ID: 1002328909

View in Genome Browser
Species Human (GRCh38)
Location 5:178428435-178428457
Sequence TCCGAGCAGCAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002328909_1002328911 -7 Left 1002328909 5:178428435-178428457 CCTTCCTCATTCTGCTGCTCGGA 0: 1
1: 1
2: 0
3: 34
4: 249
Right 1002328911 5:178428451-178428473 GCTCGGAACTCCTTGTGACAAGG 0: 1
1: 0
2: 0
3: 6
4: 53
1002328909_1002328913 10 Left 1002328909 5:178428435-178428457 CCTTCCTCATTCTGCTGCTCGGA 0: 1
1: 1
2: 0
3: 34
4: 249
Right 1002328913 5:178428468-178428490 ACAAGGACTGAGTGAGTGTCCGG 0: 1
1: 0
2: 1
3: 15
4: 171
1002328909_1002328915 27 Left 1002328909 5:178428435-178428457 CCTTCCTCATTCTGCTGCTCGGA 0: 1
1: 1
2: 0
3: 34
4: 249
Right 1002328915 5:178428485-178428507 GTCCGGAGTGACTGCCAGCTGGG No data
1002328909_1002328914 26 Left 1002328909 5:178428435-178428457 CCTTCCTCATTCTGCTGCTCGGA 0: 1
1: 1
2: 0
3: 34
4: 249
Right 1002328914 5:178428484-178428506 TGTCCGGAGTGACTGCCAGCTGG 0: 1
1: 0
2: 2
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002328909 Original CRISPR TCCGAGCAGCAGAATGAGGA AGG (reversed) Intronic
900819941 1:4878963-4878985 TCCCAGCAGCTGATGGAGGATGG + Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900923959 1:5691602-5691624 TCTGAGCAGGAGGAAGAGGAGGG - Intergenic
901176477 1:7303054-7303076 TCCCAGCAGCACCAAGAGGAAGG - Intronic
901492305 1:9602751-9602773 ACCGTGCAGCAGAGTGAGGCTGG + Intronic
902173497 1:14631705-14631727 TCCCAGCAGCTGAAGGATGAAGG - Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
902840367 1:19070395-19070417 TCCCAGCAGCACCAAGAGGATGG - Intergenic
903312685 1:22472093-22472115 TCCGTGGAGCACAATGGGGAGGG + Intronic
903569079 1:24291139-24291161 TCTGAGCAACAGGATGAGCAGGG - Intergenic
903860175 1:26360239-26360261 TCCGAGGAGAACAATGAGGTTGG - Intergenic
905642005 1:39596539-39596561 CCTGAGCAGAAGATTGAGGAAGG + Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906612792 1:47214827-47214849 TGAGAGGAGCAGTATGAGGAAGG - Intergenic
908774521 1:67627308-67627330 TCTCAGCAGGAGAAGGAGGATGG + Intergenic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
916464494 1:165060634-165060656 ACCCAGCAGCTGACTGAGGAGGG + Intergenic
918191663 1:182181431-182181453 GCTGAGCAGCAGAGTGAGCATGG - Intergenic
918236669 1:182586918-182586940 ACAGAGCAGCAGTATGAAGAAGG + Exonic
918542584 1:185648545-185648567 GCCAATCAGCAGAATGTGGATGG - Intergenic
918703741 1:187636759-187636781 TCTGAACAGCAGAAAGAGGGTGG + Intergenic
920674637 1:208030549-208030571 TCAAAGCTGCAGACTGAGGAAGG + Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921592274 1:217018522-217018544 GCTGAGCAGCAAAATGAGGCTGG - Intronic
923295877 1:232594548-232594570 TCCCAGAAGGAGAGTGAGGATGG - Intergenic
924036239 1:239941259-239941281 TCCGTACAGCAGCATGAGAATGG + Intergenic
924092870 1:240520331-240520353 TCCAAGCAGCAGAATGCAGGGGG + Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
1063146197 10:3297201-3297223 TCAGAGCAGCACCATGGGGACGG - Intergenic
