ID: 1002328041

View in Genome Browser
Species Human (GRCh38)
Location 5:178422549-178422571
Sequence CTCAGGGACGTGCAGACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 250}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002328041_1002328050 7 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328050 5:178422579-178422601 AACCCAGCAGGCCGGGAGCTGGG 0: 1
1: 0
2: 1
3: 23
4: 222
1002328041_1002328048 0 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328048 5:178422572-178422594 CCACAGCAACCCAGCAGGCCGGG 0: 1
1: 0
2: 2
3: 33
4: 424
1002328041_1002328049 6 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328049 5:178422578-178422600 CAACCCAGCAGGCCGGGAGCTGG 0: 1
1: 0
2: 0
3: 25
4: 242
1002328041_1002328053 10 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328053 5:178422582-178422604 CCAGCAGGCCGGGAGCTGGGAGG No data
1002328041_1002328056 16 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328056 5:178422588-178422610 GGCCGGGAGCTGGGAGGGACGGG 0: 1
1: 0
2: 3
3: 111
4: 849
1002328041_1002328045 -5 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328045 5:178422567-178422589 CTGAGCCACAGCAACCCAGCAGG 0: 1
1: 0
2: 1
3: 39
4: 412
1002328041_1002328046 -1 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328046 5:178422571-178422593 GCCACAGCAACCCAGCAGGCCGG 0: 1
1: 0
2: 3
3: 29
4: 561
1002328041_1002328054 11 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328054 5:178422583-178422605 CAGCAGGCCGGGAGCTGGGAGGG 0: 1
1: 0
2: 3
3: 75
4: 541
1002328041_1002328055 15 Left 1002328041 5:178422549-178422571 CCCGCTGTCTGCACGTCCCTGAG 0: 1
1: 1
2: 0
3: 26
4: 250
Right 1002328055 5:178422587-178422609 AGGCCGGGAGCTGGGAGGGACGG 0: 1
1: 1
2: 14
3: 124
4: 1203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002328041 Original CRISPR CTCAGGGACGTGCAGACAGC GGG (reversed) Intronic
900757223 1:4444611-4444633 CTCAGGGAAGTGGAAACTGCGGG + Intergenic
900860178 1:5223342-5223364 GTCAGGGACATGCAGGCACCAGG + Intergenic
900860406 1:5225062-5225084 CTTAGGGATGTCCAGATAGCTGG + Intergenic
900882274 1:5390791-5390813 CTCAGGCAATTGTAGACAGCTGG + Intergenic
900942309 1:5807707-5807729 CTAAGGGAAGAGCAGACACCTGG + Intergenic
901887259 1:12231124-12231146 CCCACGGGCGGGCAGACAGCCGG - Intronic
902974774 1:20080834-20080856 CTGAGGGAGGTGCAGAGAGCAGG + Intronic
903067375 1:20708141-20708163 CTCAGGGAGGGGCAGAGACCAGG - Intronic
903995671 1:27304077-27304099 CTCTGGCACATGCAGACAGAGGG - Intronic
904081158 1:27873262-27873284 CACAGGGATGGGCACACAGCAGG + Intronic
904136263 1:28314912-28314934 CTGGGGGAAGAGCAGACAGCAGG + Intergenic
905159611 1:36020141-36020163 CTCAGGAAGGAGCAGGCAGCCGG + Intronic
