ID: 1002327595

View in Genome Browser
Species Human (GRCh38)
Location 5:178420214-178420236
Sequence TTCCCCCCATTTCATAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1366
Summary {0: 1, 1: 0, 2: 21, 3: 142, 4: 1202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002327595_1002327597 -5 Left 1002327595 5:178420214-178420236 CCTCTTCTATGAAATGGGGGGAA 0: 1
1: 0
2: 21
3: 142
4: 1202
Right 1002327597 5:178420232-178420254 GGGAATAGATGCACTTCCGTGGG No data
1002327595_1002327596 -6 Left 1002327595 5:178420214-178420236 CCTCTTCTATGAAATGGGGGGAA 0: 1
1: 0
2: 21
3: 142
4: 1202
Right 1002327596 5:178420231-178420253 GGGGAATAGATGCACTTCCGTGG 0: 1
1: 0
2: 0
3: 9
4: 57
1002327595_1002327598 -4 Left 1002327595 5:178420214-178420236 CCTCTTCTATGAAATGGGGGGAA 0: 1
1: 0
2: 21
3: 142
4: 1202
Right 1002327598 5:178420233-178420255 GGAATAGATGCACTTCCGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 61
1002327595_1002327602 29 Left 1002327595 5:178420214-178420236 CCTCTTCTATGAAATGGGGGGAA 0: 1
1: 0
2: 21
3: 142
4: 1202
Right 1002327602 5:178420266-178420288 GATCAAACAAGAGCGCCCGTGGG No data
1002327595_1002327601 28 Left 1002327595 5:178420214-178420236 CCTCTTCTATGAAATGGGGGGAA 0: 1
1: 0
2: 21
3: 142
4: 1202
Right 1002327601 5:178420265-178420287 AGATCAAACAAGAGCGCCCGTGG 0: 1
1: 0
2: 0
3: 1
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002327595 Original CRISPR TTCCCCCCATTTCATAGAAG AGG (reversed) Intronic
900083185 1:874356-874378 TTCCCCCCTTTACCTAGAAAAGG - Intergenic
900565009 1:3327875-3327897 TTACCCCCATTCCACAGATGGGG + Intronic
900750158 1:4390640-4390662 TTGCCCCCATTTCAAAAAGGAGG + Intergenic
901119702 1:6881035-6881057 TTATCCCCATTTCATAGACAAGG + Intronic
901223170 1:7595656-7595678 TTGCCCCCATTTTAGAGATGGGG + Intronic
901490650 1:9594803-9594825 TTGCCCCCACTTCACAGATGTGG + Intronic
901658911 1:10786634-10786656 TTATGCCCATTTCATAGATGAGG + Intronic
901680429 1:10909855-10909877 TTGTCCCCATTTCACAGATGAGG - Intergenic
901736223 1:11313828-11313850 TGCCTCCCATTTTATAGATGGGG + Intergenic
902257754 1:15201181-15201203 TAAGCCCCATTTCACAGAAGAGG - Intronic
902287067 1:15413656-15413678 CTCTCCCCATTTGACAGAAGAGG + Intronic
902565551 1:17308857-17308879 TTATCCCCATTTCACAGATGAGG - Intronic
902633841 1:17722053-17722075 TTCCCCCCATTTCATGGAGGAGG + Intergenic
902718330 1:18288083-18288105 TTATCCCCATTTCACAGATGAGG + Intronic
902743058 1:18453595-18453617 TTCTCCTCATTTCACAGGAGGGG - Intergenic
902754799 1:18541854-18541876 ATTCCCCCATTTTCTAGAAGAGG + Intergenic
902774696 1:18667214-18667236 TTTCCCCAATTTTATAGATGAGG - Intronic
902841413 1:19076433-19076455 TTATCCCCATTTTATAGATGGGG - Intronic
902924881 1:19689500-19689522 TTTCCACCATTTCCTAGATGAGG + Intronic
902987791 1:20165970-20165992 TTAGCACCATTTCATAGATGAGG - Intronic
903012317 1:20339860-20339882 TTCTCCCCATTTTGTAGATGAGG - Intronic
903029500 1:20452748-20452770 TCCTCCCCATTTCATAGATGTGG + Intergenic
903060112 1:20663508-20663530 TTATCCCCATTTCACAGATGAGG + Intergenic
903175365 1:21577270-21577292 ATGCTCCCATTTCACAGAAGAGG - Intronic
903268460 1:22172914-22172936 TTATCTCCATTTCACAGAAGAGG + Intergenic
903295659 1:22341845-22341867 TACACCCCATTTCACAGATGAGG + Intergenic
903300866 1:22377904-22377926 TTATCCCCATTTCATAGACGAGG - Intergenic
903310089 1:22448641-22448663 TTACCCCCATTTTATACAGGAGG - Intergenic
903311622 1:22462640-22462662 ATTCCCACATTTCATAGATGAGG - Intronic
903351262 1:22717910-22717932 TTACCCCCATTTGAAAGATGAGG - Intronic
903360696 1:22775272-22775294 TTAACCCCATTTCACAGACGAGG - Intronic
903379259 1:22885564-22885586 TTCACCCCATTGGATGGAAGGGG + Intronic
903445840 1:23422772-23422794 CTCTTCCCATTTCACAGAAGAGG + Intronic
903572611 1:24317538-24317560 ATACCCCCATTTTATAGATGAGG - Intergenic
903654435 1:24940442-24940464 TTCTCCCCATTTCATAGATGAGG - Intronic
903666792 1:25012954-25012976 TTATCCCCATTTCATGGATGGGG + Intergenic
903705330 1:25281359-25281381 TTCCTCTCATTTTACAGAAGGGG - Intronic
903721896 1:25411971-25411993 TTCCTCTCATTTTACAGAAGGGG + Intronic
903831863 1:26180304-26180326 TTCTGCCCATTTCACAGATGAGG - Intronic
904028569 1:27520084-27520106 TTACCCCCATTTTACAGATGGGG - Intergenic
904130647 1:28272942-28272964 ATCTCCCCATTTCACAGATGAGG - Intronic
904133519 1:28293024-28293046 TTCTCCCCATTTTAGAGATGGGG - Intergenic
904224386 1:29003291-29003313 ATCCCCCCATTTTATAGATGAGG + Intronic
904353458 1:29923783-29923805 TTGTCCCCATTTCAAAGAGGAGG - Intergenic
904417101 1:30369856-30369878 TTACCCCCATTTTACAGATGAGG + Intergenic
904442652 1:30541655-30541677 TTCTCCCCATTTTATGGACGAGG - Intergenic
904538732 1:31218586-31218608 TTCCTCCCATTTTGCAGAAGAGG - Intronic
904626853 1:31811117-31811139 TTCTCCCCACTTCATAGAGGAGG + Intronic
904825915 1:33273601-33273623 TTCACCCCATTTTACAGAGGAGG + Intronic
904844276 1:33397074-33397096 TTATCCCCATTTCACAGATGAGG - Intronic
905005441 1:34705965-34705987 TTGCTCCCATTTCACAGAAGAGG + Intergenic
905304539 1:37008303-37008325 TTGCTCCCATTTTATAGATGAGG - Intronic
905345631 1:37309293-37309315 TTCTCCCCATTTTAGAGATGGGG + Intergenic
905859522 1:41340795-41340817 TTATCCCCATTTTATAGATGAGG + Intergenic
905914144 1:41673444-41673466 TTACCCCCATTTCATAGGAGGGG + Intronic
906334494 1:44917028-44917050 TTCCCAACATTTAATACAAGAGG - Intronic
906653574 1:47532066-47532088 TTACCCCCATTTTACAGATGAGG - Intergenic
906695791 1:47822689-47822711 TTATCCCCATTTCAGAGATGAGG + Intronic
906789023 1:48642548-48642570 ATCCCCACATTTCAAAGATGGGG + Intronic
906943347 1:50275109-50275131 TTCACTCCATCTCATAGATGAGG - Intergenic
907013119 1:50983607-50983629 TTACCCCCATTTCACAGATGTGG - Intergenic
907052752 1:51340784-51340806 TTACCCCCATTTTACAGATGAGG + Intronic
907158795 1:52356816-52356838 ATCACCCCATCTCATAGATGAGG + Intronic
907170952 1:52464093-52464115 TTTCCCCCATTTTACAGATGAGG - Intronic
907191041 1:52649278-52649300 TTACCCCCATTTTATAGCAGAGG + Intronic
907238822 1:53069533-53069555 GTACCCCTATTTCCTAGAAGGGG - Intronic
907332989 1:53683487-53683509 TTCTCCCCATTTCACAGATGAGG - Intronic
907355385 1:53868402-53868424 TTCTTCCCATTTTATAGATGAGG - Intronic
907356226 1:53876714-53876736 TTATCCCCATTTTATAGATGAGG - Intronic
907386689 1:54130080-54130102 TTGCCCCCATTTTACAGATGGGG - Intergenic
907474235 1:54694952-54694974 TTATCCCCATTTCATAGATGAGG - Intronic
907499383 1:54867193-54867215 CTACCCCCATTTCACAGAGGAGG - Intronic
907513664 1:54980345-54980367 TCACCCCCATTTTATAGAAAGGG - Intergenic
907515131 1:54988953-54988975 TTCACCCCAGTTGAGAGAAGAGG - Intronic
907515882 1:54993227-54993249 TTCACCTCCTTTCATGGAAGTGG - Intergenic
907645401 1:56237401-56237423 TTAACCCCATTTTATAGACGAGG - Intergenic
908080180 1:60568928-60568950 TTACTTCCATTCCATAGAAGAGG + Intergenic
908098376 1:60764273-60764295 TTTTCCCCATTTCATAGAGAGGG - Intergenic
908427278 1:64019386-64019408 TTCTCCCCATTTTACAGATGGGG - Intronic
908436906 1:64115828-64115850 CTCCTCCCATTTAATAGATGAGG - Intronic
908650058 1:66322876-66322898 TTACCCCCATTTTAGAGATGAGG + Intronic
908685833 1:66718528-66718550 TTATTCCCATTTTATAGAAGAGG - Intronic
909494569 1:76264120-76264142 TTCCCCACATTTTACAGATGAGG + Intronic
910123678 1:83817733-83817755 TTCACGCCATTTCATAGGTGAGG - Intergenic
910334183 1:86109480-86109502 TTCTCCCCATTTTACAGAAAAGG + Intronic
910406197 1:86893112-86893134 TTATCCCTATTTAATAGAAGAGG - Intronic
910489561 1:87754040-87754062 TCCCCCCCGTTTAATAGAAGAGG + Intergenic
910498382 1:87859856-87859878 ATTGCCCCATTTCATAGATGAGG + Intergenic
910688956 1:89946701-89946723 TTAACCCCATTTCACAGATGAGG - Intergenic
910789599 1:91037385-91037407 TTATCCCCATTTTATAGATGAGG - Intergenic
911028447 1:93459892-93459914 CTCCAACCATTTCAGAGAAGGGG - Intronic
911501185 1:98687174-98687196 TTACCCCCATTTCATGCACGAGG + Intronic
911542580 1:99175885-99175907 TTATCCCCATTTTATAGATGGGG + Intergenic
912452127 1:109773681-109773703 TTGTCTCCATTTCATAGATGAGG - Intronic
912455039 1:109791625-109791647 TTCACCCCATTTTACAGATGAGG + Intergenic
912716160 1:111985101-111985123 TGTCCCCCATTTCATAGATAAGG + Intronic
912794972 1:112687811-112687833 TTCCTCCAATTTTATAGAGGAGG + Intronic
912954720 1:114146845-114146867 TTACCCCCAATTTATAGATGAGG - Intronic
913089892 1:115469508-115469530 TTATCCCCATTTTATAGATGTGG - Intergenic
913157588 1:116115117-116115139 TTATCCCCATTTTATAGATGAGG - Intronic
913465335 1:119135551-119135573 TTCATCCCATTTTATAAAAGAGG - Intronic
914214453 1:145612325-145612347 TTCCTCCCATTTCAGAAAACGGG + Intronic
914466392 1:147932719-147932741 TTCCTCCCATTTCAGAAAACGGG + Intronic
914499123 1:148228740-148228762 GTGTCCACATTTCATAGAAGAGG + Intergenic
915163565 1:153935724-153935746 TTATCCCCATCTTATAGAAGAGG - Intronic
915191438 1:154154249-154154271 TTACTCCCATTTCACAGACGAGG - Intronic
915548942 1:156620958-156620980 TTCCCCACATTTCACTGATGAGG + Intronic
915896179 1:159812981-159813003 TTATCTCCATTTCATAGATGAGG - Intronic
915897695 1:159824399-159824421 TGCTCCCCATTTCACAGATGAGG + Intergenic
916365544 1:164023138-164023160 TCCCCCCCATTTCTTCGAACTGG + Intergenic
916602064 1:166302923-166302945 TTATCCCCATTTTACAGAAGAGG + Intergenic
916715569 1:167444109-167444131 TACCCTCCATTTAATAGATGAGG - Intronic
916786394 1:168090111-168090133 GTACCCCCATTTCACAGATGGGG + Intronic
917249908 1:173047305-173047327 TTTCTCCCATTTTATAGATGAGG - Intronic
917256512 1:173121989-173122011 TTATCCCCATTTCAGAGATGGGG + Intergenic
917694056 1:177501431-177501453 TTACCCTCATTTTACAGAAGAGG + Intergenic
918384212 1:183989002-183989024 TTATCCCCATTTTACAGAAGAGG + Intronic
918501656 1:185202383-185202405 TTACCCCCATTTCACAGATGGGG - Intronic
918520648 1:185411405-185411427 TTACCCCCACTTTATAGATGGGG - Intergenic
918549563 1:185726701-185726723 TGATCCCCATTTCATAGAAGAGG - Intergenic
918556468 1:185806185-185806207 TTACCCCCATTTCATAGATGAGG + Intronic
919842205 1:201617913-201617935 TTCCCCTCATTTCAGAGGAAGGG + Intergenic
920304712 1:205011172-205011194 TTCTCCCCATCTCTTAGAACAGG + Intronic
920373886 1:205496206-205496228 TTACCCCCATTTTACAGATGAGG + Intergenic
920512329 1:206560383-206560405 GTCTCCCCATTTCATAGGAAGGG + Intronic
921132391 1:212230864-212230886 TTCCCTCCATTTTATAGATGGGG + Intergenic
921212982 1:212915827-212915849 TGTCTCCCATTTCACAGAAGTGG - Intergenic
921308196 1:213817711-213817733 TTATTCCCATTTTATAGAAGAGG - Intergenic
921637782 1:217516262-217516284 TTCCCCCCATTCTATATAAATGG - Intronic
921651166 1:217680274-217680296 TTAGCCTCATTTGATAGAAGAGG - Intronic
922140207 1:222877128-222877150 TTATCCCCATTTTATAGATGAGG - Intronic
922285750 1:224169134-224169156 TTTCCCCCATTTCATGTATGAGG - Intergenic
922580790 1:226696207-226696229 TTATCCCCATTTCACAGATGTGG - Intronic
922902723 1:229149799-229149821 TTCTCCCTATTTCACAGATGAGG + Intergenic
922954988 1:229591624-229591646 TTAACCCCATTTCACAGATGAGG - Intergenic
922992012 1:229922220-229922242 TTGCCCCCATTTTACAGAAGAGG + Intergenic
923035991 1:230285458-230285480 CTCCTCCCATGTCATGGAAGTGG + Intergenic
923059223 1:230455278-230455300 TCACCCCCATTTGATAGAAAAGG + Intergenic
923189428 1:231606330-231606352 TTACCCCCATTTCACAAATGGGG - Intronic
923204031 1:231740614-231740636 TTCTAAGCATTTCATAGAAGAGG - Intronic
923256737 1:232228236-232228258 TTCTCCCCATTTTACAGTAGGGG + Intergenic
923614755 1:235527627-235527649 TTGCTCCCATTTTATAGATGAGG - Intergenic
923824356 1:237483417-237483439 TTACATCCATTTCATAGAGGTGG + Intronic
924121878 1:240808509-240808531 TTTCCCTCATTTTAGAGAAGAGG + Intronic
924464143 1:244284970-244284992 CTCACCCCATTTCACAGATGGGG + Intergenic
924563946 1:245180432-245180454 TTCTCCCCATTTTACAGATGTGG - Intronic
1062763867 10:47028-47050 TTCCCCCCTTTACCTAGAAAAGG + Exonic
1063622844 10:7665462-7665484 TTCTCCACATTTCACAGAAGAGG + Intronic
1063826368 10:9903015-9903037 TTATCTCCATTTCACAGAAGGGG + Intergenic
1063946241 10:11179001-11179023 TTGCCCCCATTTCACAGAAAAGG + Intronic
1064219237 10:13425564-13425586 TTGCTCCCATTTCACAGATGAGG + Intergenic
1064670820 10:17712221-17712243 TTACCCCCATTTTATAGATGGGG + Intronic
1065367268 10:24949014-24949036 TGCTCCCCATTTTACAGAAGAGG - Intronic
1065451282 10:25860663-25860685 TTCCCCCCATTTAATAGTATTGG - Intergenic
1067087382 10:43250092-43250114 TTCACCACATTTTCTAGAAGTGG - Intronic