1063218499 10:3944841-3944863 TCCAAGCAGCAGGATAAGAAGGG + Intergenic
1065592667 10:27281135-27281157 TCCGAGTGTCAGAATGAGGCTGG + Intergenic
1065657699 10:27969149-27969171 TCCGAGTGTCAGAATGAGGCTGG - Intronic
1065932447 10:30491650-30491672 GCCAGGCAGGAGAATGAGGATGG + Intergenic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068284205 10:54913462-54913484 TCCAGGCAGAAGAATGTGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070549096 10:77476462-77476484 ACCGAGCAGCAGAGGGAAGAGGG - Intronic
1070724136 10:78776938-78776960 TCCCAGCATCAGAAAGAGGAAGG + Intergenic
1070992576 10:80745454-80745476 TCCGAACAGTGGAAAGAGGATGG + Intergenic
1073985506 10:109203770-109203792 TCCGAGCAGAAGAATCAACAGGG + Intergenic
1074815118 10:117137104-117137126 TCCGCGCGGCGGAAGGAGGAGGG + Intronic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077245252 11:1533784-1533806 TCCGAGCAGGAGAAATGGGAGGG + Intergenic
1077610142 11:3638967-3638989 TCAAAGCAGCTGAAGGAGGATGG + Intronic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1078759155 11:14237857-14237879 TAAGAGCAGCAGAAGTAGGAGGG + Intronic
1079465911 11:20730735-20730757 TGAGAGCAGCAGACTGAGGATGG + Intronic
1080612849 11:33919818-33919840 TCCCAGCAGTAGAAAGAGGAAGG - Intergenic
1081039265 11:38191010-38191032 TTTGACCAGCAGAATGTGGAAGG - Intergenic
1081041894 11:38223741-38223763 TCCGAACAGCAGAAAAAGGATGG - Intergenic
1081166814 11:39817799-39817821 TCTGAGCTCCAGAATTAGGAAGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1083935973 11:65870339-65870361 TCCGAGGAGCTGAATTAGGCAGG + Intronic
1086555430 11:88104913-88104935 TCCCAGAAGCAGCATGAGAAGGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1087736980 11:101845360-101845382 TCTGAAAAGCAGAATGAGGAAGG - Intronic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088434181 11:109792551-109792573 TACTAGTAGCAGTATGAGGAGGG + Intergenic
1089360669 11:117884239-117884261 TCTGAGCAACAGAAAGAGGCAGG + Intergenic
1089966584 11:122658546-122658568 TCCTAGCAACTCAATGAGGAAGG + Intronic
1091214585 11:133892966-133892988 TCAGAGGAGCAGTGTGAGGAGGG - Intergenic
1091328912 11:134715038-134715060 TCAGATCAGCAGAATGGAGAGGG + Intergenic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1094365218 12:29672651-29672673 TCAGAGCATGTGAATGAGGATGG - Intronic
1095644444 12:44526738-44526760 GCGGAGCAGAAGAATGGGGAGGG + Intronic
1095842533 12:46709874-46709896 TCCCAGCAGAAGAGGGAGGAGGG + Intergenic
1096010047 12:48205306-48205328 GCCAAGCAACAGAATGAGGTAGG - Intergenic
1096502873 12:52075785-52075807 ACCAAGCAACAGAATGGGGAAGG - Intronic
1096688596 12:53305669-53305691 TTTGTGCAGCAGAATGAGCATGG + Intronic
1097260396 12:57716528-57716550 TCAGAGGAGCAGGATGGGGATGG + Intronic
1097631013 12:62062422-62062444 TCACAGCTGCAGCATGAGGAAGG - Intronic
1098198262 12:68025468-68025490 TCAGGGAAGGAGAATGAGGAGGG + Intergenic
1103654850 12:122462562-122462584 TCTGAGCATCAGAATAAAGAAGG + Intergenic