905340888 1:37276552-37276574 CTCAGGGAGGTGCAGGCAGAGGG + Intergenic
907315869 1:53572199-53572221 CTCTGGGAAGTGGAGACACCAGG - Intronic
907487651 1:54788454-54788476 CTCAGGAAGGTGAAGACTGCAGG - Intronic
908997671 1:70177030-70177052 CTCTGGGAGGTGGAGACAGGCGG + Intronic
916754583 1:167756836-167756858 CTCTTGGGGGTGCAGACAGCCGG + Intronic
917149726 1:171930467-171930489 CTCAGGCACATGCAGAGACCAGG - Intronic
917342821 1:173996984-173997006 CTCTGGGAGGTGGAGACAGGTGG + Intronic
920170628 1:204070348-204070370 CTCAGGGACTTGCAAAGAGATGG + Intergenic
921257660 1:213357009-213357031 CACAGGGAGGGGCAGAAAGCAGG + Intergenic
923206434 1:231763211-231763233 CCCATGGCCATGCAGACAGCAGG - Intronic
1063015285 10:2070745-2070767 CTCAGGGACATCCAGCCAGGGGG + Intergenic
1063121590 10:3108743-3108765 CTCGGGCACGTGCAGAGAGGAGG + Exonic
1063367997 10:5502859-5502881 CTAAGGGAGGTGCAGAAGGCTGG + Intergenic
1064782910 10:18862399-18862421 CTAAGGGATGTCCAGAGAGCTGG - Intergenic
1065664198 10:28040620-28040642 CTTTGGGAGGTGGAGACAGCAGG - Intergenic
1067524825 10:47031891-47031913 AGCAGGGAGGAGCAGACAGCAGG + Intergenic
1067555936 10:47271609-47271631 CTAAGGGGTGTCCAGACAGCTGG + Intergenic
1067736110 10:48852140-48852162 CTCAGGGATGTGGAGACAGGAGG - Intronic
1069687425 10:70327189-70327211 CTAAGGGATGCCCAGACAGCTGG + Intronic
1073453518 10:103623142-103623164 CACAGGGCCGGGCACACAGCTGG + Intronic
1075819748 10:125296695-125296717 TTCAGGGACGTGGAGGCAGGAGG + Intergenic
1076545038 10:131239630-131239652 CACAGGGCAGTGCAGACAGAGGG + Intronic
1076800200 10:132818230-132818252 ATAAGCGATGTGCAGACAGCTGG + Intronic
1077434330 11:2531527-2531549 CCCAGGGATGCGCAGACAGTGGG - Intronic
1077930060 11:6721539-6721561 CTGAGGGACTTGCTGACAGAAGG - Intergenic
1081022448 11:37963695-37963717 GAAAGGGAAGTGCAGACAGCAGG - Intergenic
1081627006 11:44662103-44662125 CTCAGGGACTGGCAGATAGCAGG - Intergenic
1081989510 11:47330244-47330266 CTGAGGGCCCTGCAGAGAGCTGG + Intergenic
1082959466 11:58905310-58905332 CTCTGCGACTTGCAGTCAGCTGG + Intergenic
1083708890 11:64535221-64535243 CTAAGAGGCCTGCAGACAGCAGG - Intergenic
1084351232 11:68601293-68601315 CTCAGAGACGTGCACACAGAGGG - Intronic
1084872117 11:72105380-72105402 CTCAGGGAAGAGCAGGCAGAGGG + Intronic
1085392888 11:76191480-76191502 CTCAGGGTCACGCACACAGCAGG - Intronic
1085720485 11:78908094-78908116 TTCAGGGAGGTGCAGCCAGGAGG - Intronic
1087624352 11:100579984-100580006 CTAAGGGATGTCCAGATAGCTGG - Intergenic
1087894274 11:103570731-103570753 CTAAGGGATGTCCAGACAGCTGG - Intergenic
1089246748 11:117126817-117126839 CTAAGGGATGTCCAGATAGCTGG + Intergenic
1090001182 11:122960283-122960305 CACAGGGATGTTAAGACAGCTGG + Intergenic