1067217994 10:44318557-44318579 TTCCCCCCATGTTATAGAGGGGG + Intergenic
1068784206 10:60952495-60952517 TTATCCCCATTTTATAGATGAGG + Intronic
1068965407 10:62906994-62907016 ATACCCCCTTTTCATGGAAGAGG + Intronic
1069090626 10:64195784-64195806 TTACCCCCATTTAAAAGATGAGG - Intergenic
1069422048 10:68255346-68255368 TTAACCCCATTTTATAGATGAGG - Intergenic
1069549446 10:69352642-69352664 TTCCAGACATTTCATATAAGTGG - Intronic
1069664056 10:70143348-70143370 TTAGCCCCATTTCAAAGACGTGG + Intronic
1069678347 10:70265775-70265797 TCCTCCCCATTTTATGGAAGAGG - Intronic
1069715317 10:70517141-70517163 TTGTTCCCATTTCACAGAAGTGG + Intronic
1069919912 10:71810258-71810280 TTGGCCCCATTTTATGGAAGAGG - Intronic
1069951423 10:72021086-72021108 TTATCCCCATTTCACAGATGAGG - Intergenic
1069952335 10:72027705-72027727 TTCCTCCCATTTGAGATAAGGGG - Intergenic
1070625270 10:78046685-78046707 TTACCCCCATTTTATAGATGAGG + Intronic
1070722632 10:78767366-78767388 TTCAACCCATTTCATAGATATGG + Intergenic
1070778354 10:79123355-79123377 TTCTCCCCATTTTACAGATGAGG - Intronic
1070808521 10:79285436-79285458 TCAGCCCCATTTCATAGATGAGG + Intronic
1071028482 10:81143646-81143668 TTACCCCCATTTGACAGATGGGG - Intergenic
1071195251 10:83151613-83151635 ATCTCCCCATTTTACAGAAGAGG - Intergenic
1071371327 10:84954516-84954538 TTGTCCCCATTTTAAAGAAGAGG + Intergenic
1071522307 10:86338928-86338950 TTATCCCCATTTTATAGATGAGG + Intronic
1071529317 10:86377061-86377083 TTGCCCACATTTCACAGATGGGG + Intergenic
1072023018 10:91423301-91423323 TACACCCCATTTTATAGATGGGG - Intronic
1072104632 10:92262444-92262466 TTATCCCCATTTCACAGATGAGG + Intronic
1072234285 10:93439635-93439657 TTATCCCCATTTTATAGATGAGG - Intronic
1072239640 10:93483555-93483577 TTATCCCCAGTTCATAGATGAGG - Intergenic
1072619000 10:97067636-97067658 TTGCGCCCATTTCACAGAGGAGG + Intronic
1073038208 10:100579082-100579104 TTATTCCCATTTCATAGATGAGG - Intergenic
1073181940 10:101588705-101588727 TTCACCCCGTTTTACAGAAGAGG + Intronic
1073274555 10:102298689-102298711 TTATCCCCATTGTATAGAAGAGG + Intronic
1073311244 10:102543853-102543875 TTATCCCCATTTTATAGATGAGG + Intronic
1073571135 10:104581951-104581973 TTGCTCCCATTTCATAGACAGGG + Intergenic
1073596047 10:104801197-104801219 TTCCCCCATTTTCACAGATGAGG - Intronic
1073664964 10:105521201-105521223 TTACCTCCATTTTATACAAGAGG - Intergenic
1073819146 10:107240088-107240110 TTACGCCCATTTTATAGATGAGG - Intergenic
1074259178 10:111834666-111834688 TTACCCCCATTTTATAGATGAGG + Intergenic
1074410190 10:113221596-113221618 CTATCCCCATTTCATAGATGTGG - Intergenic
1074437015 10:113442721-113442743 TTCCCAGAATTTCATAGAACAGG - Intergenic
1074561134 10:114536156-114536178 TTCCACACATTTCATACAAATGG + Intronic
1074680972 10:115907060-115907082 TTATCCCCATTTCCTAGATGAGG + Intronic
1074933245 10:118151179-118151201 TTTTCCCCATTTCCCAGAAGAGG + Intergenic
1075279688 10:121129002-121129024 TTATCCCCATTTTATAGAAGTGG + Intergenic
1075444389 10:122503655-122503677 TTCCCCCCATTTTAAAGATGTGG - Intronic
1075563752 10:123488099-123488121 TTCTGCCCATTTCAGAGATGTGG - Intergenic
1076105103 10:127815746-127815768 TTGTCCCCATTTCACAGAAGTGG - Intergenic
1076159936 10:128235951-128235973 TTACCCCCATTTTACAGATGAGG + Intergenic
1076192752 10:128494396-128494418 GCCCACCCATTTCATAGAAGAGG - Intergenic
1076540800 10:131213575-131213597 TTGTCCCCATTCCATAGACGGGG - Intronic
1077098180 11:808798-808820 TTACCCCCATTTTATAGATGAGG - Intronic
1077497643 11:2894122-2894144 TTGTCCCCATTTCACAGATGGGG + Intronic
1077631947 11:3816965-3816987 TTATTCCCATTTCACAGAAGGGG - Intronic
1077703013 11:4459055-4459077 TTCCCCCACTTTCAAAGGAGAGG - Intergenic
1078339127 11:10486515-10486537 TTCCCACCAACTCAGAGAAGGGG - Intronic
1078416695 11:11171900-11171922 TTGCCTCCATTTCACAGATGAGG + Intergenic
1078447870 11:11418294-11418316 TTCTCCCCATCTCATAGATGAGG - Intronic
1078565823 11:12413179-12413201 TTATCTCCATTTCATAGATGAGG + Intronic
1078609579 11:12808838-12808860 TTCTCCCCATTTTACAGAAAAGG - Intronic
1078628152 11:12977312-12977334 TTATCCCCATTTTATAGATGAGG - Intergenic
1078800388 11:14638091-14638113 TTATCCCCATTTCACAGATGAGG + Intronic
1079111459 11:17607510-17607532 TTACCCCCACTTTAGAGAAGAGG - Intronic
1079313012 11:19382759-19382781 TTCCACCCATTTTATAGATGAGG + Intronic
1079338826 11:19595458-19595480 TTATCCCCATTTTATAGATGAGG + Intronic
1079359403 11:19758092-19758114 TCCCCTCCACTTCATAGATGAGG + Intronic
1079924197 11:26472408-26472430 TTACCCCCATTTCATAGGTGAGG + Intronic
1080024620 11:27600337-27600359 TTTCCCCCACTTAATAGATGAGG - Intergenic
1080157427 11:29128183-29128205 TTTCCCCCATTTTATAGAAGAGG + Intergenic
1080401861 11:31943577-31943599 TTACCCCCATTTTACAGATGAGG + Intronic
1080420116 11:32102251-32102273 TTTCCCCCATTTTACAGATGAGG - Intronic
1080453572 11:32398687-32398709 TTCTCTCCATTTCATGGATGGGG - Intronic
1080865721 11:36193141-36193163 TTACCCCCATTTTACAGATGAGG - Intronic
1081584989 11:44378063-44378085 TTCTCCCCATTTTACAGATGAGG - Intergenic
1081630701 11:44687742-44687764 TTACCCCCGTTTCACAGACGAGG + Intergenic
1081738026 11:45418031-45418053 TTCCCCCTATTTCAGAGATGAGG - Intergenic
1081739940 11:45431792-45431814 CTGTCCCCATTTCATAGATGAGG + Intergenic
1081753213 11:45526937-45526959 GTTACCCCATTACATAGAAGGGG - Intergenic
1081986893 11:47311627-47311649 TTCCCACCATCTGAGAGAAGTGG - Intronic
1082268751 11:50146731-50146753 TTCCCCCCACTTTAAAGATGGGG + Intergenic
1082287372 11:50332335-50332357 TTCCTCCCATTTTAAAGATGGGG - Intergenic
1082774571 11:57235592-57235614 TTTCCCCCATTTCATACCAATGG + Exonic
1082803881 11:57434317-57434339 TTATCCCCAATTCAGAGAAGGGG - Intergenic
1083115592 11:60456307-60456329 TTGCCCCCATTTTATAGATGAGG - Intronic
1083190888 11:61051521-61051543 TTCTCCCCATTTCACAGATGAGG - Intergenic
1083629585 11:64088698-64088720 TTATCCCCATTTCATAGACAGGG - Intronic
1083657286 11:64235611-64235633 TTCTACCCATTTCACAGAGGAGG + Intronic
1083680423 11:64349171-64349193 TTGCTCCCATTTTATAGATGGGG + Intronic
1083773413 11:64880714-64880736 TTCCCCCAATTTCATGGAGTTGG + Intronic
1084069072 11:66722246-66722268 TTGTCCCCATTTCATAGATGAGG + Intronic
1084070677 11:66732169-66732191 TTAACCCCATTTCACAGATGAGG + Intergenic
1084099216 11:66934436-66934458 CTACCCCCATTTTATAGATGAGG - Intronic
1084489095 11:69468710-69468732 TTTCCCCCATTCCACAGAGGAGG + Intergenic
1084521943 11:69668614-69668636 TGCCCCCCATTTTACAGATGAGG - Intronic
1084616185 11:70237486-70237508 TTACCACCATTTTAAAGAAGGGG - Intergenic
1084776212 11:71378100-71378122 TTCCCCTCGTTTTATAGATGAGG + Intergenic
1084960771 11:72715164-72715186 TAGCCCCCGTTTCACAGAAGAGG - Intronic
1085038572 11:73313814-73313836 TTACCCCCATTTTATGGAAGGGG - Intronic
1085309544 11:75508045-75508067 TTCCCTCCATTTTATAGGACAGG + Intronic
1085347986 11:75780459-75780481 TTACCCCCATTTCATAGATGGGG + Intronic
1085370251 11:75996700-75996722 TTCTCCCCATTTTACAGATGAGG + Intronic
1085395295 11:76204001-76204023 TTACCCCCGTTGCACAGAAGAGG - Intronic
1085450193 11:76627220-76627242 TTATCCCCATTTTATAGATGAGG - Intergenic
1085614246 11:77983122-77983144 TTACCCCCATTTCACAGATAAGG - Intronic
1085625410 11:78068052-78068074 TTATCCCCATTTTATAGATGAGG - Exonic
1085709975 11:78820461-78820483 TTCACCCCATTTCACAAATGAGG - Intronic
1085776661 11:79372674-79372696 CCCCTCCCATTTCACAGAAGAGG - Intronic
1085792440 11:79507588-79507610 TAACCCCCATTTCACAGAAAAGG - Intergenic
1085931334 11:81087002-81087024 TTACCCCCATTTTATAGACAAGG - Intergenic
1085951039 11:81331660-81331682 TTCCCACAGTTACATAGAAGGGG - Intergenic
1086059372 11:82684570-82684592 TTATCCCCATTTCAGAGAGGTGG + Intergenic
1087159284 11:94933584-94933606 TTTTCTCCATTTCATAGATGAGG + Intergenic
1087261452 11:96017157-96017179 TTCCTCCCATTTCATAGATGAGG + Intronic
1087284949 11:96255368-96255390 TTATCCCCATTTTACAGAAGAGG + Intronic
1087595788 11:100253447-100253469 TTATCCCCATTTCATAGAGGAGG - Intronic
1087654929 11:100911059-100911081 TTTCTCACTTTTCATAGAAGAGG - Intronic
1087747873 11:101970837-101970859 TTACGCCCATTTTATAGATGAGG + Intronic
1088533110 11:110831955-110831977 TCACCCCCATTTCATAGCATCGG - Intergenic
1088571804 11:111230116-111230138 TTCTCCCCATTTCTCAGATGAGG + Intergenic
1089288207 11:117421099-117421121 ATTCTCGCATTTCATAGAAGCGG + Intergenic
1089740439 11:120578567-120578589 TTCCCTCCCTTCCATAGAGGGGG + Intronic
1089964937 11:122648012-122648034 TTGCCCACATTGCATAGATGGGG - Intergenic
1089995031 11:122898433-122898455 TTACCCCCATTTAACAGACGAGG - Intronic
1090253159 11:125264867-125264889 GTCCTCCCATTTCACAGATGGGG - Intronic
1090388007 11:126367637-126367659 TTACCCCCATTTAAAAGACGAGG + Intronic
1090577622 11:128124502-128124524 TTCCGGCCATTTCATATAAATGG - Intergenic
1090704075 11:129320805-129320827 ATCCCCTCATTTCATAGTTGAGG - Intergenic
1090855097 11:130603977-130603999 TTATCCCCATTTTATAGATGAGG - Intergenic
1090953353 11:131493653-131493675 GTACCCCCATTTCACAGATGGGG + Intronic
1090954908 11:131505122-131505144 TTACCCCTATTTCTTAGATGAGG - Intronic
1091122326 11:133066376-133066398 AACCTCCCCTTTCATAGAAGAGG + Intronic
1091651846 12:2316297-2316319 TTCTCCCCATTTTACAGATGTGG - Intronic
1091813697 12:3420340-3420362 TTATCCCCATTTCACAGATGAGG - Intronic
1092117144 12:6017679-6017701 TTATCCCCATTTTATAGATGAGG + Intronic
1092261297 12:6954600-6954622 TTACCCCCATTTTATAGATGAGG - Intronic
1092599735 12:10046892-10046914 TTAAACCCATTTCATAGATGAGG - Intronic
1092845159 12:12578062-12578084 TTAACCCCATTTTATAGATGAGG - Intergenic
1092879059 12:12873772-12873794 TTATCCCCATTTCATAGCTGAGG + Intergenic
1092899326 12:13044177-13044199 TTCTCCCCATTTCACTGACGAGG + Intergenic
1092982142 12:13807342-13807364 TTCACACCACTTCATATAAGAGG + Intronic
1093203413 12:16217556-16217578 TTATTCCCATTTCATAGAGGAGG - Intronic
1093374052 12:18402296-18402318 TTCTGCACATTTCATACAAGTGG - Intronic
1093705575 12:22271537-22271559 TTCACCCCATTTTATAGATGAGG - Intronic
1093980291 12:25468345-25468367 CTCCACCCATTTTATAGATGGGG - Intronic
1094114652 12:26897526-26897548 TTCCCACCATTCCATGGAAATGG + Intergenic
1094140622 12:27177969-27177991 TTATCCCCATTTTATAGATGAGG - Intergenic
1094474555 12:30831388-30831410 TTAACCCAATTTCATAGAAAGGG - Intergenic
1095353375 12:41241556-41241578 TTATCCCCATTTTATAGATGAGG - Intronic
1095422028 12:42034124-42034146 TTATCCCCATTTTAAAGAAGAGG + Intergenic
1095627379 12:44332190-44332212 TTACCCCCATTTTATAGATATGG - Intronic
1095970296 12:47897162-47897184 TTATACCCATTTTATAGAAGAGG - Intronic
1096202031 12:49691161-49691183 TTATCTCCATTTTATAGAAGAGG - Intronic
1096411707 12:51381683-51381705 TTGCCCCCACTTTATAGATGAGG - Intronic
1096463343 12:51834906-51834928 TTCTCCCCATTTTATAGAAGAGG + Intergenic
1096519590 12:52176990-52177012 TTGTCCCCATTTTATAGATGGGG + Intronic
1096681540 12:53258671-53258693 TCCTCCCCATTTCACAGATGAGG - Intergenic
1097202401 12:57290480-57290502 TTTTCCCCATTTTATAAAAGAGG - Intronic
1097818262 12:64099206-64099228 TTCCCCCTATTTTATAGGTGAGG - Intronic
1097849112 12:64394215-64394237 TTATCTCCATTTCATAGATGGGG - Intergenic
1098092968 12:66923763-66923785 TTACTCCCATTTTATAGATGAGG - Intergenic
1098159742 12:67638615-67638637 TTTCCCCCATTTTAGAGATGAGG - Intergenic
1098927898 12:76372979-76373001 TTGTCCCCATTTTACAGAAGAGG - Intronic
1098933247 12:76446050-76446072 TTCCCCCCATTTTACAAATGAGG - Intronic
1099039797 12:77637594-77637616 TTATCCCCATTTTACAGAAGTGG + Intergenic
1099326292 12:81219098-81219120 TTTCTCCCATTTCATAGACAGGG + Intronic
1099353415 12:81603175-81603197 TTCTCCCCATTTCATAAGTGAGG - Intronic
1099413806 12:82362382-82362404 TTACCCCCATTTTACAGATGAGG - Intronic
1099657371 12:85510179-85510201 TTCCCAGCTTTTCATAAAAGAGG - Intergenic
1099947686 12:89263507-89263529 TTCCCCCCATCTCTGAGAACTGG - Intergenic
1100379389 12:94047473-94047495 TTATTCCCATTTCATAGAGGAGG - Intergenic
1100619548 12:96258071-96258093 TTCTCCCCATTTTACAGATGAGG + Intronic
1100767632 12:97885269-97885291 TTACCTCCATTTCACAGATGAGG + Intergenic
1100889568 12:99109555-99109577 TTATCTCCATTTCATAGAGGAGG - Intronic
1100889771 12:99112096-99112118 TCATCCCCATTTTATAGAAGAGG + Intronic
1101039107 12:100736378-100736400 TTTCCCCCATTTTATAAATGAGG + Intronic
1101065562 12:101016860-101016882 TTATCCCCATTTCACAGATGAGG + Intronic