1090183238 11:124718868-124718890 CTCAGGGAGGTGAAGCCTGCGGG + Intergenic
1094395360 12:29999466-29999488 CTAAGGGATGTCCAGATAGCTGG - Intergenic
1097107048 12:56632140-56632162 CTCAGGGACTTGAGGTCAGCAGG - Intronic
1097722793 12:63041667-63041689 CTAAGGGATGTCCAGATAGCTGG - Intergenic
1102422293 12:112813534-112813556 CCCAGGGAAGTGAACACAGCTGG + Intronic
1102434158 12:112907613-112907635 CTCAAGGTCTTGCAGCCAGCAGG - Intronic
1104461694 12:128961807-128961829 CTAAGGGATGTCCAGATAGCTGG - Intronic
1104997128 12:132664976-132664998 CTCAGGGACTTGCAGAGTGTCGG - Intronic
1106100976 13:26695047-26695069 CTCAGGGGCGTGCAGACAGCAGG - Intergenic
1108007393 13:45963528-45963550 CTCAGGGAGGTTGAGGCAGCAGG - Exonic
1109273921 13:60283498-60283520 CTAAGGGATGTCCAGATAGCTGG - Intergenic
1113090276 13:106610714-106610736 ATCAGGGATGTGCAGGCAACAGG - Intergenic
1113204412 13:107898545-107898567 CTAAGGGATGTTCAGATAGCTGG - Intergenic
1115082595 14:29474917-29474939 CTAAGGGATGCCCAGACAGCTGG + Intergenic
1120330037 14:83080715-83080737 CTTAGGGAAGTGCAGAAAGATGG - Intergenic
1121007786 14:90501244-90501266 CACAGGGATGCGCAGTCAGCAGG - Intergenic
1121272907 14:92649887-92649909 CTCAGAGGGGTGCACACAGCTGG + Intronic
1121408652 14:93734535-93734557 CTCAGGGACTTGCAGAGTGGGGG - Intronic
1122714278 14:103684589-103684611 CTCAGGGAGGAGGAGGCAGCTGG + Intronic
1124628727 15:31325780-31325802 CTCCGGGAGGCCCAGACAGCGGG + Intergenic
1125755941 15:42065162-42065184 CTCAGAGACAGGAAGACAGCAGG - Intergenic
1127088128 15:55443360-55443382 CTCAGGGCCGTGCAGGCCGTGGG + Intronic
1127188403 15:56505302-56505324 CTCAGGCACATGCAGAGACCTGG + Intergenic
1128669083 15:69560855-69560877 GTCAGGGAGGTGAAGACAGAAGG + Intergenic
1129873957 15:78960226-78960248 CCCTGGGACCTGCAGCCAGCTGG - Exonic
1130656061 15:85792949-85792971 CTCAGGGCCTGGCACACAGCAGG + Intronic
1130928136 15:88400255-88400277 CTCAGGAAGGGCCAGACAGCTGG + Intergenic
1132623175 16:877805-877827 CTGAGGGACCCGCAGACAGACGG + Intronic
1132738296 16:1398041-1398063 CTCACGGACGTGGAGAACGCAGG + Intronic
1132937774 16:2490300-2490322 CTCAGGGAGCTGCTGGCAGCTGG + Intronic
1134362927 16:13549583-13549605 CTAAGGGGTGTGCAGATAGCTGG - Intergenic
1138525918 16:57607199-57607221 CTCAGGGACTTCTACACAGCTGG + Intergenic
1138862022 16:60770189-60770211 CTCAAGGCCCTGCAGTCAGCTGG + Intergenic
1138862034 16:60770283-60770305 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862039 16:60770330-60770352 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862044 16:60770377-60770399 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862049 16:60770424-60770446 CTCAGGGTCCTGCAGTCAGCTGG + Intergenic
1138862055 16:60770518-60770540 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1138862059 16:60770565-60770587 CTCAAGGTCCTGCAGTCAGCTGG + Intergenic
1139230834 16:65281070-65281092 CCCTGGCACTTGCAGACAGCAGG - Intergenic
1139721722 16:68861539-68861561 CTCAGGGAAGTGCAGGCAGGAGG - Intronic
1139955386 16:70690687-70690709 CCCTGGGAGGGGCAGACAGCTGG - Intronic
1140280467 16:73550109-73550131 CTCGGAGACCAGCAGACAGCAGG - Intergenic
1140933127 16:79646440-79646462 CTCAGGTCCGTGCAGAGAGGAGG + Intergenic
1142177955 16:88653518-88653540 CTCAGGGAGGGGGAGACGGCAGG + Intronic
1143119960 17:4600318-4600340 TCCAGGGTCGTGCAGGCAGCAGG + Intronic
1143327535 17:6109292-6109314 ATGAGCGACGTGCAGAAAGCAGG - Intronic
1144828300 17:18118734-18118756 CTCAGGGACTTGGAGACACAGGG - Exonic
1147739998 17:42665948-42665970 CTCAGGGACTGGCACAGAGCGGG + Intronic
1152214960 17:79026741-79026763 CCCAGGCAGGTGCAGCCAGCTGG + Intronic
1152608259 17:81303646-81303668 CTGAGAGACCTGCAGCCAGCTGG + Intergenic
1155220214 18:23678355-23678377 CTAAGGGATGCCCAGACAGCTGG - Intergenic
1157327286 18:46678391-46678413 GTCAGGGACGTGGAGAGTGCAGG - Intronic
1157473571 18:48007823-48007845 CTCGCGGACCTGCAGTCAGCTGG - Intergenic
1157805533 18:50655050-50655072 CTCAGGGAGGTGAAGATAACAGG + Intronic
1160172060 18:76563241-76563263 CAGAGGGACGTCCAGATAGCAGG - Intergenic
1160733574 19:651888-651910 CTCAGGCCCGTGCAGTCTGCTGG + Intronic
1160942015 19:1624692-1624714 CTCACGGACGTGCGCACAGTGGG + Intronic
1161086539 19:2338135-2338157 CACAGGGACATGCCGACTGCTGG + Intronic
1161907634 19:7168985-7169007 GTCAGGGAAGTGCAGTCAGCAGG + Intronic
1162052826 19:8045110-8045132 CCCAGTGATGTGCAGAGAGCTGG - Intronic
1163297352 19:16420958-16420980 CTCCGGGAGGTGCGGGCAGCAGG - Intronic
1166974912 19:46600416-46600438 CTCAGGTCCCTGCATACAGCAGG + Intronic
1168266928 19:55228412-55228434 CTCAGCCACCTGCAGACATCTGG + Exonic
1168273065 19:55260519-55260541 CTAAGGGATGTCCAGATAGCTGG - Intergenic
1168540202 19:57203731-57203753 CTCAGGGACCAGCAGCCAGGGGG - Intronic
1168639074 19:58018841-58018863 TTCAGGGAAGGGGAGACAGCAGG - Intergenic
1168714104 19:58517187-58517209 CCGGGGGACGTGCAGCCAGCAGG + Exonic
925676666 2:6369175-6369197 CTAAGGGATGCCCAGACAGCTGG + Intergenic
926568698 2:14506790-14506812 CAGAGGAACGTTCAGACAGCAGG - Intergenic
928323857 2:30304454-30304476 CTCAGGGATGCCCAGAGAGCTGG + Intronic
930229194 2:48826723-48826745 CTCAGGCACATGCAGAGACCCGG + Intergenic
930838862 2:55824737-55824759 CTCAGGCACATGCAGAGTGCTGG + Intergenic
931387153 2:61808125-61808147 CTCAGAGATTGGCAGACAGCAGG - Intergenic
933841659 2:86291721-86291743 GCCAGGGACGTGGAGACAGGAGG - Intronic