1101129675 12:101675678-101675700 GTGCCCCCATTACATAGATGAGG - Intronic
1101157177 12:101938905-101938927 TTACCCCCACTTTATAGATGGGG + Intronic
1101248448 12:102908087-102908109 TTACACCCATTTTACAGAAGAGG - Intronic
1101317942 12:103646532-103646554 TTAAACCCATTTTATAGAAGAGG + Intronic
1101394757 12:104336809-104336831 TTTCCCCCTTTTTATAGATGAGG + Intronic
1101652904 12:106693971-106693993 TTATCCCCATTTCACAGAAGGGG + Intronic
1101662190 12:106775349-106775371 TCCTCCCCATTTTATAGATGAGG + Intronic
1101700392 12:107168516-107168538 TTACTCCCATTTCACAGAGGAGG - Intergenic
1101732862 12:107440917-107440939 TTTCTCCCATTTTATAGATGAGG + Intronic
1101742919 12:107515074-107515096 TCACCCCCATTTCACAGAAGAGG + Intronic
1101844702 12:108353497-108353519 TTCCTGACATTTCATAGAAATGG - Intergenic
1101878370 12:108610046-108610068 TTCTCCCCATTTCCTAGGTGAGG + Intergenic
1101926183 12:108973218-108973240 TTCTCCCCATTTCACAGATAAGG + Intronic
1102025383 12:109711636-109711658 TACCCTCCATTTCATGGCAGGGG + Intergenic
1102059561 12:109922506-109922528 TTCTCCACATTTCACAGAACTGG - Intronic
1102077459 12:110071251-110071273 TTCTCCCCATTTTACAGATGAGG + Intronic
1102117379 12:110413328-110413350 TCTCCCCCGTTTCACAGAAGGGG - Intergenic
1102135361 12:110569498-110569520 TGCCCCTCATTTCACAGATGAGG - Intronic
1102205683 12:111089325-111089347 CTCCCCCCATTTCTCAGATGGGG - Intronic
1102512465 12:113425086-113425108 TTATCCCCATTTTAGAGAAGGGG + Intronic
1102514009 12:113434562-113434584 TTATCCCCATTTCATAGGTGAGG + Intronic
1102522310 12:113486069-113486091 TTCCATCCATTTCACAGATGAGG + Intergenic
1102556523 12:113730433-113730455 TCCCTCCCATTTCACAGATGAGG + Intergenic
1102782892 12:115580846-115580868 TTCTCCCCACTTCATGGATGAGG + Intergenic
1102878374 12:116465536-116465558 TTATCCCCATTTCACAGATGAGG + Intergenic
1102895342 12:116594241-116594263 CTGTCCCCATTTCATGGAAGAGG + Intergenic
1102914225 12:116740817-116740839 ATCACCCCATTTCACAGAGGAGG - Intronic
1103025262 12:117568588-117568610 TTACCCCCATTTTACAGACGAGG - Intronic
1103028551 12:117593646-117593668 TTGCCCCCATTTTACAGAGGAGG - Intronic
1103039021 12:117679342-117679364 TTATACCCATTTCATAGATGGGG + Intronic
1103124919 12:118413458-118413480 TTGGCCCCATTTTAAAGAAGAGG - Intronic
1103244397 12:119443852-119443874 TTGTCCCCATTTCATAGATGAGG - Intronic
1103355956 12:120320469-120320491 TTGCTCCCATTTCATGGATGTGG - Intergenic
1103441574 12:120966744-120966766 TTATCCCCATTTCACAGATGCGG - Intergenic
1103443053 12:120977974-120977996 TTATCCCCATTTTATAGAGGAGG - Intergenic
1103444131 12:120982967-120982989 TTAGCCCCATTTCACAGATGCGG + Intronic
1103751106 12:123162485-123162507 TTATCCCCGTTTTATAGAAGAGG + Intronic
1103917416 12:124383200-124383222 TTGTCCCCATTTCACAGATGGGG + Intronic
1103920852 12:124398473-124398495 ATCACCCCATTTTATAGAAGGGG + Intronic
1103931007 12:124450860-124450882 TTAACCCCATTTTATAGATGAGG - Intronic
1103964902 12:124632449-124632471 TTAGCCCCATTTCATGGACGAGG - Intergenic
1104055532 12:125227340-125227362 TTATCCCCATTTTATAGATGGGG + Intronic
1104074538 12:125377501-125377523 TTACCCTCATTTTATAGCAGGGG - Intronic
1104158094 12:126152655-126152677 TTTCCCCCATATCATAGATAAGG + Intergenic
1104202240 12:126600849-126600871 TTAGCCCCATTTAGTAGAAGTGG + Intergenic
1104387922 12:128366706-128366728 ATCCCCAAATTTCATAGATGAGG - Intronic
1104423747 12:128657956-128657978 TTATCCCCATTTCACAGATGAGG + Intronic
1104485807 12:129150530-129150552 CTAGCCCCATTTCACAGAAGAGG + Intronic
1104613002 12:130244837-130244859 TTATCCCCATTTCATAGATCAGG + Intergenic
1105440418 13:20410789-20410811 TTGTCCCCATTTCACAGATGGGG + Intronic
1105831331 13:24165177-24165199 TTCCACCCATTTCCCTGAAGCGG + Intronic
1106326836 13:28699518-28699540 TTCTCCTCATTTTACAGAAGAGG - Intergenic
1106635749 13:31526847-31526869 TTATCCCCATTTTATAGATGAGG + Intergenic
1107061386 13:36163184-36163206 TTACTCCCATTTTACAGAAGAGG + Intergenic
1107602643 13:42029094-42029116 TTATCCCCATTTTATAGATGAGG - Intergenic
1107736216 13:43401017-43401039 TTAACCCCATTTTATAGATGAGG - Intronic
1107780704 13:43899054-43899076 ATCCCCACATGTCAGAGAAGGGG - Intergenic
1108026742 13:46185742-46185764 TTACCCCCATTTTATAGACTAGG - Intronic
1108097074 13:46913753-46913775 GCCACCCCATTTTATAGAAGAGG - Intergenic
1108278823 13:48840358-48840380 TTTGCCCTATTTCATACAAGTGG + Intergenic
1108283438 13:48882046-48882068 TTGTCCCCATTTTATAGATGGGG - Intergenic
1109276530 13:60310034-60310056 TTGCCCCCATTTCATAGATGAGG - Intergenic
1111781283 13:92728570-92728592 TACCCCCGTTTTCCTAGAAGTGG - Intronic
1111887873 13:94045951-94045973 TTGTCCCCATTTTACAGAAGAGG + Intronic
1112461124 13:99604799-99604821 ATACCCCCATTTTATAGATGAGG + Intergenic
1112797725 13:103075197-103075219 TTCCCCTTACTTAATAGAAGTGG + Intergenic
1113582117 13:111437289-111437311 TTATCCCCATTTCACAGATGGGG + Intergenic
1113725968 13:112602032-112602054 TTCTCCCCATTTTTTAGAAGTGG + Intergenic
1114537926 14:23434628-23434650 TTCACCCCATTTGACAGATGAGG + Intronic
1115304080 14:31915881-31915903 TTCTCCCCATTTTACAGAAGAGG - Intergenic
1115347074 14:32354397-32354419 TTATCCCCATTTCACAGAATGGG - Intronic
1115406341 14:33021311-33021333 TTATCCCCATTTTACAGAAGAGG + Intronic
1115502622 14:34062990-34063012 TTATCCCCATTTCACAGAAGAGG - Intronic
1116409768 14:44607648-44607670 TTCTTCCCATTTTATAGATGGGG + Intergenic
1116649673 14:47573554-47573576 TTTCCCCCATTTCACAGATAAGG - Intronic
1116999170 14:51354846-51354868 TTATCCCCATTTTATAGATGAGG + Intergenic
1117212748 14:53518018-53518040 CTTCTCCCATTTCACAGAAGAGG + Intergenic
1117487902 14:56217178-56217200 GTCTCCCCTTTTCATAGAGGAGG + Intronic
1117556702 14:56893663-56893685 TTGCCCCCATTTTATAGCTGAGG - Intergenic
1117746963 14:58879460-58879482 TTATGCCCATTTTATAGAAGAGG - Intergenic
1117959692 14:61150496-61150518 TTGCCCCCATTTCACAGATGAGG + Intergenic
1118118145 14:62804713-62804735 TTATCCCCATTTCACAGATGAGG - Intronic
1118119225 14:62819384-62819406 TTCTTCTCATTTCATATAAGTGG - Intronic
1118138083 14:63049676-63049698 TTATCCCCATTTTATAGAAAGGG - Intronic
1118304415 14:64643305-64643327 TTCCTCCCACTTCATTGCAGTGG - Intergenic
1118390053 14:65288159-65288181 TTCCCTCCCCTTCATAGAAATGG + Intergenic
1118596474 14:67439174-67439196 TTATCCCCATTTCACAGACGGGG - Intergenic
1118707008 14:68489524-68489546 TTTCCCCCATTTTACAGAAATGG - Intronic
1119180583 14:72602418-72602440 TTCTCCCCATTTCTCAGACGAGG + Intergenic
1119191598 14:72686408-72686430 TTACCCCCGTTTTATAGATGAGG + Intronic
1119236256 14:73021991-73022013 TTCCCCTCATTTGACAAAAGTGG + Intronic
1119270539 14:73300283-73300305 ATCCCTCCATTTCATAGGAATGG - Intronic
1119308208 14:73624776-73624798 TTACGCCCATTTCATAGATGAGG - Intergenic
1119397628 14:74339265-74339287 CTCGCCCCATTTCACAGATGAGG + Intronic
1119582021 14:75793584-75793606 TTCTCCCCATTTTACAGATGGGG + Intronic
1119667535 14:76496060-76496082 TTCTCCCTATTTCACAGATGAGG - Intronic
1119730962 14:76950905-76950927 TTCTCCCCATTTCACACATGAGG + Intergenic
1120108893 14:80529116-80529138 TTTCACCCATTTTATAGATGAGG - Intronic
1120147668 14:80997105-80997127 TTGCTCCCATTTTACAGAAGAGG + Intronic
1120918348 14:89730295-89730317 TTATCCCCATTTCACAGATGAGG - Intergenic
1121013001 14:90533028-90533050 TTCTCCCCATTTCACAGATGAGG + Exonic
1121262256 14:92574989-92575011 TTATCCCCATTTTATAGATGAGG - Intronic
1121272981 14:92650341-92650363 TTGCCCCCAGTTCACAGATGAGG - Intronic
1121305839 14:92906525-92906547 TTACCCCCATTTCACAGGGGTGG + Intergenic
1121419451 14:93802492-93802514 TTGCCACCATTTTATAGATGAGG + Intergenic
1121698602 14:95933697-95933719 TTCCCTCCATCTTATAGATGAGG - Intergenic
1121817951 14:96942897-96942919 TTCTCCCCATTTTATGGACGAGG + Intergenic
1122044571 14:99014211-99014233 TCGCCCCCATTTTATAGATGAGG - Intergenic
1122234107 14:100322478-100322500 TGCTCCCCATTTCACAGATGGGG - Intergenic
1122287918 14:100663352-100663374 TTGTCCCCATTTCACAGATGAGG + Intergenic
1122406893 14:101506105-101506127 TTCTCCCCATTTGACAGATGTGG + Intergenic
1122415124 14:101545774-101545796 TCACCCCCATGTCACAGAAGAGG + Intergenic
1122587330 14:102818047-102818069 TTCCCACCCTTTCAGAGATGAGG + Intronic
1122734629 14:103830464-103830486 TGCCCTCCATTTTATAGATGAGG + Intronic
1122782944 14:104151303-104151325 GTCCCCCCAGTTCAGGGAAGGGG + Intronic
1122833843 14:104421426-104421448 TTTCCTCCATTTCACAGATGAGG - Intergenic
1122864510 14:104597407-104597429 TCCCCACCATTTCATAAAAGAGG + Intronic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124576765 15:30916290-30916312 TTCTCCCCATTTGACAGATGAGG - Intronic
1124722572 15:32122723-32122745 TTCTCCCCATGGCATTGAAGTGG + Intronic
1124940222 15:34210676-34210698 TTGTCCCCATTTTACAGAAGGGG - Intergenic
1125194793 15:37033896-37033918 TTCACCCCACTGCAGAGAAGAGG - Intronic
1125825809 15:42675227-42675249 TTATCCCCATTTTATAGATGAGG - Intronic
1125927543 15:43575409-43575431 TTCCTCCCATTTTACAGATGAGG - Intronic
1125940686 15:43674974-43674996 TTCCTCCCATTTTACAGATGAGG - Intergenic
1126242566 15:46461933-46461955 TGCACCCAATGTCATAGAAGAGG + Intergenic
1126446890 15:48757305-48757327 TTATCCCCATTTTATAGATGAGG - Intronic
1126732748 15:51700932-51700954 TTAACCCCATATCACAGAAGAGG - Intronic
1126935150 15:53698533-53698555 ATTACCCCATTTCATAGATGAGG + Intronic
1127027108 15:54819025-54819047 TTCCCCTCATGTCACAGATGAGG - Intergenic
1127246081 15:57176581-57176603 TTCCTCCCATTTGATAGCTGAGG + Intronic
1127387537 15:58478595-58478617 TTATCCCCATTTCATAGAGGAGG + Intronic
1127626005 15:60780993-60781015 TTATCCCCATTTCACAGATGGGG + Intronic
1127630670 15:60824645-60824667 TTAGCCCCATTTTATAGATGGGG - Intronic
1127693515 15:61421199-61421221 TTATCCCCATTTAATAGAAAAGG + Intergenic
1127858342 15:62971504-62971526 TTCTCCCCATTTTACAGATGAGG - Intergenic
1128102681 15:65016484-65016506 TTCCTCCCATTTTATACAACTGG + Exonic
1128325085 15:66719108-66719130 TTCTCCCCATTTCATAGAGGAGG + Intronic
1128340500 15:66819419-66819441 TTATCCCCATTTTATAGATGAGG + Intergenic
1128536917 15:68498517-68498539 CTGCCCTCATTTCAAAGAAGAGG - Intergenic
1128545699 15:68566276-68566298 TTATCCCCATTTGATAGGAGAGG + Intergenic
1128713062 15:69886347-69886369 TTCATCCCATTTCACAGATGGGG - Intergenic
1128791742 15:70439311-70439333 TTGCCCCCATTTTTCAGAAGAGG + Intergenic
1128892040 15:71340268-71340290 TCGTCCCCATTTCATAGATGAGG + Intronic
1129120102 15:73391089-73391111 TTCACCCCATTTTATAGATGAGG - Intergenic
1129324719 15:74794035-74794057 TTACCCCCATTTCACAGAAGCGG - Intronic
1129331083 15:74827610-74827632 TTATCCCCATTTTACAGAAGAGG + Intronic
1129660993 15:77552815-77552837 TTCTCTCCATTTTATAGATGAGG - Intergenic
1129664700 15:77573049-77573071 TTACTCCCATTTCATAGACAAGG - Intergenic
1129890475 15:79068418-79068440 AACTCCCCATTTCATAGATGAGG - Intronic
1129904158 15:79174206-79174228 TTCTCCCCATTTTACAGATGAGG - Intergenic
1129917971 15:79291354-79291376 TTCTTTCCATTTCATCGAAGGGG - Intergenic
1130170022 15:81501674-81501696 TTAGCCCCATTTTATAGACGAGG + Intergenic
1130210225 15:81915452-81915474 TTACCTCCATTTTATAGATGCGG - Intergenic
1130323188 15:82856989-82857011 TTCCCCCCATTTTACAGATGAGG - Intronic
1130515400 15:84622333-84622355 TTCCCCCCATTTTACCAAAGAGG - Exonic
1130549678 15:84882016-84882038 TTCTCCCCCTGTCATAGAAGTGG - Intergenic
1130628165 15:85537753-85537775 TTTCCCCCATTTCACAGATGAGG - Intronic
1130671226 15:85914666-85914688 TTCCCCCTTTTTTAGAGAAGGGG + Intergenic
1130980055 15:88806124-88806146 TTCTCCCCTTTTTAGAGAAGAGG - Intronic
1131116783 15:89800899-89800921 TTAGCCTCATTTTATAGAAGAGG + Intronic
1131316652 15:91344696-91344718 TTCGCCCTATTTTATAGAAGAGG + Intergenic
1131378828 15:91947326-91947348 TTCCCACAATTTCACAGAATTGG - Intronic
1131831516 15:96357669-96357691 TTCCTCCTATTTCTTAGAACTGG + Intergenic
1132020051 15:98353108-98353130 CTATCCCCATTTCACAGAAGAGG - Intergenic
1132170719 15:99651395-99651417 TTCTCCCCATGTTATAGACGAGG + Intronic
1132539343 16:501317-501339 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132539353 16:501353-501375 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132539371 16:501424-501446 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132539380 16:501460-501482 ATCCCCCCATTTCATAGGCAAGG + Intronic