937305252 2:120866983-120867005 CTCAGGGAACTGCAGGGAGCCGG + Intronic
937520877 2:122711466-122711488 CTCAGGCATATGCAAACAGCAGG + Intergenic
938082830 2:128379338-128379360 GACAGGCCCGTGCAGACAGCTGG - Intergenic
938116405 2:128605659-128605681 CTCTGGGATCAGCAGACAGCAGG - Intergenic
938301954 2:130221621-130221643 CTAAGGGATGTCCAGACAGCTGG + Intergenic
938454747 2:131452831-131452853 CTAAGGGATGTCCAGACAGCTGG - Intergenic
945566723 2:211410166-211410188 CTCATTGACATGCAGACACCAGG - Intronic
945709935 2:213283310-213283332 CTCAGGGACATGAATGCAGCTGG + Intergenic
946165530 2:217861339-217861361 CTCAGGGACTTGCAGGGAGAGGG - Intronic
946346394 2:219114460-219114482 CTCAGGGGCTTCCAGACAGAAGG + Intronic
946348745 2:219133434-219133456 CTCAGGGCCTTGTAGACAGGAGG - Intronic
946605287 2:221397930-221397952 CTAAAGGATTTGCAGACAGCTGG + Intergenic
948610160 2:239161847-239161869 CTGAGGGACGTGCTGAGAGACGG - Intronic
948766483 2:240224308-240224330 CTTTGGGATGTGCAGACAGTAGG + Intergenic
948772539 2:240258949-240258971 CTCAGGGACACACAGTCAGCCGG - Intergenic
1168824242 20:798642-798664 CAGAGGCAGGTGCAGACAGCAGG - Intergenic
1169386188 20:5151679-5151701 CTTTGGGAGGTGCAGACAGAAGG - Intronic
1170030427 20:11938452-11938474 CTCAGGGATGTCCAGATAGCTGG + Intergenic
1171234068 20:23510145-23510167 CTCCGGGACTTTCACACAGCAGG + Intergenic
1173281286 20:41630682-41630704 CTAAGGGACGCACAGATAGCTGG + Intergenic
1174467661 20:50730451-50730473 CTCTGGGACGTTCAGAGAGGAGG + Intergenic
1174557198 20:51404236-51404258 CCCAGGGACACACAGACAGCTGG + Intronic
1174733944 20:52946120-52946142 CTGAGGGATGTCCAGATAGCTGG - Intergenic
1174867002 20:54147133-54147155 CTCAGGGAAATGCAGCAAGCAGG - Intergenic
1175756643 20:61534519-61534541 ATCAGGTGCCTGCAGACAGCTGG - Intronic
1176299070 21:5090141-5090163 CTCCGGTACGTGCAGACATCTGG - Intergenic
1176424633 21:6540639-6540661 CACAGGGACGTGCGCACGGCTGG - Intergenic
1176457789 21:6928684-6928706 CCCAGGGGGGTGCAGACAACAGG - Intergenic
1176835961 21:13793768-13793790 CCCAGGGGGGTGCAGACAACAGG - Intergenic
1178781048 21:35603728-35603750 CTCAGGGCCTCGCACACAGCAGG - Intronic
1179640659 21:42745517-42745539 CACAGGGACGGCCACACAGCTGG + Intronic
1179700122 21:43148948-43148970 CACAGGGACGTGCGCACGGCTGG - Intergenic
1179779930 21:43693046-43693068 CTCAAGGCCCTGCAGAGAGCAGG - Intronic
1179824139 21:43954616-43954638 CTGTGGGCCGTGCAGACAGCTGG + Intronic
1179857955 21:44171807-44171829 CTCCGGTACGTGCAGACATCTGG + Intergenic
1180718855 22:17891910-17891932 CTCAGTGCCGTGGGGACAGCAGG - Intronic
1181422980 22:22814645-22814667 CCCAGGGCTGTGCAGACAGGAGG - Intronic
1181521253 22:23449943-23449965 CTGAGGGTCGTGCACACAGCAGG + Intergenic