1132539391 16:501496-501518 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132539439 16:501670-501692 CTCCCCCCATTTCATAGGCAGGG + Intronic
1132539475 16:501809-501831 GTCCCCCCATTTCACAGACAAGG + Intronic
1132539502 16:501916-501938 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132539514 16:501952-501974 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132539526 16:501988-502010 GTCCCCCCATTTCATAGGCAAGG + Intronic
1132645339 16:996965-996987 TTCACCCCATTTAACAGAAGAGG + Intergenic
1132724101 16:1331439-1331461 TTGTCCCCATTTTACAGAAGAGG + Intergenic
1133228033 16:4352023-4352045 TTCCGGACATTTCATAGAAATGG + Intronic
1133535536 16:6698894-6698916 TTCCCCCTTATTCATAAAAGAGG + Intronic
1133876515 16:9739989-9740011 TTACCCCCATTTTAAAGATGAGG - Intergenic
1133888685 16:9856750-9856772 TTATCTCCATTTCATAGATGAGG + Intronic
1133907119 16:10032598-10032620 TTATCCCCATTTCACAGACGAGG + Intronic
1133919289 16:10137717-10137739 TTACCCCCATTTTACAGAGGAGG - Intronic
1133925756 16:10190789-10190811 GTCCCCCCATTTTATAGATGAGG - Intergenic
1134066330 16:11230787-11230809 GTCTCCCCATCTCATAGATGGGG + Intergenic
1134393319 16:13839797-13839819 TTGCCCCCATTTCACAAGAGAGG + Intergenic
1134490250 16:14690815-14690837 TATCCCCCATTTCACAGATGAGG - Intronic
1134495631 16:14729932-14729954 TATCCCCCATTTCACAGATGAGG - Intronic
1134501179 16:14770245-14770267 TATCCCCCATTTCACAGATGAGG - Intronic
1134579401 16:15358787-15358809 TATCCCCCATTTCACAGATGAGG + Intergenic
1134589310 16:15439296-15439318 TTATCCCCATTTCACAGATGAGG - Intronic
1134723181 16:16398764-16398786 TATCCCCCATTTCACAGATGAGG - Intergenic
1134756711 16:16673637-16673659 TTATCCCCATTTCACAGATGAGG - Intergenic
1134763122 16:16731700-16731722 TTACCCCCATTTTACAGATGAGG - Intergenic
1134944247 16:18313106-18313128 TATCCCCCATTTCACAGATGAGG + Intergenic
1134982930 16:18627449-18627471 TTACCCCCATTTTACAGATGAGG + Intergenic
1134989357 16:18685526-18685548 TTATCCCCATTTCACAGATGAGG + Intergenic
1135099891 16:19596115-19596137 TTGTCCCCATTTTATAGATGAGG + Intronic
1135205394 16:20479722-20479744 TTCTCCCCATTTGACAGAAAAGG + Intronic
1135213512 16:20544090-20544112 TTCTCCCCATTTGATAAAAAAGG - Intronic
1135347830 16:21704467-21704489 TTAGCCCCATTTCACAGATGGGG - Intronic
1135540116 16:23323537-23323559 TTCCCCTCATTTTACAGATGGGG + Intronic
1135591830 16:23710707-23710729 TTTGCCCCATTTTATAGATGAGG + Intronic
1135742633 16:24989522-24989544 TTCTGGCCATTTCATATAAGTGG - Intronic
1135966162 16:27036960-27036982 TTCCCTCCATTTCACAAATGGGG - Intergenic
1136055056 16:27682335-27682357 TTGTCCCCATTTCACAGACGAGG + Intronic
1136165671 16:28451452-28451474 TATCCCCCATTTCACAGATGAGG + Intergenic
1136197301 16:28663557-28663579 TATCCCCCATTTCACAGATGAGG - Intergenic
1136213640 16:28777704-28777726 TATCCCCCATTTCACAGATGAGG - Intergenic
1136258373 16:29057628-29057650 TATCCCCCATTTCACAGATGAGG - Intergenic
1136320122 16:29478688-29478710 TACCCCCCATTTCACAGATGAGG + Intergenic
1136380032 16:29888956-29888978 TGGCCCCCATTTTATAGATGAGG + Intronic
1136411187 16:30078257-30078279 TTAGCCCCATTTCATAGCAGAGG + Intronic
1136434693 16:30218029-30218051 TACCCCCCATTTCACAGATGAGG + Intergenic
1137247028 16:46714259-46714281 TTGTCCCCATTTTATAGATGAGG + Intronic
1137385519 16:48038990-48039012 TTCCCACCATTTTAATGAAGAGG + Intergenic
1137475024 16:48800225-48800247 TTATCCCCATTTAACAGAAGAGG - Intergenic
1137591342 16:49695937-49695959 TTATCCCCATTTTATAGATGAGG + Intronic
1138070691 16:53990317-53990339 TTATCCCCATTTTATAGATGAGG + Intronic
1138216361 16:55208150-55208172 TTCCCCCCTTGTAATAGAAGTGG + Intergenic
1138223213 16:55270618-55270640 TTACCCCCATCTCACAGATGAGG - Intergenic
1138227435 16:55309527-55309549 TTGTCCCCATTTTATAGATGAGG + Intergenic
1138250567 16:55498832-55498854 TTCCTCCCATTTTACAGATGAGG + Intronic
1138453447 16:57107057-57107079 TTGCCCCCATTTTAGAGATGAGG - Intronic
1138525049 16:57600343-57600365 CTTACCCCATTTCATTGAAGGGG - Intergenic
1138575981 16:57907651-57907673 TTCTCCCCTTTGCATAGAAAGGG + Intronic
1138789488 16:59886311-59886333 TTCCCCCTTTGTCTTAGAAGTGG - Intergenic
1138840010 16:60489332-60489354 TTTCTCTCATTTCTTAGAAGGGG - Intergenic
1139498605 16:67341397-67341419 TTACCCCCATTTTACAGATGAGG + Intronic
1139731352 16:68948380-68948402 TTCTCCCCATTTTACAGATGAGG + Intronic
1140736099 16:77899147-77899169 TTGCCCCCATTTTACAGATGAGG + Intronic
1140888765 16:79267688-79267710 TTAATCTCATTTCATAGAAGAGG - Intergenic
1140904926 16:79401964-79401986 TTACCCCCATTTTATAGATGAGG + Intergenic
1140909508 16:79438593-79438615 TTTCCTCCATTTCACAGAGGAGG + Intergenic
1140921261 16:79540771-79540793 TTCCCCACATGTCAGAGAAGAGG - Intergenic
1141086416 16:81098694-81098716 TTACACTCATTTCATAGATGAGG + Intergenic
1141091115 16:81130895-81130917 TTATTCCCATTTCATAGATGGGG - Intergenic
1141296597 16:82775577-82775599 TATCCCCCATTTTATAGCAGAGG + Intronic
1141470214 16:84233188-84233210 GCACCCCCATTTCATAGAGGAGG + Intronic
1141482175 16:84313798-84313820 ATCCACCCATTTCACAGGAGAGG - Intronic
1141484731 16:84331050-84331072 TTACACCCAGTTCAGAGAAGAGG - Intergenic
1141485839 16:84339746-84339768 TACCCCCCGTTTCAAAGCAGTGG - Intergenic
1141631613 16:85291123-85291145 TTATCCCCATTTTACAGAAGGGG + Intergenic
1141768035 16:86071539-86071561 CTCCTCCCATTTCACAGATGAGG - Intergenic
1141769191 16:86078746-86078768 ATCATCCCATTTCACAGAAGTGG + Intergenic
1141787918 16:86214047-86214069 TTCGCCCCATTTCATAGGCAAGG + Intergenic
1141802620 16:86321464-86321486 TTACCTCCATTTCACAGATGGGG - Intergenic
1141908794 16:87044708-87044730 TTATTCCCATTTCACAGAAGAGG + Intergenic
1141936424 16:87242061-87242083 TGATCCCCATTTCACAGAAGGGG + Intronic
1142477979 17:200955-200977 TTCCCTCCACTTCACAGAGGAGG - Intergenic
1142612394 17:1116413-1116435 TTACCCCCATTCTATAGATGAGG - Intronic
1142867632 17:2800274-2800296 TTCTCCCCATTTCAGAGATGAGG - Intronic
1142991741 17:3735834-3735856 TACTCTCCATTTTATAGAAGAGG + Intronic
1143007568 17:3846624-3846646 TGACCCCCATTTCATATATGAGG + Intergenic
1143175816 17:4954394-4954416 TACCCCCCATTTTACAGATGGGG - Intronic
1143271905 17:5682092-5682114 TTACCCCCATTTTATAGATGAGG - Intergenic
1143423908 17:6817755-6817777 TTACCCCCATTTTACAGAAAAGG - Intronic
1143583735 17:7841100-7841122 TTACCCCCATTTTACAGATGAGG - Intronic
1143659156 17:8314072-8314094 TTAGCCCCATTTCACAGATGAGG - Intronic
1143737514 17:8923432-8923454 TTACCCCCATTTTACAGATGAGG + Intronic
1143881371 17:10032536-10032558 ATCCCCCCATTTCACAGATGAGG - Intronic
1144249294 17:13399558-13399580 TTACCCCCATTTTAGAGATGAGG + Intergenic
1144259814 17:13507305-13507327 TTCCCTTCATTTCACAGATGGGG + Intronic
1145043763 17:19596176-19596198 TTCCCCCCATTTTGTATATGAGG - Intergenic
1145183638 17:20775278-20775300 TTCCAGACATTTCATATAAGTGG + Intergenic
1145198135 17:20914155-20914177 TTTCCCCCATTTTAAAGATGAGG + Intergenic
1145260665 17:21352580-21352602 TTGTTCCCATTTCACAGAAGGGG + Intergenic
1145846906 17:28047075-28047097 TTATCCCCATTTTATAGATGAGG - Intronic
1146156357 17:30527466-30527488 TTATCACCATTTTATAGAAGAGG - Exonic
1146172016 17:30641702-30641724 TTTCCCCCATTTTATAGATGGGG - Intergenic
1146181869 17:30703620-30703642 TTCTCCCCATCTTACAGAAGGGG - Intergenic
1146345474 17:32057738-32057760 TTTCCCCCATTTTATAGATGGGG - Intergenic
1146394594 17:32453800-32453822 TTTCCCCCACTATATAGAAGAGG - Intronic
1146615732 17:34356040-34356062 TCATGCCCATTTCATAGAAGAGG - Intergenic
1146644208 17:34566065-34566087 TTATCTCCATTTCACAGAAGAGG - Intergenic
1146820335 17:35979549-35979571 TTACCCCCACTTAATAGATGAGG - Intronic
1146910704 17:36646717-36646739 TTCTCCCCATTTTACAGATGGGG + Intergenic
1146943994 17:36861957-36861979 TTTCCCCCATTTTACAGATGAGG - Intergenic
1147050993 17:37794771-37794793 TTACCCACATTTTATAGATGAGG - Intergenic
1147275644 17:39314153-39314175 TTCCGCACATTTCATATAAATGG + Intronic
1147308617 17:39580302-39580324 TTCTTCCCATTTCATAGATGAGG - Intergenic
1147320248 17:39641695-39641717 TTCTCCCCATTTTACAGAAAAGG + Intronic
1147554126 17:41465601-41465623 TTGTCCCCATTTTACAGAAGAGG + Intronic
1147931586 17:43984515-43984537 TTTCCCCCATTTCGCAGAGGTGG + Intronic
1148207537 17:45788542-45788564 TTTCCCCCATTTTATAGCTGGGG - Intronic
1148209670 17:45800575-45800597 TTGCCCCCACTTCACAGATGAGG + Intronic
1148772111 17:50073381-50073403 ATCCCCCCACTTTATAGATGAGG - Intronic
1148877929 17:50703336-50703358 TTCCCCCCATTTTACAGAAGAGG + Intronic
1148905376 17:50908682-50908704 TTAGCCCCATTTCACAGATGAGG + Intergenic
1149583805 17:57770800-57770822 CTACTCCCATTTCATAGATGAGG + Intergenic
1149605385 17:57921231-57921253 TTCCCCCCATTTTATAGCAGAGG - Intronic
1149824433 17:59814623-59814645 TTAACCACATTTCATAGATGAGG + Intronic
1149868780 17:60164971-60164993 TCACCCCCATTTCACAGATGAGG - Intronic
1150226098 17:63525251-63525273 ATCCCTTCATTTCATAGATGTGG + Intronic
1150574211 17:66415780-66415802 TTATCCCCATTTCACAGATGAGG - Intronic
1151095570 17:71493660-71493682 TTTTCCCCATTTTATAGATGAGG - Intergenic
1151293721 17:73168168-73168190 TTACCCCCATTTTAGAGATGTGG - Intronic
1151339351 17:73459864-73459886 TTAACTCCATTTTATAGAAGAGG - Intronic
1151685289 17:75642773-75642795 TTACCCCCATTTTAGAGATGAGG + Intronic
1151943160 17:77305314-77305336 CCCGCCCCATTTCATAGAGGAGG - Intronic
1152070379 17:78131264-78131286 TTCACCCCATTTGACAGATGGGG + Exonic
1152162565 17:78677976-78677998 TTATCCCCATTTCACAGATGAGG - Intronic
1152228365 17:79102913-79102935 TTCCCTCCTTTTCCTAGGAGAGG - Intronic
1152248634 17:79199853-79199875 TTCTCCCCATTTTATAGATAAGG - Intronic
1152354880 17:79801934-79801956 TTACCCCCATTTTCTAGATGAGG + Intergenic
1152581872 17:81169057-81169079 TTCCAGACATTTCATACAAGTGG - Intergenic
1152956775 18:47361-47383 TTCCCCCCTTTACCTAGAAAAGG + Intronic
1153180162 18:2423773-2423795 TTATCCCCATTTCATACATGAGG + Intergenic
1153347231 18:4040217-4040239 TTACCTCCATTTGATAGATGAGG - Intronic
1153556068 18:6315514-6315536 TCACCCTCATTTCACAGAAGAGG + Intronic
1153908838 18:9688451-9688473 ATTTCCCCATTTCATAGAGGTGG - Intergenic
1153911682 18:9710241-9710263 TTATGCCCATTTCATAGATGAGG - Intronic
1153920324 18:9783226-9783248 TTGGCCCCATTTCACAGAACAGG + Intronic
1154390115 18:13929523-13929545 TTCCTCCCATCTCAAAGCAGGGG - Intergenic
1155107584 18:22682950-22682972 TTGTGCCCATTTTATAGAAGAGG - Intergenic
1155658360 18:28218317-28218339 TACCTCCCATTTTATATAAGAGG - Intergenic
1155968886 18:32062131-32062153 TTATCTCCATTTCACAGAAGGGG + Intronic
1156249945 18:35343743-35343765 TTCCCTCCATTTCCCACAAGCGG - Intronic
1156287160 18:35708088-35708110 TTGTCCCCATTTTATAGATGAGG + Intronic
1156503569 18:37575093-37575115 TTCTGCCCATTTTATAGATGAGG - Intergenic
1156518532 18:37701425-37701447 TTAACCCCATTTTATAGATGAGG + Intergenic
1156604769 18:38653475-38653497 TTCCGTCCATTTCATAAATGTGG - Intergenic
1156899638 18:42286053-42286075 TTCACCCCATTTTATAGAGGAGG - Intergenic
1157029466 18:43887799-43887821 TTAGCCCCATTTGATAGAAAAGG - Intergenic
1157332854 18:46716197-46716219 TACCCTCCATTTTATAGATGAGG - Intronic
1157646195 18:49275072-49275094 TTACCCCCATTTCTTCTAAGAGG + Intronic
1157741233 18:50095306-50095328 TTCCACCCATGAAATAGAAGTGG + Intronic
1157780026 18:50430227-50430249 TTAGCCCCCTTTCATAGATGAGG + Intergenic
1157902201 18:51529431-51529453 TTATAGCCATTTCATAGAAGAGG + Intergenic
1158592360 18:58788538-58788560 TTATCCCCATTTTATAGATGAGG - Intergenic
1159944242 18:74432003-74432025 TTCTGCCTATTTAATAGAAGGGG - Intergenic
1160689589 19:455353-455375 TTCCACCCATTTTATAGATGAGG - Intronic
1161347881 19:3777195-3777217 TTACACCCATTTCACAGACGTGG - Intergenic
1161488244 19:4547552-4547574 TTCCTCCCATTTTAGAGACGGGG + Intronic
1161612106 19:5248832-5248854 TTCCCTCCATTTTACAGATGAGG - Intronic
1162116026 19:8429994-8430016 TTACCCCCATTTTACAGATGGGG - Intronic
1162976967 19:14212171-14212193 TTCTCCCCATCTTATAGAAGGGG + Intergenic
1162990411 19:14298333-14298355 TTTCCCCCATTTTATAGACGGGG + Intergenic
1162998729 19:14352630-14352652 TCACCCCCATTTCACAGATGAGG - Intergenic
1163246717 19:16100161-16100183 TTACCCCCATTTGACAGACGGGG + Intronic
1163284046 19:16335289-16335311 TTACCCCCATTTCAAAGAAGAGG - Intergenic
1163443624 19:17334151-17334173 TTACCCCCATTTCACAGGTGAGG + Intronic