1183700124 22:39446363-39446385 CTCAGGGACGGGGACAGAGCCGG - Intergenic
1183870992 22:40742100-40742122 CTAAGGGATGTCCAGATAGCTGG + Intergenic
1184087567 22:42274369-42274391 CTCAGAGACTTGCACAAAGCAGG - Intronic
1184510028 22:44927993-44928015 CTCAGACACGGGGAGACAGCGGG + Intronic
1184764530 22:46564561-46564583 CTCAGGATCCTCCAGACAGCTGG - Intergenic
1184980146 22:48090017-48090039 CTCAGGACCCTGCAGAAAGCAGG - Intergenic
949661519 3:6284225-6284247 CTCAGGGAGGGGAACACAGCTGG + Intergenic
949931042 3:9078618-9078640 CACAGGGACGTGCACTAAGCAGG + Intronic
950185715 3:10944357-10944379 CTAAGGAATGTGCAGATAGCTGG - Intergenic
951246795 3:20350417-20350439 GTAAGGGACGTCCAGATAGCTGG + Intergenic
951642099 3:24847611-24847633 CTCAGACACATCCAGACAGCTGG - Intergenic
952698332 3:36297011-36297033 CTCAAGGTCATGCAGTCAGCAGG - Intergenic
954532567 3:51333499-51333521 CTCAGGGACATGTAGTCATCTGG + Intronic
954797836 3:53170498-53170520 CTCAGGGCCCTGCAGGCAGGTGG + Intronic
956152182 3:66255220-66255242 CTCAGGGAGGTGAAGACAGGAGG - Intronic
957965264 3:87313836-87313858 CTCAGTGAGGAACAGACAGCAGG + Intergenic
958574367 3:95928651-95928673 CTCAGGGAAATGTAGACAGAAGG + Intergenic
958775965 3:98483239-98483261 CTCAGGGAAGTGGAGAAAGCTGG + Intergenic
959904778 3:111699089-111699111 CTAAGGGAGGTGAAGACAGGAGG + Intronic
961810204 3:129517756-129517778 ATCAGAGATGGGCAGACAGCTGG + Intronic
962236780 3:133713709-133713731 CTCAGGGTCCGGCAGTCAGCAGG + Intergenic
962976784 3:140452648-140452670 CTCAGGTACCTCCTGACAGCAGG - Intronic
965361905 3:167752064-167752086 CTCAGGGTCTGGCAGAAAGCAGG - Intronic
967183965 3:186930151-186930173 CTCAGGGTCTCGCAGTCAGCCGG + Intergenic
967336764 3:188352699-188352721 CTCAGTGCCGTGCATGCAGCTGG - Intronic
968229873 3:196999204-196999226 CACAGGGCTGTGCACACAGCAGG + Intronic
968268480 3:197381002-197381024 CTCATGCACCTGCAGTCAGCTGG - Intergenic
968447404 4:658617-658639 GCCAGGGCCGTGCAGACAGAGGG - Intronic
969297712 4:6279540-6279562 CTCAGAGAAGTGCACAGAGCAGG + Intronic
973002660 4:44970535-44970557 CTAAGGGATGTCCAGATAGCTGG - Intergenic
975482980 4:74902428-74902450 CTAAGGGATGTCCAGATAGCTGG - Intergenic
976767936 4:88617954-88617976 CTCAAGGAAGTGGAGGCAGCAGG + Intronic
976931248 4:90569763-90569785 CTCCTGGACCAGCAGACAGCAGG - Intronic
977821858 4:101481090-101481112 CTCAGGGAATTGCTGAGAGCAGG + Intronic
980480529 4:133381316-133381338 CTAAGGGACATACAGATAGCTGG + Intergenic
981101257 4:140831757-140831779 CTAAGGGATGTCCAGATAGCTGG + Intergenic
983166447 4:164482725-164482747 CCAAGGGATGTGCAAACAGCAGG + Intergenic
983641641 4:169948921-169948943 CTGTGGGTCATGCAGACAGCTGG - Intergenic
984405492 4:179324495-179324517 CACAGGGGCATGCAGACAGGAGG + Intergenic