1163632107 19:18422787-18422809 TTCACCCCATTTCACAGAGAAGG - Intronic
1165315381 19:35052176-35052198 TTACCCCCATCTCACAGATGAGG - Intronic
1165341061 19:35212488-35212510 TTCCCCCCATTTCACGGACATGG - Intergenic
1165438243 19:35808639-35808661 ATCCCCCCATTTTCTAGATGGGG + Intronic
1165671799 19:37686185-37686207 TTCCCTCCATTTTACAGATGAGG + Intronic
1165700150 19:37931379-37931401 TTCATCCCATTTCATAGATGAGG + Intronic
1165735779 19:38174536-38174558 TTACCCCCATTTTACAGATGAGG - Intronic
1165802923 19:38563912-38563934 TTCTTCCCATTTTATAGATGAGG - Intronic
1165927248 19:39334743-39334765 TTCTCCCCATTTCACAGATGAGG + Intronic
1166104559 19:40590872-40590894 CTCCCCTCATTGCACAGAAGGGG - Intronic
1166292337 19:41871183-41871205 ATTCCCCCATTTCACAGACGTGG - Intronic
1166341708 19:42141421-42141443 CTGCCCCCATTTCACAGATGAGG - Intronic
1166567738 19:43775459-43775481 TTGCCCCCATTTTATAGATGTGG + Intronic
1166676007 19:44741599-44741621 TTACCCTCATTTTATAGATGAGG + Intergenic
1166875798 19:45896515-45896537 ATCGCCCCATTTTATAGATGAGG + Intronic
1166938883 19:46351064-46351086 CACCCCCCATTTTACAGAAGCGG - Intronic
1167465627 19:49649819-49649841 ATACCCCCATTTTATAGATGAGG + Intronic
1168321935 19:55515999-55516021 TTATCCCCATTTTACAGAAGGGG - Intronic
925341305 2:3139488-3139510 TTACCCCCATTTTACAGATGAGG + Intergenic
925709271 2:6722339-6722361 ATCACTCCATTTCATAGATGCGG + Intergenic
926006582 2:9377763-9377785 TTCCTCCCATTTCTGAGCAGAGG + Intronic
926082613 2:10000432-10000454 TTATCCCCATTTTATAGATGAGG + Intronic
927206189 2:20612136-20612158 TTACCCCCATTTTATAGAGGAGG + Intronic
927511740 2:23648236-23648258 TTCTCCCCCTTTTATAGATGAGG - Intronic
927610859 2:24539133-24539155 TCCCCCCCATTTAAGAGATGGGG + Intronic
927638719 2:24833775-24833797 TTCTCCTCATTTCACAGATGAGG + Intronic
927887227 2:26726033-26726055 TTAACCCCATTTTATAGATGTGG + Intronic
927961751 2:27244755-27244777 TTCCACCCATTTCACAGATGTGG + Intergenic
928421353 2:31139453-31139475 TTCCCTCCATTTTACAGATGAGG - Intronic
928598960 2:32885029-32885051 TTATCCCCATTTTACAGAAGAGG - Intergenic
929630680 2:43458436-43458458 TTATCCCCATTTAATAGATGAGG - Intronic
930064535 2:47317577-47317599 TTATCCCCATTTCATAGATGAGG - Intergenic
930349671 2:50234578-50234600 TTTCTCCCATTGCCTAGAAGAGG - Intronic
930873008 2:56185669-56185691 TTCCCTTCTTTTCCTAGAAGAGG - Intronic
930892635 2:56408914-56408936 TTATACCCATTTCATAGATGAGG - Intergenic
931129011 2:59312125-59312147 TTCCCCCCATTTTACAGAAGAGG + Intergenic
931224186 2:60315515-60315537 TTATCCCCATTTCATAGATGAGG + Intergenic
931962023 2:67492858-67492880 TTATCTCCATTTCATAGATGAGG - Intergenic
932012448 2:67992188-67992210 TTACCTCCATTTTACAGAAGGGG - Intergenic
932119019 2:69081141-69081163 TTATCCCCATTTTATAGATGAGG + Intronic
932318190 2:70800477-70800499 TTACTTCCATTTCACAGAAGAGG + Intergenic
932411830 2:71552122-71552144 TTATCCCCATTTCACAGATGAGG + Intronic
932495160 2:72142521-72142543 TTGTCCCCTTTTCATGGAAGGGG - Intronic
932800697 2:74740130-74740152 TTATCCCCATTTCACAGATGAGG + Intergenic
933581460 2:84131309-84131331 TTACCCTCATTTCATAGATGAGG - Intergenic
933707290 2:85301327-85301349 TTACCCCCATTCCAGAGATGAGG - Intronic
933739655 2:85523543-85523565 TGATCCCCATTTCACAGAAGAGG + Intergenic
934605611 2:95692975-95692997 TTACCCTCATTTTATAGATGAGG + Intergenic
935445300 2:103150076-103150098 TTATCCACATTTCATAGATGAGG + Intergenic
935651340 2:105384812-105384834 TTCTCCCCATTTTATAGATGTGG + Intronic
935702098 2:105821734-105821756 TTGCCCCCATTTAATAGATGGGG + Intronic
935744997 2:106182706-106182728 TTCTCTCCATTTCATAGGTGGGG - Intronic
936372394 2:111912966-111912988 TTGTCCCCAGTTCATAGATGAGG - Intronic
936539077 2:113335515-113335537 TTACCCTCATTTTATAGATGAGG + Intergenic
936636440 2:114264196-114264218 TTTCCCCCATTTCATAGCCGGGG + Intergenic
936979499 2:118251168-118251190 TGCCACTCATTTCATTGAAGTGG - Intergenic
937190294 2:120089863-120089885 TTAGCCCCATTTCATAGATAAGG - Intronic
937500471 2:122472842-122472864 TTATCCCCATTTTATAGATGAGG + Intergenic
937630757 2:124098589-124098611 TTTCCCCCATTTTACAGATGAGG + Intronic
937853239 2:126654931-126654953 TTGCCTCCATTTTATAGATGAGG + Intergenic
937955407 2:127419239-127419261 TCAACCCCATTTCATAGAGGGGG - Intronic
938566726 2:132525309-132525331 TTATCCCCATTTCACAGATGAGG - Intronic
938596097 2:132788537-132788559 TTCTCCCCATTTCACAGAAGAGG - Intronic
938895316 2:135743481-135743503 TTATCCCCATTTTATAGATGAGG + Intronic
939127339 2:138193271-138193293 TTCCTCTAATTTCATAGATGAGG - Intergenic
939552618 2:143634401-143634423 TTCCCTCCATTTTATAAATGTGG - Intronic
939664969 2:144940619-144940641 TTATTCCCATTTCATAGATGAGG + Intergenic
939845781 2:147244725-147244747 TTATCCTCATTTTATAGAAGAGG - Intergenic
940006664 2:149014593-149014615 TTTTCCCCATTTCATATATGAGG - Intronic
940090785 2:149914423-149914445 TTCCCACAATTTCATATAAATGG - Intergenic
940769196 2:157822287-157822309 TTTACCCCATTTCATGGAAAAGG - Intronic
941074667 2:160993098-160993120 TTACTCCCATTTCACAGATGAGG + Intergenic
941203878 2:162547590-162547612 ATATCCCCATTTTATAGAAGTGG + Intronic
941769385 2:169328945-169328967 ATGGCCCCATTTCATAGATGAGG + Intronic
942137612 2:172943424-172943446 TTACTCCCATTTCACAGATGAGG - Intronic
942144000 2:173007928-173007950 TTACCCCTATTTTACAGAAGGGG - Intronic
942170499 2:173284917-173284939 TTGTCCCCATTTCATAGATTGGG - Intergenic
942191547 2:173475501-173475523 ATCCTCCCATTTTATAGATGAGG + Intergenic
942338182 2:174914136-174914158 TTACCCCCATTTTACAGATGAGG - Intronic
942414385 2:175743444-175743466 TTATCCCCATTTCATAGATGAGG - Intergenic
942546492 2:177069970-177069992 TTATCCCCATTTTATAGATGAGG + Intergenic
943398911 2:187379776-187379798 TTACCCTCATTTCATATATGAGG + Intronic
943767841 2:191680816-191680838 TTATTCCCATTTCACAGAAGAGG - Intronic
944408984 2:199418187-199418209 CTACCCTGATTTCATAGAAGAGG + Intronic
944768609 2:202889883-202889905 TTCCCCCCTTTTGAGAGGAGTGG - Intronic
944820709 2:203427803-203427825 TTCCCTCCTCTTCATACAAGTGG - Exonic
945325594 2:208478856-208478878 TTGTCCCCATTTCACAGATGAGG - Intronic
946005099 2:216518255-216518277 TTTCCCCCATTTTACAGATGAGG + Intronic
946220693 2:218223638-218223660 TTGTCCCCATTTTGTAGAAGAGG + Intronic
946299133 2:218811885-218811907 TTATCCCCATTTTATAGAAAGGG + Intronic
946368761 2:219267292-219267314 TTACCCCCAATTTATAGATGAGG - Intronic
946459408 2:219855870-219855892 TTATCTCCATTTCACAGAAGGGG - Intergenic
946579096 2:221107160-221107182 TTCACCTCATTTTATAGATGAGG - Intergenic
946704385 2:222443893-222443915 TTCTCCCCATTTCACAGATAAGG - Intronic
946880939 2:224176575-224176597 TTGCCCTCACTTCACAGAAGAGG + Intergenic
947477930 2:230468108-230468130 TTCCCCCCATTTGACAGATGGGG + Intronic
948146350 2:235710962-235710984 TTATCCCCATTTCACAGATGAGG + Intronic
948437623 2:237964880-237964902 TTATCCCCATTTTATAGATGAGG - Intergenic
948529283 2:238593747-238593769 TTCCTCCTATTTTATAGATGAGG + Intergenic
948562760 2:238865142-238865164 TCACCCCCATTTCACAGCAGGGG + Intronic
1168765623 20:380354-380376 TTCTTCCCATTTCATAGGTGGGG + Intronic
1168829691 20:838991-839013 TTGCCCCCATTTTACAGCAGAGG + Intronic
1168865886 20:1086192-1086214 TTAACCCCATTTTACAGAAGAGG - Intergenic
1168866991 20:1095215-1095237 TTCTCCCCATTTTACAGATGGGG + Intergenic
1168984401 20:2035617-2035639 TTACCCCCATTTTACAGATGAGG - Intergenic
1169193854 20:3673245-3673267 TTATCCCCATTTTACAGAAGAGG + Intronic
1169257289 20:4109178-4109200 CTGCTCCCATTTCATAGATGAGG - Intergenic
1169308033 20:4510640-4510662 TGCCCACCATTTCATGGGAGGGG - Intergenic
1169316281 20:4593199-4593221 TTATCCCCGTTTCATAGATGAGG - Intergenic
1169703017 20:8469996-8470018 TTCCAGACATTTCATAGAAATGG + Intronic
1171046833 20:21816630-21816652 TTATCCCCATTTCACAGATGAGG - Intergenic
1171169146 20:23000083-23000105 TTATCCCCATTTTATAGAAGAGG - Intergenic
1171217676 20:23363590-23363612 TGATCCCCATTTCATAGATGAGG - Intronic
1171226091 20:23443130-23443152 TTCTCCTCATTTCCTAGATGAGG + Intronic
1171947891 20:31394540-31394562 TTACCCCCATTTTATAGAAGAGG - Intergenic
1172029241 20:31969687-31969709 TCTCCCTCATTTCACAGAAGAGG - Intronic
1172031969 20:31988627-31988649 CTGTCCCCATTTCATAGATGAGG - Intronic
1172048045 20:32095230-32095252 TTCTGGACATTTCATAGAAGGGG - Intronic
1172106285 20:32519028-32519050 TTAACCCCATTTCACAGATGAGG + Intronic
1172121230 20:32599982-32600004 ATTCCCCCATTTCACAGATGAGG - Intronic
1172162594 20:32879000-32879022 TTGTCCCCATTTTATAGATGAGG + Intronic
1172430228 20:34884464-34884486 TTATCCCCATTTTATGGAAGAGG - Intronic
1172566526 20:35934857-35934879 TTCCTCACATTTCATAAAACAGG + Intronic
1172619844 20:36311699-36311721 TCACCCCCATTTTATGGAAGAGG + Intronic
1172777066 20:37413943-37413965 TTCCTCTCATTTCAAAGAATTGG + Intergenic
1172837296 20:37881227-37881249 GTCCCCCCATATCACAGATGAGG - Intergenic
1172882130 20:38208955-38208977 ATCCCTCCATTTCACAGATGGGG + Intergenic
1173070525 20:39760274-39760296 TTATCCCCATTTTACAGAAGAGG - Intergenic
1173072158 20:39778878-39778900 CTCCCCCCACCTCACAGAAGAGG + Intergenic
1173184276 20:40828852-40828874 TAATCCCCATTTCATAGATGAGG + Intergenic
1173324339 20:42018839-42018861 TTGTCCCCATTTTATAGATGAGG - Intergenic
1173332439 20:42086449-42086471 TTCTCCCCATTTTACAGATGAGG - Intronic
1173444393 20:43104787-43104809 TTGCCCACATTTTATAGATGAGG - Intronic
1173503921 20:43572283-43572305 GTACCCCCATTACATAGATGAGG - Intronic
1173552065 20:43939269-43939291 TTATCCCCATTTCACAGAGGAGG - Intronic
1173606505 20:44335848-44335870 AGCTCCCCATTTCATAGATGAGG - Intergenic
1173640674 20:44599806-44599828 GCCCTCCCATTTTATAGAAGGGG + Intronic
1173655547 20:44698148-44698170 TATCCCCCATTTTACAGAAGAGG + Intergenic
1173660525 20:44730117-44730139 TTATCCCCATTTTAAAGAAGGGG - Intergenic
1173785261 20:45788527-45788549 TTATCCCCATTTTATAGATGAGG + Intronic
1173826493 20:46051159-46051181 TTACTCCCATTTTATAGATGGGG - Intronic
1173936638 20:46871642-46871664 TCACCCCTATTTCATAGATGAGG - Intergenic
1173948289 20:46968893-46968915 GTCCCCTCATTTTACAGAAGAGG - Intronic
1173954137 20:47017772-47017794 TTATTCCCATTTCACAGAAGAGG + Intronic
1174256849 20:49263068-49263090 TTATCCCCATTTTATAAAAGGGG + Intronic
1174413263 20:50349755-50349777 TTGTCCCCATTTCCTAGATGAGG + Intergenic
1174429649 20:50458588-50458610 TTAGCCCCATTTCACAGACGGGG + Intergenic
1174484775 20:50854250-50854272 TGCCACCCATTTCACAGAGGGGG - Intronic
1174769190 20:53282497-53282519 TTACCCCCATTTTATGGATGGGG + Intronic
1175148250 20:56912698-56912720 TTGCCCCCATCTCACAGAGGAGG + Intergenic
1175524201 20:59622351-59622373 TTGCCCCCAGTTTATAGAGGAGG - Intronic
1175544736 20:59770999-59771021 TCACCCCCATTTCACAGATGAGG - Intronic
1175680676 20:60986148-60986170 GTCCCCCCATTTTATAGACAAGG - Intergenic
1176717858 21:10368504-10368526 TTCTCCTCATTTCTGAGAAGAGG + Intergenic
1177056859 21:16316946-16316968 TTCCACCCATTTTATAGATAAGG - Intergenic
1177653797 21:23989896-23989918 TTACTCCCATTTCACAGATGAGG - Intergenic
1177731744 21:25035878-25035900 TTGCCACCATTTCATATAAAAGG - Intergenic
1178505990 21:33163419-33163441 TTCTTCCCATTTCATTGATGAGG - Intergenic
1178528223 21:33350914-33350936 TTACCACCACTTCAGAGAAGAGG - Intronic
1178583699 21:33856093-33856115 TTATCCCCATTTCACAGACGAGG - Intronic
1178704067 21:34858450-34858472 TTATCCCCATTTTACAGAAGAGG + Intronic
1178809358 21:35867271-35867293 ATCCTCCCATTTTATAGATGAGG - Intronic
1179039581 21:37790496-37790518 TTATCCCCATTTCATAGATAAGG + Intronic
1179418037 21:41214123-41214145 ATCACCCCCTTTCCTAGAAGAGG + Intronic
1179421424 21:41239680-41239702 TTCCCCCCATTTTCAAGATGTGG + Intronic
1179831995 21:44002650-44002672 ATCACCCCATTTCGTACAAGAGG - Intergenic
1180016263 21:45087094-45087116 TTCCCCCCACTTATCAGAAGAGG + Intronic
1180248351 21:46563248-46563270 TTGCCCCCATTTCATACGTGAGG + Intronic
1180299084 22:11021410-11021432 TTCTCCTCATTTCTGAGAAGAGG + Intergenic
1180568578 22:16696163-16696185 TTATCCCCATTTTATAGATGAGG + Intergenic
1180905616 22:19408952-19408974 TTCTCCTCATTTCACAGATGAGG - Intronic
1181161762 22:20963977-20963999 CTGCCCCCATTTCATACACGTGG - Intergenic
1181733751 22:24866302-24866324 TAGCCCCCATTTTATAGATGAGG + Intronic
1181759832 22:25050590-25050612 TTACCCCCATTTTACAGAAGTGG - Intronic
1181878109 22:25955787-25955809 TTGCCCCCATTTCACAGATGAGG + Intronic
1181901191 22:26157273-26157295 TTATCCCCATTTCACAGATGAGG - Intergenic
1181905209 22:26189225-26189247 TTGCCACCATTTCACAGATGAGG + Intronic
1181946556 22:26522181-26522203 TTACCCCCATTTTACAGAAGAGG + Intergenic
1181959204 22:26610791-26610813 TTCTCCCCATTTCAAAGATGGGG + Intronic
1181960462 22:26618625-26618647 TTATGCCCATTTCACAGAAGAGG + Intergenic
1181969904 22:26682011-26682033 TTACCCCCATTTTATAAATGGGG - Intergenic
1182091782 22:27600800-27600822 TTCTCTCCATTTCACAGATGAGG - Intergenic
1182106037 22:27690249-27690271 TCTCCCCCATTTCAAAGAAATGG - Intergenic
1182166907 22:28184110-28184132 TTACCCCCATTTTATAGATAAGG - Intronic
1182410623 22:30182199-30182221 TTGCCCCCATTTCACAGATAAGG - Intergenic
1182467794 22:30528740-30528762 TTCCCCCCATTAAACAGATGAGG + Intronic
1182472362 22:30556276-30556298 TCGTCCCCATTTCACAGAAGAGG - Intronic
1182739631 22:32558375-32558397 TTCCTCCCATTTCAGGGATGAGG + Intronic
1182753856 22:32662597-32662619 TTACCCCCATTTTACAGATGAGG - Intronic
1182773224 22:32810962-32810984 TTCCCCCCATTTTAGAGATGAGG - Intronic
1182897363 22:33869711-33869733 TTCTCCCCATTTCAGAGATGAGG + Intronic
1183046497 22:35224739-35224761 CTAGCCCCATTTCATAGATGAGG + Intergenic
1183154459 22:36064518-36064540 TTATCCCCATTTTACAGAAGAGG + Intergenic
1183214180 22:36468374-36468396 TTACCCCCATTTTATGGAAAAGG - Intronic
1183237065 22:36626940-36626962 TTATCCTCATTTTATAGAAGAGG + Intronic
1183290748 22:37000289-37000311 TTCCCACCATTTTATAAATGAGG + Intronic
1183887251 22:40894679-40894701 CTCCACCCATTTCATAGACTTGG + Intronic
1183971513 22:41481127-41481149 TTACCCCCATGTTACAGAAGAGG + Intronic
1184111397 22:42397714-42397736 TTATCCCCATTTTATAGATGAGG + Intronic
1184152828 22:42648593-42648615 TTTGCCCCATTTCACAGATGGGG - Intronic
1184246641 22:43239134-43239156 ATTCCCCCATTTCACAGATGGGG - Intronic
1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG + Intronic
1184694048 22:46130081-46130103 TGCTCCCCATTTCACAGATGGGG + Intergenic
1184710471 22:46246634-46246656 TTCCACCCATTTTATAGATGAGG - Intronic
1184767888 22:46581345-46581367 TTCACCCCATTTTACAGATGAGG + Intronic
1184870849 22:47237690-47237712 TTGTCCCCATTTCACAGATGGGG + Intergenic
1184887882 22:47357513-47357535 TTCTCCCCATTTTATGGATGAGG + Intergenic
949552952 3:5127154-5127176 TTCCCCTCATTTTTTAGATGTGG + Intronic
949920781 3:8998838-8998860 CTACCCTCATTTCATAGATGAGG + Intronic
950003591 3:9676892-9676914 TTGCCCCCATTTTAGAGAAGAGG + Intronic
950076367 3:10190031-10190053 TTATCCCTATTTTATAGAAGAGG + Intronic
950121089 3:10482977-10482999 TTCTACCCATTTCATGGATGAGG + Intronic
950129401 3:10531701-10531723 TTATCCTCATTTCACAGAAGAGG - Intronic
950137845 3:10594849-10594871 TCACCCCCATTTTATAGATGAGG + Intronic
950148296 3:10667224-10667246 TTCTCCCTATTTTATAGATGAGG + Intronic
950196931 3:11015858-11015880 TTGCCCCCATTTTATACATGGGG + Intronic
950220010 3:11187491-11187513 TTGCCCCCATTTTACAGAATGGG - Intronic
950220144 3:11189111-11189133 TTGCCCCCATTTTACAGAATGGG + Intronic
950365048 3:12477152-12477174 TTCTCCCCATTTTAAAGATGAGG - Intergenic
950440383 3:13006981-13007003 CTCTCCCCATTTTATAGATGAGG + Intronic
950525494 3:13520533-13520555 TCCCTCCCATTTCACAGATGAGG - Intergenic
950637273 3:14323954-14323976 TTACCCCCATTGTACAGAAGAGG + Intergenic
950692324 3:14669708-14669730 TTATCCCCATTTTATAGAGGGGG - Intronic
950792968 3:15487984-15488006 TTATCCCCATTGCATAGATGAGG + Intronic
950796256 3:15512820-15512842 TTACAGCCATTTCATAGACGAGG + Intronic
950930668 3:16785638-16785660 TTTTCCCCATTTTATAGATGAGG + Intergenic
951689025 3:25375951-25375973 TTATCCCCATTTCTTAGATGAGG - Intronic
951921613 3:27860788-27860810 TTTCCCCAATTTTATAGAAGGGG + Intergenic
951923503 3:27881152-27881174 TGTCCCCCATTTTATAGAGGAGG - Intergenic
952010170 3:28891619-28891641 TTATCCCCATTTCATAGACGAGG + Intergenic
952052029 3:29395418-29395440 TTACCCCCATTTTACAGATGGGG - Intronic
952366824 3:32682290-32682312 TGTCCCCCATTTCATAGATAGGG - Intergenic
952821106 3:37486414-37486436 ATCTCCCCATTTTATAGATGAGG - Intronic
953107711 3:39901414-39901436 CTTCCCTCATTTTATAGAAGAGG + Intronic
953429004 3:42821502-42821524 TTACCCCCATTTTATACAGGAGG + Intronic
953453298 3:43021678-43021700 TTCTCCCCATTTTATAGCTGAGG + Intronic
953743293 3:45555072-45555094 TTCTCTCCATTTCACAGAGGAGG - Intergenic
954647789 3:52142125-52142147 TACCCTCCATTTCACAGATGCGG - Intronic
954750512 3:52810908-52810930 TTCTCCCCACTGCATAGATGTGG - Intergenic
954828886 3:53401173-53401195 TCCCTTACATTTCATAGAAGAGG - Intergenic
955028311 3:55191588-55191610 TTACTCCCATTTGATAGAAAAGG + Intergenic
955317746 3:57952914-57952936 TCACCCCCATTTCACAGATGAGG - Intergenic
955319491 3:57964162-57964184 TCACCCCCATTTCACAGATGGGG - Intergenic
955679753 3:61488010-61488032 TTTCCCCCATGTCATAGAAGAGG - Intergenic
955700957 3:61681611-61681633 TAATCCACATTTCATAGAAGAGG - Intronic
955730041 3:61975261-61975283 TTACCCCCATTTTATAGATGAGG - Intronic
955738988 3:62069252-62069274 TTACCTCTATTTCACAGAAGGGG + Intronic
955740612 3:62087565-62087587 TTACCTCCATTTTATAGATGTGG + Intronic
955798067 3:62658524-62658546 TTATCCCCATTTCACAGATGAGG - Intronic
955802745 3:62702919-62702941 TTAGCCCCATTTCATGGAAGAGG + Intronic
955803918 3:62714032-62714054 TTAGCCCCATTTTATAGATGAGG + Intronic
955976841 3:64488066-64488088 TCACCCCCATTTTACAGAAGAGG + Intergenic
955990194 3:64618585-64618607 TTCCCTCCATTTCACAGATGAGG - Intronic
956197950 3:66672443-66672465 TTCTCCCCATTTGACAGATGAGG + Intergenic
956210466 3:66796422-66796444 TTCACCCCATTTTACAGATGAGG - Intergenic
956431848 3:69194639-69194661 TTACCCCCATTTTACAGATGAGG + Intronic
956501385 3:69889341-69889363 TTACCTCCATTTTATAGATGAGG - Intronic
956712552 3:72051144-72051166 TTTTCCCCATTTCACAGATGGGG - Intergenic
956916653 3:73879034-73879056 TTTCCCCTATTTTATAAAAGAGG + Intergenic
957220653 3:77378345-77378367 TTATCCCCATTTTATAGAATGGG + Intronic
957231834 3:77528598-77528620 TTCTCTCCATTTTATAGAGGAGG - Intronic
958005433 3:87803888-87803910 TTATCCCCATTTTACAGAAGAGG + Intergenic
958443433 3:94184568-94184590 TTCTCCACATTTCACAGACGTGG - Intergenic
959026020 3:101240567-101240589 TTACCCCCATTTAATATATGAGG + Intronic
959865025 3:111256945-111256967 TTAACCCCATTTGATAGAAAAGG + Intronic
959940888 3:112079813-112079835 TTTTCCTCATTTTATAGAAGAGG + Intronic
961093035 3:124131897-124131919 TTTCCCCCATTTTACAGAGGAGG - Intronic
961204325 3:125068813-125068835 TTTTCCCCATTTTATAGAAGAGG - Intergenic
961373825 3:126449451-126449473 CTTTCCCCATTTCACAGAAGGGG + Intronic
961625403 3:128259040-128259062 CTCCCCCTATTTCATAGAAGAGG - Intronic
961731516 3:128968657-128968679 TCACCCCCATTTCACAGAGGAGG + Exonic
962844833 3:139265078-139265100 ATCACCCCATTTTATAGAGGAGG + Intronic
963025362 3:140913708-140913730 TTTCCCCCACTTTAGAGAAGAGG + Intergenic
963041230 3:141071530-141071552 TTATCCCCATTTTATAGATGAGG + Intronic
963215263 3:142739286-142739308 TTGTCCCCATTTTATAGAGGAGG + Intronic
963440123 3:145330390-145330412 TTTCCCCCAATTCATGGAATAGG + Intergenic
963845255 3:150148992-150149014 TTATCCCCATTTTATAGACGAGG - Intergenic
963960932 3:151307989-151308011 TTCTCCCTGTTTCATAGATGAGG - Intronic
964124000 3:153217136-153217158 TTACACCCATTTTATAGATGAGG + Intergenic
964203927 3:154149106-154149128 TTTTCCCCATTTCACAGATGGGG - Intronic
964597617 3:158454290-158454312 TTACCCCCATTTTACAGATGAGG - Intronic
964769981 3:160214221-160214243 TCACTCCCATTTTATAGAAGAGG + Intergenic
965434008 3:168624738-168624760 TTACGCCCATTTTATAGATGAGG + Intergenic
965638694 3:170810735-170810757 TTACTGCCATTTCATAGATGAGG - Intronic
965715775 3:171601201-171601223 TTCTCCCCATTTTATAGATGAGG - Exonic
965716101 3:171604860-171604882 TTCCTCCCAATTTATAGGAGAGG + Intronic
965921410 3:173919487-173919509 TTAGCCACATTTCACAGAAGAGG + Intronic
966056953 3:175705205-175705227 TTATCCTCATTTCACAGAAGAGG + Intronic
966367759 3:179208472-179208494 TTAGTCCCATTTCATAGAGGAGG + Intronic
966663864 3:182448409-182448431 TTACCCCCATTTTGTAGATGAGG - Intergenic
966920461 3:184607958-184607980 TGATCCCCATTTCATAGATGAGG + Intronic
966980602 3:185130679-185130701 TTCTGGCCATTTCATATAAGTGG + Intronic
967045652 3:185734286-185734308 TCAACCCCATTTTATAGAAGAGG + Intronic
967088334 3:186113845-186113867 TTCTCCCCGTTTTATAGATGAGG + Intronic
967288783 3:187899055-187899077 TTATCCCCATTTTACAGAAGAGG - Intergenic
967933127 3:194705207-194705229 TAACCTCCATTTCATAGATGAGG + Intergenic
967991936 3:195137998-195138020 GTCTCCCCATTTCACAGATGAGG + Intronic
968958873 4:3732672-3732694 TTCCTCCCATTTCACAGATCGGG - Intergenic
969080689 4:4615731-4615753 ATGCCCCCATTTGATAGAATAGG + Intergenic
969102175 4:4777408-4777430 TTACTCCCATTTTACAGAAGGGG - Intergenic
969109309 4:4832016-4832038 TTGCCCCCATTTTACAGATGAGG - Intergenic
969169358 4:5347652-5347674 ATCCCCACATGTCAAAGAAGGGG + Intronic
969211648 4:5692401-5692423 TTACTCCCATTTTATAGATGAGG + Intronic
969313923 4:6370266-6370288 ATCACCCCATTTCACAGATGAGG - Intronic
969335611 4:6507868-6507890 ACCCTCCCATTTCATAGATGAGG - Intronic
969347293 4:6577269-6577291 TCACCCCCGTTTAATAGAAGTGG - Intronic
969831021 4:9796962-9796984 TTCCCTCCTTTCCATGGAAGTGG - Intronic
970759576 4:19468622-19468644 TTCCCCCCATTTAATTAATGTGG - Intergenic
971045087 4:22797382-22797404 TTATCCCCATTTCACAGATGAGG + Intergenic
971197808 4:24486206-24486228 TTCTCCCCATTTTACAGACGAGG + Intergenic
971268027 4:25111826-25111848 TTATCCCCATTTCACAGATGAGG + Intergenic
971396282 4:26230479-26230501 TAACCCCCATTTTATAGATGAGG + Intronic
971418054 4:26451751-26451773 TTATACCCATTTCATAGATGAGG + Intergenic
971839259 4:31812309-31812331 TTATCCCTATTTCAAAGAAGAGG - Intergenic
972214387 4:36878889-36878911 TTATCCCCATTTCACAGATGAGG - Intergenic
972570799 4:40308895-40308917 TTCTCCCCATTTTCTAGATGAGG - Intergenic
972742354 4:41899578-41899600 TTCTTCCCATTTTATAGATGAGG + Intergenic
972796216 4:42422573-42422595 TTGCCCCCATTTTATTGATGAGG + Intronic
974020652 4:56689051-56689073 TTCCCCTCATTTCACATATGAGG - Intergenic
974113065 4:57547971-57547993 TTTCCCCCATTTTATAGATGAGG + Intergenic
975804091 4:78094867-78094889 TTACCCCCATTTTACAGATGAGG - Intronic
975848801 4:78551255-78551277 TTATCCCCATTTTATAGATGAGG - Intergenic
975880204 4:78896463-78896485 TTACCCCCATTTTATAGATGAGG - Intronic
977774093 4:100896811-100896833 TTCCCCCTATTTCCAAGTAGTGG - Intergenic
978538312 4:109786719-109786741 TTTTCCACATTTTATAGAAGAGG - Intronic
979375521 4:119942023-119942045 TTAGCCCCATTTTATAGATGAGG - Intergenic
979532048 4:121779251-121779273 TTACCTCCATTTTATAGATGAGG - Intergenic
979641971 4:123019185-123019207 TTATCCCCATATTATAGAAGAGG + Intronic
980932358 4:139194040-139194062 TTATCCCCATTTTATAGATGAGG - Intergenic
981044366 4:140252473-140252495 TTCCCCGCATTTGATAGCTGGGG + Intergenic
981121553 4:141057053-141057075 TTACCTCCATTTTATAGATGAGG - Intronic
981342351 4:143636005-143636027 TTACCCCCACTTTATAGATGAGG - Intronic
981545715 4:145891488-145891510 TTTCCCCCATCTCATATAAGAGG + Intronic
981920652 4:150080642-150080664 TTATCCCCATTTTATAGATGAGG + Intronic
982216343 4:153085621-153085643 TTTCCCTCATTTCATAGATAAGG - Intergenic
982518072 4:156377619-156377641 TTTCCGCCATTTGAAAGAAGTGG + Intergenic
983250961 4:165345949-165345971 TTATCCTCATTTCATAGATGAGG - Intergenic
983520976 4:168708769-168708791 TTATCCCCATTTTATAGATGAGG + Intronic
984788235 4:183589261-183589283 TTCTGGACATTTCATAGAAGTGG + Intergenic
985441005 4:189982475-189982497 TTCCCCCCTTTACCTAGAAAAGG + Intergenic
985798767 5:1987172-1987194 ATCCCCACATGTCAGAGAAGGGG + Intergenic
986575121 5:9204605-9204627 TTCTTCCCATTTCACAGATGAGG + Intronic
986604704 5:9509839-9509861 GTCTCCCCATTTCCTAGAAGAGG - Intronic
986732106 5:10642572-10642594 TTAGCCTCATTTTATAGAAGAGG - Intronic
986862469 5:11943505-11943527 TTCTCCCCATTTCATATAAATGG - Intergenic
987198213 5:15548532-15548554 TTGTCCCCATTTTATAGATGAGG - Intronic
987877819 5:23702436-23702458 TTATCTCCATTTCATAGATGAGG + Intergenic
988417387 5:30962722-30962744 TTAGCCCCACCTCATAGAAGAGG + Intergenic
988448556 5:31315689-31315711 CTGCCCCCATTTTATAGATGAGG - Intronic
988595219 5:32584803-32584825 TTCTCTCCATTTTATAGACGAGG - Intronic