985537710 5:474038-474060 CTGAGGGAGGTGCGGCCAGCAGG + Intronic
985958596 5:3282673-3282695 CAGAGGGGCCTGCAGACAGCTGG + Intergenic
986299730 5:6468360-6468382 CTCAGGCCAGTGCACACAGCAGG - Intronic
992957284 5:81922778-81922800 CTAAGGGATGCCCAGACAGCTGG + Intergenic
993076942 5:83243924-83243946 CTCAGGGACAGGCATGCAGCAGG - Intronic
994550021 5:101222467-101222489 CTAAGGGATGTTCAGATAGCTGG - Intergenic
994593552 5:101803661-101803683 TTCAGGGACGTGCATGGAGCTGG + Intergenic
994651889 5:102539486-102539508 CTAAGGGATGTCCAGATAGCTGG + Intergenic
995614405 5:113944687-113944709 CACAGGCACATGCTGACAGCTGG + Intergenic
995800494 5:115988802-115988824 CTCAGGGAGTTGGAGGCAGCAGG + Intronic
997508423 5:134436584-134436606 GACAGTGACGTGCAGGCAGCTGG + Intergenic
997804653 5:136905217-136905239 CTCAGGGAGGTGGAGGCAGGAGG - Intergenic
998112628 5:139513941-139513963 CTCAGGGTTGTGCAGACAGAAGG + Intergenic
999757498 5:154675811-154675833 CTTTGGGAGGTGAAGACAGCTGG - Intergenic
1002328041 5:178422549-178422571 CTCAGGGACGTGCAGACAGCGGG - Intronic
1004588871 6:17029706-17029728 CTAAGGGATGTCCAGAGAGCTGG + Intergenic
1004732709 6:18373777-18373799 CAGAGGGACCTGCAGAAAGCTGG + Intergenic
1004895070 6:20140377-20140399 CTCAGGGATGCTCAGATAGCTGG + Intronic
1005289053 6:24360336-24360358 CACAGGGCCTTGCACACAGCAGG - Intergenic
1005364164 6:25060713-25060735 CTCAGGGATGCCCAGATAGCTGG + Intergenic
1005835885 6:29709347-29709369 CTCAGGGGCATGCTGCCAGCAGG - Intergenic
1006066714 6:31467438-31467460 CTCAGGAACGTGCTGGCAACAGG - Intergenic
1008216388 6:48794997-48795019 CTAAGGGATGCCCAGACAGCTGG + Intergenic
1009712299 6:67340260-67340282 CTAAGGGATGTCCAGACAGCTGG + Intergenic
1012229822 6:96747690-96747712 CCCAGGGACAAGCAGCCAGCAGG + Intergenic
1013978751 6:116105203-116105225 CTGAGGGGCCTGCACACAGCTGG - Intronic
1015669426 6:135672069-135672091 CTACAGGATGTGCAGACAGCTGG + Intergenic
1016661476 6:146585972-146585994 CTAAGGGATGTCCAGATAGCTGG + Intergenic
1017536285 6:155350399-155350421 CTCAGGCACATGCAGAGACCTGG - Intergenic
1018172795 6:161155024-161155046 CTCAAGGACATGCTGGCAGCGGG - Intronic
1018244990 6:161814045-161814067 CTCAGGGCCTTGCTGACAGAAGG + Intronic
1019590084 7:1826535-1826557 CTGAGGGTCGTGCACACAGCAGG - Intronic
1019787124 7:2984129-2984151 CTAAGGGATGTCCAGATAGCTGG + Intronic
1019884233 7:3890117-3890139 CTCAGAGTCCTGCAGACAGTTGG + Intronic
1021426120 7:20501611-20501633 TTCAGGGACGTGGATGCAGCTGG - Intergenic
1024236213 7:47401068-47401090 CACAGGCGCCTGCAGACAGCTGG + Intronic
1024640041 7:51320998-51321020 CCCAGGGAAGTGGAGACTGCTGG + Intergenic
1026112632 7:67470373-67470395 CTCAGGGTCGGGGAGGCAGCGGG + Intergenic