988654921 5:33200120-33200142 CTCAACCCATTTCATTGAAGGGG - Intergenic
988721774 5:33886391-33886413 TTATCCCCATTTCATAGATAAGG + Intronic
988782218 5:34532744-34532766 TTCCCTGCATTTGTTAGAAGTGG + Intergenic
988827001 5:34947392-34947414 TTTCACCAATTTCATAGAGGAGG + Intronic
989271392 5:39537675-39537697 TTCTCCCCATTTGAAAGATGAGG + Intergenic
989415177 5:41166383-41166405 TTACCCCCATTTTATAGATGAGG - Intronic
989671719 5:43925036-43925058 GTCCCTCCATTTCAGAAAAGTGG - Intergenic
990551097 5:56879733-56879755 TTCCTCCTATTTTATGGAAGGGG - Intronic
990649852 5:57885987-57886009 TTACACCCATTTTACAGAAGAGG - Intergenic
990714710 5:58623927-58623949 TTCCCCCCACTACATAAACGAGG - Intronic
990811379 5:59728115-59728137 TTATCCCCATTTGATAGATGAGG + Intronic
991053647 5:62299198-62299220 GTACCCCCATTTTATAGATGAGG + Intergenic
991311235 5:65245049-65245071 TTACCCCCAGTTTATAGATGAGG - Intronic
991416514 5:66398220-66398242 TTACCTCCATTTCACAGACGAGG + Intergenic
991460416 5:66852448-66852470 TTAACTCCATTTTATAGAAGAGG + Intronic
991698992 5:69299619-69299641 TTATCCCCATTTTAGAGAAGAGG - Intronic
991714890 5:69442446-69442468 TTAGCCCCATTTTACAGAAGAGG - Intronic
992089184 5:73302897-73302919 TTATCCCCATTTTACAGAAGAGG + Intergenic
992125867 5:73640693-73640715 TTATTCCCATTTCATAGATGAGG - Intronic
992507543 5:77402749-77402771 TTACCCCCACTTCATAGACAAGG + Intronic
992570903 5:78056290-78056312 TTAGCCCCATTTTACAGAAGAGG - Intronic
992644869 5:78802735-78802757 TTCTCCCCTTTGCATAGATGAGG + Intronic
992703705 5:79366206-79366228 TTATCCCCATTTTATAGATGGGG - Intergenic
992835084 5:80632253-80632275 TTCCCTCCATTCCATTAAAGAGG + Intronic
992879382 5:81091145-81091167 TGCCTCCCATTTCACAGATGGGG - Intronic
994061635 5:95485359-95485381 TTCCACAAATTTCATATAAGTGG + Intronic
994121240 5:96115475-96115497 TTACCTCCATTTTATAGATGGGG + Intergenic
994176546 5:96718123-96718145 TTACCCCCATTTTACAGATGAGG + Intronic
994911139 5:105909764-105909786 TTACTCCCATTTTATAGATGTGG + Intergenic
995046022 5:107649023-107649045 ATCCCCTCATTTCACAGATGAGG + Intronic
995213585 5:109569802-109569824 TTACGCCCATTTTATAGATGGGG + Intergenic
995226415 5:109706159-109706181 TTCTCCCCATTTTACAGATGAGG + Intronic
995314669 5:110754867-110754889 TTTTCTCCATTTCATAGATGAGG - Intronic
995964737 5:117891150-117891172 TTATCCCCATTTCAGAGATGAGG + Intergenic
996340477 5:122433295-122433317 TTATCCCCATTTCATAGATGAGG + Intronic
996538206 5:124601005-124601027 TTATCCTCATTTCATAGAAAAGG - Intergenic
996544231 5:124660678-124660700 TTACTCCCATTTTATAGATGAGG - Intronic
996705554 5:126494443-126494465 ATCCCCCCATTTTATTGATGAGG + Intronic
997524844 5:134545684-134545706 TTACCCCCATTTTACAGATGTGG - Intronic
997612822 5:135227167-135227189 TTTCCCCCATTTTACAGAGGAGG + Intronic
998466780 5:142352869-142352891 TTATTCCCATTTCAGAGAAGAGG + Intergenic
998545177 5:143021640-143021662 TTATCCCCATTTTACAGAAGAGG - Intronic
998594471 5:143514427-143514449 TTATCCCCATTTTATAGATGAGG - Intergenic
998878355 5:146622354-146622376 TTGTCCCCATTTTATAGAGGTGG + Intronic
999191142 5:149748263-149748285 TTCACCCCATTTCACAGGTGAGG - Intronic
999204600 5:149839084-149839106 TTATCCCCATTTTATAGATGAGG + Intronic
999246314 5:150156735-150156757 TTTGCCCCATTTTATAGATGGGG + Intergenic
999265246 5:150262770-150262792 TTATCCCCACTTCATAGAGGAGG + Intronic
999411076 5:151350298-151350320 TTACCCCCATTTTACAGATGAGG + Intergenic
999439750 5:151591992-151592014 TTACCTCCATTTAATAGATGGGG - Intergenic
999476278 5:151901837-151901859 TTATCCCCATTTTATAGATGAGG + Intronic
999690217 5:154139960-154139982 TTACCCCTATTTCATAGGTGAGG - Intronic
999735538 5:154510375-154510397 TTCCGGACATCTCATAGAAGTGG + Intergenic
999889934 5:155966380-155966402 TTGCCCTCATTTTATAGATGAGG - Intronic
999954524 5:156686171-156686193 TTATCCCCATTTCATTGATGAGG + Intronic
1000025782 5:157358009-157358031 TTAGCCCCATTTCACAGATGAGG - Intronic
1000025830 5:157358428-157358450 AACCCCTCATTTCATAGATGTGG + Intronic
1000239313 5:159394736-159394758 TTCTCCTCATTTTATAGATGAGG + Intergenic
1000339801 5:160268384-160268406 TTCTTCCCATTTCACAGATGAGG - Intronic
1000665016 5:163984287-163984309 ATTGCCCCATTTCATAGATGAGG + Intergenic
1001245040 5:170099736-170099758 TTGTCCCCATTTCATAGATGAGG - Intergenic
1001273958 5:170336768-170336790 TTATTCCCATTTTATAGAAGAGG - Intergenic
1001297785 5:170510904-170510926 CTGTCCCCATTTTATAGAAGAGG - Intronic
1001298328 5:170515023-170515045 ATCCCCCTATTTTATAGATGAGG + Intronic
1001403258 5:171458939-171458961 TTATCCCCATTTTATAGATGAGG + Intergenic
1001532640 5:172474965-172474987 TTCCTCCCATTTCACAGATGGGG + Intergenic
1001580662 5:172796084-172796106 TTCACCCCATTTTATAGGTGAGG + Intergenic
1001664039 5:173417864-173417886 TTACCCCTATTTTATAGATGAGG + Intergenic
1001934881 5:175696795-175696817 TTCTCCCCGTCTTATAGAAGGGG - Intergenic
1002095147 5:176826265-176826287 TTCTTCCCATTTCATAGATGGGG - Intronic
1002168321 5:177361609-177361631 TTACCCCCATTTTACAGATGAGG - Intronic
1002327595 5:178420214-178420236 TTCCCCCCATTTCATAGAAGAGG - Intronic
1003150502 6:3544102-3544124 TTCTCCCCATTTTATATATGAGG + Intergenic
1003164762 6:3666489-3666511 ATCACCCCATTTCATGGATGAGG - Intergenic
1003521469 6:6862188-6862210 TTGCACCCATTTCACAGATGAGG - Intergenic
1003665644 6:8108999-8109021 TTATCCCCATTTTATAGATGAGG + Intergenic
1004172355 6:13305445-13305467 TTTCCCCCATTTTAGAGATGGGG - Intronic
1004314443 6:14573626-14573648 TTACCTCCATTTCATAGGTGAGG + Intergenic
1004739287 6:18441764-18441786 TTATCCCCATTTCACAGATGAGG - Intronic
1004892511 6:20114994-20115016 TTACCCCCATTTTACAGATGAGG - Intronic
1004998046 6:21213192-21213214 TTCCTCCCAATTTATAGATGAGG - Intronic
1005840415 6:29741629-29741651 GTTTCCCCATTTCATAGATGAGG + Intergenic
1006021881 6:31122163-31122185 ATACCCCCATTTCACAGATGAGG - Intronic
1006023151 6:31129672-31129694 TTAGCCCCATTTCACAGAAGAGG - Intronic
1006131182 6:31870430-31870452 TTACCCCCATTTTACAGATGGGG + Intronic
1006389434 6:33749811-33749833 TTCCCCTCATTTCACAGTGGAGG + Intergenic
1006389803 6:33751681-33751703 TTCCCCTCATTTCACAGCAGAGG + Intergenic
1006785501 6:36664031-36664053 TTACCCCCATTTTACAGATGAGG - Intergenic
1006843819 6:37049207-37049229 TTCCCCACCTTTCTGAGAAGAGG + Intergenic
1006893721 6:37452270-37452292 TTCTCCTCATTTTATAGATGAGG - Intronic
1006907350 6:37541786-37541808 TTGCCCCCATTTTACAGATGTGG - Intergenic
1007014019 6:38444644-38444666 TTATCCCCATTTTATAGATGTGG - Intronic
1007171192 6:39864783-39864805 TTCTCTCCATTTCACAGATGAGG + Intronic
1007209280 6:40178825-40178847 TTACCCTCATTTTGTAGAAGAGG - Intergenic
1007286848 6:40754088-40754110 TTGTCCCCATTTCATTGATGAGG - Intergenic
1007352677 6:41285378-41285400 TTCTCCCCATTTTATAGATAAGG + Intronic
1007389828 6:41544728-41544750 TTATCTCCATTTTATAGAAGAGG - Intergenic
1007394503 6:41569902-41569924 TTCCCCCCATCTCTTTGAAGGGG - Intronic
1007465212 6:42046990-42047012 TTCTCTCCATTTTATAGACGAGG - Intronic
1007465947 6:42050979-42051001 TTCACACCATTTCATTGAAAGGG - Intronic
1007682257 6:43642544-43642566 TTGTCCCCATTTTATAGATGAGG + Intergenic
1007723444 6:43899990-43900012 TTCATCCCATTTTATAGATGAGG + Intergenic
1007899324 6:45395471-45395493 TTACTCTCATTTTATAGAAGAGG - Intronic
1007910420 6:45507984-45508006 TTACTCCCATTTTATAGATGAGG + Intronic
1007958285 6:45936572-45936594 TTACCCCCATTTCACAGATGAGG + Intronic
1010121389 6:72379729-72379751 ATTCCCCCATTTCATAGATGAGG + Intronic
1011067393 6:83342136-83342158 TTCACCCCATTTAAATGAAGTGG - Intronic
1011766033 6:90621374-90621396 TTGTCCCTATTTTATAGAAGAGG + Intergenic
1013074267 6:106756570-106756592 TTGCCTTCATTTTATAGAAGAGG - Intergenic
1013141246 6:107337511-107337533 TTACCCTCATTTTATACAAGAGG - Intronic
1013155184 6:107486540-107486562 ATACCCCCATTTCACAGATGAGG - Intergenic
1013791521 6:113842762-113842784 TTACCCCCATTTCTCAGATGAGG + Intergenic
1014206590 6:118662568-118662590 TTATCTCCATTTCATAGATGAGG + Intronic
1014791721 6:125680085-125680107 GTCTCCCCATTTCATAGCTGGGG + Intergenic
1015265024 6:131282290-131282312 TTGCCCACATTTTATAGAAAAGG - Exonic
1015750588 6:136554513-136554535 TTTCCTCCATTTCACAGATGAGG + Intergenic
1016389072 6:143557291-143557313 TTTGCCCCATTTCACAGATGGGG + Intronic
1016462129 6:144287949-144287971 TTCCCTCCATTTTATAGGTGTGG + Intronic
1016642181 6:146361665-146361687 ATCCCCCCATTTTATAGACGAGG + Intronic
1016975470 6:149803284-149803306 TTCTCCCCATTCTATAGAATAGG + Intronic
1017030981 6:150221715-150221737 TTACCTCCATTTTATAGAGGAGG - Intronic
1017245970 6:152225108-152225130 TTATCCCCATTTTATAGATGAGG + Intronic
1017276016 6:152569360-152569382 TTACCTCCATTTCACAGATGAGG - Intronic
1017491097 6:154945611-154945633 TTACCTCCATTTTATAGATGAGG - Intronic
1017621794 6:156306847-156306869 TTCTCCTCATTTCACAGAACTGG + Intergenic
1017706494 6:157128071-157128093 TTGCCCCCATTTTACAGATGAGG + Intronic
1018270398 6:162071214-162071236 CTGCCCCCATTTCACAGATGAGG - Intronic
1018475057 6:164132315-164132337 TTCCCCCCACTTCTCAGATGGGG + Intergenic
1018977738 6:168578215-168578237 TTGCCCCCACTTCACAGACGAGG - Intronic
1019062379 6:169265710-169265732 TTCCTGCCACTTCATAGATGGGG - Intergenic
1020480661 7:8656419-8656441 TTATCCCCATTACAGAGAAGAGG + Intronic
1020504106 7:8961353-8961375 TTACTCCCTTTTTATAGAAGTGG - Intergenic
1020793125 7:12650932-12650954 TTATCCCCATTTCCTAGAGGTGG - Intronic
1021002494 7:15349897-15349919 ATCCCCCCATGTCATAGGAGGGG - Intronic
1021195106 7:17665822-17665844 TTATCCCCATTTTGTAGAAGGGG - Intergenic
1021463307 7:20913244-20913266 TTCCCTCCATTTTAAAGAAATGG + Intergenic
1022036259 7:26537617-26537639 TTATCCCCATTTCACAGAGGTGG - Intronic
1022235898 7:28459897-28459919 TTATCCCCATTTTATAGATGAGG + Intronic
1022441716 7:30438383-30438405 TTATCCCCATTTTATAGATGGGG - Intronic
1022461755 7:30615330-30615352 TTCATCCCATTTCAAAGAATGGG - Intronic
1022474076 7:30699152-30699174 TTCTCCCCATTTTACAGATGGGG - Intronic
1022487808 7:30793945-30793967 TTATCCCCATTTCACAGATGAGG + Intronic
1022570883 7:31453211-31453233 TCATCCCCATTTCATAGAAGAGG + Intergenic
1022687383 7:32609396-32609418 TTCCCCTCATTTACTAGGAGAGG + Intergenic
1022896488 7:34754853-34754875 TTCTCCACATTTCATATAAATGG + Intronic
1023320152 7:38988100-38988122 TCATCCCCATTTTATAGAAGTGG + Intronic
1024697859 7:51874661-51874683 TTATCCCCATTTTATAGATGAGG - Intergenic
1025245087 7:57310909-57310931 TTAGCCCCATTTCACAGAGGGGG - Intergenic
1026587889 7:71671641-71671663 TTCCTCCCATTTTATAGATGAGG - Intronic
1026661767 7:72309007-72309029 TTATCCCCATTTTATAGATGGGG + Intronic
1026666201 7:72341715-72341737 TTATCCCCATTTTATAGATGAGG - Intronic
1026741334 7:72980530-72980552 TGCCCCCCACTTCATGGAGGAGG - Intergenic
1026859569 7:73776986-73777008 TTTCCCTCATTTTATAGAGGAGG + Intergenic
1027102400 7:75384548-75384570 TGCCCCCCACTTCATGGAGGAGG + Intergenic
1027163644 7:75819908-75819930 CCCCCACCATTTCATAGATGAGG - Intronic
1027445454 7:78268507-78268529 GTGTCCCCATTACATAGAAGAGG + Intronic
1027603687 7:80272428-80272450 TTACCCTCATTGTATAGAAGTGG + Intergenic
1027825515 7:83110012-83110034 TTCTCCTCATTTTATAGATGAGG - Intronic
1028239100 7:88397739-88397761 TTACCCCCATTTTACAGATGAGG - Intergenic
1028696799 7:93723341-93723363 TTAGCCTCTTTTCATAGAAGGGG - Intronic
1029326827 7:99816951-99816973 TTCCCATCATTTCATAGGATGGG + Intergenic
1029725513 7:102401137-102401159 TTTTCCCCATTTTATAGATGAGG + Intronic
1030065241 7:105654382-105654404 TATCCCCAATTTCATAGATGTGG + Intronic
1030217304 7:107057662-107057684 TTATTCCCATTTCATAGATGAGG - Intronic
1030228583 7:107180625-107180647 TTGCCCCCATTTAATATATGGGG + Intronic
1030434167 7:109494206-109494228 TTAACCCCATTTTATAGATGAGG - Intergenic
1030648275 7:112088827-112088849 TTATCCCCATTTTATAGATGAGG - Intronic
1031013578 7:116548774-116548796 TTCCCCCCATTTTACAGATTAGG - Intronic
1031091140 7:117356402-117356424 TTCCGGCCATTTCATATAAATGG - Intergenic
1031781256 7:125968746-125968768 TTCCAACCATTTACTAGAAGTGG - Intergenic
1031994138 7:128217561-128217583 TTCCCCTCATGTCACAGATGAGG - Intergenic
1032237482 7:130137941-130137963 TTAGCCCCATTTCAGAGAAAAGG - Intergenic
1032347512 7:131130481-131130503 TTACCCCCATTTCACAGAAGTGG + Intronic
1032538805 7:132686400-132686422 TTCTCCCCATTTTACAGATGAGG + Intronic
1035836400 8:2758149-2758171 TTCCCCCAATTTATTAGTAGAGG + Intergenic
1036217217 8:6890698-6890720 TTCCTCCCTTTTAAAAGAAGAGG + Intergenic
1036523170 8:9511221-9511243 TTTTTCCCATTTCATAGATGAGG - Intergenic
1037295924 8:17400311-17400333 TTATCCCCATTTCACAGATGAGG + Intronic
1037348093 8:17921597-17921619 TCCCCCTCATTTCATAGATGGGG + Intergenic
1037440538 8:18911515-18911537 TCACCCCCATTTTATAGATGAGG - Intronic
1037669295 8:21000516-21000538 TCCCACCCATCTCAGAGAAGAGG - Intergenic
1037670669 8:21012695-21012717 TTATCCCCATGTCACAGAAGAGG - Intergenic
1037913853 8:22760181-22760203 TTACCCCCATTTTATAGACAGGG + Intronic
1038021651 8:23556149-23556171 TTGCCCCCACTTCAAAAAAGTGG - Intronic
1038589639 8:28824843-28824865 TTCTCTCCATTTTATAGATGAGG - Intronic
1038979200 8:32738222-32738244 TTCTCCCCAGAGCATAGAAGTGG + Intronic
1039321252 8:36434548-36434570 TTCCCCCCCTTTTAAAGCAGGGG - Intergenic
1039557913 8:38489954-38489976 TTCCCTCCATTTTACAGATGTGG - Intergenic
1039657891 8:39430060-39430082 TTCACTACATTTCATACAAGTGG + Intergenic
1040931870 8:52743790-52743812 TTCCTCAAATTTCATATAAGTGG - Intronic
1040998455 8:53425449-53425471 CTGTCCCCATTTCATAGATGAGG - Intergenic
1041131598 8:54707869-54707891 TTATCACCATTTCACAGAAGAGG + Intergenic
1041733529 8:61086901-61086923 TTCTCCCCATTTCATAAATGAGG + Intronic
1042535448 8:69854079-69854101 TTATCCCCATTTTGTAGAAGAGG + Intergenic
1042839674 8:73111133-73111155 TTATCCCCATTTTATAGAGGAGG + Intronic
1042841884 8:73132213-73132235 TTACCCCCAGTTCACAGAGGGGG + Intergenic
1042842599 8:73139000-73139022 TTATCCCCATTTTATAGATGAGG - Intergenic
1043197225 8:77311186-77311208 CTCCCCACATTTCAGGGAAGTGG + Intergenic
1043553989 8:81408736-81408758 TTATTCCCATTTTATAGAAGAGG - Intergenic
1043869155 8:85411726-85411748 TTACTCCCATTTTATAGATGTGG + Intronic
1044028171 8:87199708-87199730 TTCCCCTCATTTTAGAGCAGGGG + Intronic
1044407240 8:91842132-91842154 TTATCCCCATTTCACAGATGGGG - Intergenic
1044593604 8:93937837-93937859 TTAGCCCCATTTTATAGATGAGG - Intergenic
1044726455 8:95198224-95198246 TTCCTCCCATTTTATAGACAAGG - Intergenic
1045184488 8:99823228-99823250 TTAACCCCATTTTACAGAAGAGG - Intronic
1045266873 8:100626261-100626283 TTCTCCCCATTTTACAGATGGGG + Intronic
1045655417 8:104382060-104382082 TTTCCCCCATTTCATGGATGAGG - Intronic
1045696241 8:104811542-104811564 TTATCCCCATTTTATAGAAAAGG - Intronic
1045844922 8:106622963-106622985 TTACCCCCATTTTACAGATGAGG + Intronic
1046495032 8:115002860-115002882 TTACTCCCATTGCACAGAAGAGG - Intergenic
1046593719 8:116236089-116236111 TTACCCCCATTTCATAGGTGAGG + Intergenic
1046611021 8:116425667-116425689 TTGTCCCCATTTTATAGAGGAGG - Intergenic
1046783232 8:118238142-118238164 CTACCCCCATTTTATAGATGAGG - Intronic
1047056885 8:121174752-121174774 TTATCCCCACTTCACAGAAGAGG - Intergenic
1047183727 8:122613611-122613633 TTCCATCAATTTCAAAGAAGAGG - Intergenic
1047206964 8:122810261-122810283 TACCCCCCATTTTACAGAAAAGG - Intronic
1047320724 8:123779177-123779199 GTACCCCCATTTCACAGATGAGG + Intronic
1047338420 8:123957559-123957581 TTGCCCCCATTTTATAACAGAGG + Intronic
1047490770 8:125373073-125373095 TTACCCCCATTTTACAGATGAGG + Intergenic
1047504533 8:125468760-125468782 TTCCCCCAATTCTGTAGAAGGGG + Intergenic
1047505319 8:125475169-125475191 TTCCCCCCATTTTACAGATTGGG + Intergenic
1047508628 8:125499300-125499322 TTCTCTCCATTTCACAGAAAAGG + Intergenic
1047528890 8:125657455-125657477 TTGCCCCCATTTTATAGATGAGG - Intergenic
1047932945 8:129748934-129748956 TTTTCACCATTTCATAGATGTGG - Intronic
1048028361 8:130607632-130607654 TTATCCCCATTTCACAGATGTGG + Intergenic
1048062837 8:130938206-130938228 TTATCCCCATTTGATAGATGAGG - Intronic
1048066940 8:130979693-130979715 TTACCTCCATTTTATAGATGAGG - Intronic
1048287905 8:133156372-133156394 TCTCCCCCATTTCATAGAACAGG + Intergenic
1048304308 8:133272949-133272971 TTCCCTCCTTTTCTTGGAAGCGG - Intronic
1048325307 8:133434586-133434608 TTCCCCCCATTTTACAGGTGAGG + Intergenic
1048334915 8:133495390-133495412 TTATCCCCATCTTATAGAAGAGG + Intronic
1048342675 8:133552926-133552948 TTACTCCCATTTCACAGATGTGG + Intronic
1048413451 8:134199731-134199753 TTTCCCCCAATTTACAGAAGAGG + Intergenic
1048462453 8:134633214-134633236 TTATTCCCATTTTATAGAAGAGG - Intronic
1048862809 8:138736540-138736562 TTGTCCCCATGTCATAGATGAGG - Intronic
1048998984 8:139812838-139812860 TTTCCCCCATTCCATAGTTGAGG - Intronic
1049913852 9:297224-297246 TTCCCCCTATTTCATACTTGAGG + Intronic
1049984002 9:931383-931405 TTCCTCTCACTGCATAGAAGAGG - Intronic
1050118654 9:2286393-2286415 TTGATCCCATTTTATAGAAGAGG + Intergenic
1050236469 9:3586403-3586425 TTCTCCCCATTTTATACATGAGG + Intergenic
1050383292 9:5054979-5055001 CTTCTCCCATTTGATAGAAGTGG + Intronic
1050626179 9:7506045-7506067 TTACCTTCATTTTATAGAAGGGG - Intergenic
1050746763 9:8885246-8885268 TTACCCTCATTTTATAGATGAGG + Intronic
1051165431 9:14257175-14257197 TTCCCCTCATTTTATAGGTGAGG - Intronic
1051232550 9:14967706-14967728 TTCTCCCCAAATCACAGAAGGGG - Intergenic
1051706417 9:19885501-19885523 CTCTCCCCATTTTATAGATGAGG + Intergenic
1051941754 9:22514708-22514730 TCCTCCCCATTTCACAGATGAGG + Intergenic
1053173661 9:35907729-35907751 TCCACCCCATTGCAGAGAAGAGG - Intergenic
1053304858 9:36977233-36977255 TTCCTCCCATTTTACAGATGAGG + Intronic
1053421799 9:37984453-37984475 GTCACCCCATTTTATAGATGGGG + Intronic
1053484445 9:38441563-38441585 ATCACCCCATTTCACAGATGAGG - Intergenic
1054870093 9:70041393-70041415 TTATCCCCATTTAATAGATGGGG - Intergenic
1055002039 9:71462482-71462504 TTATCCCCATATCACAGAAGAGG + Intergenic
1055305415 9:74924162-74924184 TTCTCCCCATTTGATAGATGAGG - Intergenic
1055964178 9:81849375-81849397 TTCTCCCCACTTCGTAGATGAGG - Intergenic
1056341901 9:85643363-85643385 TTACCCCCATTTAACTGAAGAGG + Intronic
1057327078 9:94075115-94075137 TTCCCCCCATCAGATAGAAATGG - Intronic
1057425702 9:94947743-94947765 TCCTCCCCATTTGATAGAGGAGG + Intronic
1057704168 9:97386028-97386050 ATCAGCCCATTTCATAGAGGAGG + Intergenic
1057824099 9:98359001-98359023 TTGCCCCCATTTTATAGATGAGG - Intronic
1057842697 9:98499330-98499352 CTCCCCTCATTTCACAGATGAGG + Intronic
1057975085 9:99597082-99597104 TTACCCCCATTTTACAGATGTGG + Intergenic
1057977896 9:99625990-99626012 TTAACCCCATTTTATAGAAGAGG + Intergenic
1058307880 9:103465263-103465285 ATCCCCACATGTCATGGAAGTGG - Intergenic
1058594579 9:106601746-106601768 TTACCCCCATTTTATAGATAAGG + Intergenic
1058749592 9:108026221-108026243 TTACCCCCATTTCAGAGATGAGG + Intergenic
1058812509 9:108654917-108654939 TTATCCCCATTTTATAGATGAGG - Intergenic
1058834719 9:108850801-108850823 TTCCCCCCATTTTACAGGTGAGG - Intergenic
1059032163 9:110710306-110710328 TACCCCCCATTTCACAAATGAGG - Intronic
1059346610 9:113633178-113633200 TTACCCCCATTTCACAGATGAGG - Intergenic
1059420484 9:114187461-114187483 TTACCCCCATTTTACAGATGAGG + Intronic
1059427229 9:114228631-114228653 CTGTCCCCATTTCATAGATGAGG - Intronic
1059442426 9:114316193-114316215 TTCCCCCCATTATATAGATGAGG - Intergenic
1059713513 9:116891508-116891530 TTACCCCCACTTTATAGATGAGG + Intronic
1059758390 9:117315526-117315548 TTACTCCCATTTCATAAATGAGG - Intronic
1060037360 9:120267157-120267179 TCACCCCCATTTTATAGATGTGG + Intergenic
1060048266 9:120358402-120358424 TTATCCCCATTTCACAGATGAGG + Intergenic
1060058985 9:120442143-120442165 GTACCCCCATTTTACAGAAGAGG + Intronic
1060137212 9:121169157-121169179 TGAGCCCCATTTTATAGAAGAGG - Intronic
1060150480 9:121285132-121285154 TCACCCCCATTTCACAGATGTGG - Intronic
1060205888 9:121682649-121682671 TCCCCCACATTTCACAAAAGGGG - Intronic
1060259391 9:122060703-122060725 CTCCCCCCATTTTACAGATGAGG - Intronic
1060298807 9:122361783-122361805 TGCCCCCCATTTTATAGACGAGG + Intergenic
1060441081 9:123639928-123639950 TTGTCCCCATTTTATAGATGAGG + Intronic
1060516029 9:124266313-124266335 TTCTGCCCATTTTATAGATGAGG + Intronic
1060667567 9:125441395-125441417 TTGTCCCCATTTTATAGAAGAGG - Intronic
1060977037 9:127770950-127770972 TCACCCCCATTTTATAGATGAGG - Intronic
1060988615 9:127835704-127835726 CTACCCCCATTTCACAGATGAGG - Intronic
1061080040 9:128364603-128364625 TTATCCCCATTTCACAGATGAGG + Intergenic
1061149980 9:128823037-128823059 TCGCCCCCATTTTACAGAAGAGG - Intronic
1061403631 9:130382053-130382075 TTCTCCTCATTTCACAGATGAGG + Intronic
1061446427 9:130640749-130640771 ATCTCCCCATTTCACAGAAGAGG + Intergenic
1061798554 9:133102288-133102310 ATCACCCCATTTCACAGAGGAGG + Intronic
1061872531 9:133528473-133528495 TTCTCCCCATTTTACAGAAGAGG + Intronic
1062175416 9:135159390-135159412 TTAGCCCCATTTTATAGATGGGG + Intergenic
1062385833 9:136311194-136311216 TTATCCCCATTTCACAGATGGGG + Intergenic
1185717998 X:2358662-2358684 TTCTTCCCATTTCATAGACGAGG + Intronic
1185718738 X:2365045-2365067 TTACCCCAATTTCATAAATGAGG - Intronic
1186060247 X:5697655-5697677 TTCTCCACATTTCAGAGATGAGG - Intergenic
1186623259 X:11263842-11263864 TCATCCCCATTTCATAGATGAGG - Intronic
1186661554 X:11672585-11672607 TTCCCCCCTTTTAATAGAAACGG + Intergenic
1186925027 X:14324165-14324187 TCTCCCCCATTTCACAGATGAGG + Intergenic
1187235395 X:17462644-17462666 TTATCCCCATTTCACAGATGAGG + Intronic
1187363864 X:18650855-18650877 ATGCCCCCATTTCACAGATGAGG - Intronic
1187452004 X:19406492-19406514 TTCTGGCCATTTCATATAAGTGG - Intronic
1187509016 X:19900782-19900804 TTCTCCCCATTTTACAGATGGGG - Intergenic
1187528755 X:20077515-20077537 TTATCTCCATTTTATAGAAGAGG - Intronic
1187975005 X:24696151-24696173 TTATCCCCATTTCACAGATGTGG + Intronic
1188047054 X:25438008-25438030 TTCTTCCCATTTTAGAGAAGAGG + Intergenic
1188926183 X:36047321-36047343 TTAGCTCCATTTCATAGATGAGG - Intronic
1189330059 X:40138924-40138946 TACCCTCCATTTCACAGATGGGG + Intronic
1189564806 X:42230666-42230688 TTATCCCCATTTTATAGATGAGG - Intergenic
1189738255 X:44093117-44093139 TTTTCCCCATTTTATAGAAGAGG - Intergenic
1190451700 X:50588454-50588476 TTTCCACCATTTGACAGAAGAGG + Intergenic
1190693153 X:52929026-52929048 TTCCCAAGGTTTCATAGAAGTGG + Intronic
1190790197 X:53692413-53692435 TTATCCCCATTTTACAGAAGAGG - Intergenic
1190877000 X:54467131-54467153 TTCCCCCCATTTTATAGATGAGG + Intronic
1190929762 X:54937380-54937402 TTCTCCCCATTTTACAGATGAGG + Intronic
1191892267 X:65956394-65956416 GTACCCCCTTTCCATAGAAGGGG + Intergenic
1192177231 X:68893645-68893667 TTAACCCCATTTTATAGAAGAGG + Intergenic
1192439393 X:71163658-71163680 TTATCCCCATTTTACAGAAGAGG + Intronic
1192700051 X:73459191-73459213 TTCCCCCTTTTTCCTAAAAGGGG - Intergenic
1193339491 X:80330952-80330974 TTATCTCCATTTTATAGAAGAGG - Intergenic
1194094586 X:89621835-89621857 TTACCCCCATTTTACAGATGAGG - Intergenic
1195230869 X:102845507-102845529 TTATCCCCATTTTACAGAAGGGG - Intergenic
1195331708 X:103808261-103808283 TTGCCCCCATTTTACAGATGAGG - Intergenic
1195389912 X:104350889-104350911 TTATCCCCATTTCAAAGATGAGG - Intergenic
1196018622 X:110965849-110965871 TTATCCCCATTTTATAGATGTGG + Intronic
1196145097 X:112307944-112307966 TTAGCCCCATTTGATAGATGAGG + Intergenic
1196719287 X:118839050-118839072 TTGTCCCTATTTTATAGAAGAGG + Intergenic
1196742052 X:119033759-119033781 TCATCCCCATTTTATAGAAGAGG + Intergenic
1196798266 X:119519946-119519968 TTATCCCCATTTTATAGATGAGG + Intergenic
1197303942 X:124817575-124817597 TTACCTCCATTTCACAGGAGAGG + Intronic
1197386193 X:125805645-125805667 TTACCACCATTCCATAAAAGAGG + Intergenic
1198073881 X:133176400-133176422 TCCTCCCTATTTCATAGCAGTGG + Intergenic
1198156790 X:133968509-133968531 TTTCCCCCATTTTACAGATGAGG - Intronic
1198400320 X:136262471-136262493 CTCCCCTCATTTCTTACAAGTGG + Intergenic
1198462170 X:136874247-136874269 GTACCCCCTTTCCATAGAAGGGG + Exonic
1198576657 X:138017523-138017545 TTCTGCCCATTTTACAGAAGAGG + Intergenic
1198633378 X:138668219-138668241 TTACCTCCATTTTATAGATGAGG + Intronic
1199707859 X:150446383-150446405 TTCCTTCCTTTTCATAGAACTGG + Intronic
1199732099 X:150644767-150644789 TTCTCCCCATTTTATGGAAGAGG + Intronic
1199741346 X:150739252-150739274 ATGCCCCCATTTCAGAGAGGAGG - Intronic
1199946079 X:152669296-152669318 TTCCCCCCATTGCACAGATGGGG + Intergenic
1200138971 X:153888133-153888155 GTGCCCCCATTTCACAGATGAGG + Intronic
1200447219 Y:3278004-3278026 TTACCCCCATTTTACAGATGAGG - Intergenic