1029970092 7:104780289-104780311 GTCAGGGACTTGCTGGCAGCGGG - Intronic
1032469354 7:132167036-132167058 CTGGGGGACAGGCAGACAGCAGG + Intronic
1033361171 7:140640239-140640261 CTCGGGGACCTGCAGAAAGCCGG - Intronic
1033422045 7:141212234-141212256 CCCCGGGACCAGCAGACAGCAGG - Intronic
1034696248 7:153056514-153056536 CTAAGGGATGTTCAGATAGCTGG - Intergenic
1034899160 7:154896821-154896843 CTCTGCCACGTGCAGACAGAGGG - Intergenic
1035050733 7:155997849-155997871 CACAGGGATGTTCAGACAGGCGG + Intergenic
1035314694 7:157990621-157990643 CTCAGGGCGGTGCTGACAGTAGG + Intronic
1035688894 8:1547149-1547171 CACAGGGACGTGCGGACCGTGGG + Intronic
1035836930 8:2764726-2764748 CTGAGGGATGTCCAGATAGCAGG + Intergenic
1036085080 8:5604766-5604788 CTAAGGGAAGTCCAGACAGCTGG + Intergenic
1039905797 8:41785661-41785683 CTCAGGGATGCGCAGCGAGCAGG - Intronic
1043485502 8:80695262-80695284 CTCTGGGAAGGGCAGACAGTTGG - Intronic
1044182478 8:89212802-89212824 CTAAGGGATGTCCAGATAGCTGG + Intergenic
1046595401 8:116255603-116255625 CTAAGGGATGTCCAGATAGCTGG + Intergenic
1047375877 8:124295587-124295609 CTCAGGGGGCTGCAGCCAGCTGG - Intergenic
1047584484 8:126254970-126254992 GTGAGGGAGGTGGAGACAGCTGG - Intergenic
1048201373 8:132377039-132377061 CTAAGGGATGCCCAGACAGCTGG + Intronic
1048290562 8:133178279-133178301 CTCAGGGGCGTACACACAGAAGG + Intergenic
1049156701 8:141071626-141071648 CCCAGGGCCTTGCACACAGCAGG - Intergenic
1051959699 9:22743629-22743651 TTCAGGGACATGGATACAGCTGG + Intergenic
1054877115 9:70108415-70108437 CTAAGGAACCTTCAGACAGCTGG + Exonic
1055208448 9:73761830-73761852 CTCAGGCACGGGCAGACACAGGG + Intergenic
1060210935 9:121709951-121709973 CTCAGTGAAGTGTAGAGAGCAGG - Intronic
1060228705 9:121811798-121811820 CTCAGTGAGGTTCACACAGCAGG - Intergenic
1061971388 9:134047324-134047346 CCCAGGGACGTGCAGGCAGTTGG - Intronic
1061976413 9:134070149-134070171 CCCAGGTACATGCACACAGCAGG + Intergenic
1062116782 9:134813875-134813897 CCCAGGGGCAGGCAGACAGCAGG + Intronic
1062268132 9:135696677-135696699 CCCAGGGACGTGCAGCTCGCGGG + Exonic
1185534331 X:848669-848691 CTCAGGGACAGGGAGGCAGCTGG - Intergenic
1187669882 X:21657450-21657472 CTCAGTGACCTGCAGGTAGCTGG + Exonic
1189566429 X:42246312-42246334 TTCAGGGACGAGAAAACAGCAGG - Intergenic
1190132968 X:47768317-47768339 CTCAGGCACATGCAGAGACCTGG + Intergenic
1194867342 X:99085625-99085647 CTCAGGCATGTGCAGAGACCTGG + Intergenic
1194902962 X:99537665-99537687 CTCAGGGAGATGCAGAGAGTTGG - Intergenic
1195675469 X:107504203-107504225 CCCAGGGACTTGCTGACTGCAGG + Intergenic
1197146276 X:123175957-123175979 CTCAGGGTTGGGCAGAAAGCTGG - Intergenic
1198121441 X:133596348-133596370 GTAAGGGAATTGCAGACAGCGGG + Intronic