1104093911 12:125538821-125538843 TCCGAGCAGCAGGGTGATGATGG - Intronic
1105749253 13:23407099-23407121 TTCGGGTGGCAGAATGAGGATGG - Intronic
1107093950 13:36514894-36514916 TCCGAGGGGCAGACTGAGGAAGG + Intergenic
1108533666 13:51349682-51349704 TCCTAAAAGCAGAATCAGGACGG - Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1112302100 13:98239894-98239916 TCCCAGCAGGTGAAGGAGGAGGG + Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113886124 13:113659131-113659153 TCCGAGCACCAGGACGTGGAGGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117602421 14:57389938-57389960 TGCGAGGAGCAGAGTAAGGAGGG + Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118468645 14:66054683-66054705 TCAGAGCAGCAGGAAGAGAAAGG - Intergenic
1119408036 14:74410948-74410970 TCAAAGCAGCTGAAGGAGGAAGG - Intronic
1121444596 14:93970477-93970499 TCCAAGCAGTAGAATGTGAAGGG - Intronic
1121662108 14:95642805-95642827 TCAGAGCAGGAGAAAGAGGCAGG - Intergenic
1121826872 14:97017363-97017385 GCTGAGCAGGAGAATGAGGTGGG - Intergenic
1122155239 14:99746727-99746749 CACCAGCAGCAGAATGGGGATGG - Intronic
1122382764 14:101321387-101321409 TTCGAACAGCAGAGAGAGGATGG + Intergenic
1122387357 14:101358227-101358249 TCTGATCAACAGAATGAGGCTGG - Intergenic
1123509132 15:20978354-20978376 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1123566354 15:21552101-21552123 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1123602618 15:21989387-21989409 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1124155887 15:27225023-27225045 TCAGAGCAACAGAATGAGGTGGG - Intronic
1130839436 15:87683995-87684017 TCCTGGCAGCAGAATGAGAATGG + Intergenic
1202974723 15_KI270727v1_random:279189-279211 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1132823557 16:1890601-1890623 TGTGAGCAGCAGAAAGCGGATGG - Intergenic
1134208524 16:12257117-12257139 TCCGAGTAGCTGAATGACTAAGG + Intronic
1136458241 16:30394663-30394685 TCCGAGGAGCAGTAAGAGGCTGG - Intronic
1136566940 16:31076337-31076359 TCGGAGCAGCTGAGTGAGGGGGG - Exonic
1136739183 16:32498512-32498534 TCCAAGCAGCTGAATGAAAAGGG - Intergenic
1138341877 16:56295378-56295400 TCCCAGCAGCACAAGGAGGTAGG - Intronic
1140119389 16:72070489-72070511 TCCGAACAGCAGAATGAGGATGG + Intronic
1140915170 16:79486956-79486978 TCTGGGCAGCAGATTTAGGATGG - Intergenic
1141861137 16:86717196-86717218 TCAAAACAGCAGGATGAGGAAGG + Intergenic
1203014030 16_KI270728v1_random:333280-333302 TCCCAGCAGCTGAATGAAAAGGG + Intergenic
1203032365 16_KI270728v1_random:606439-606461 TCCCAGCAGCTGAATGAAAAGGG + Intergenic
1144517156 17:15926589-15926611 TGTGAGCAGCAGAATGGGCAAGG + Intergenic
1147177850 17:38667681-38667703 TGCTAGCACCAGAAAGAGGATGG - Intergenic
1147655745 17:42089760-42089782 TCTCAGCAGCAGAATGTGTACGG + Intergenic
1148052758 17:44777186-44777208 TACGAGAAGCTGAATGTGGAGGG + Exonic
1148060264 17:44831062-44831084 TCTGAGCATCAGAATGCCGATGG + Intergenic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1151794064 17:76330753-76330775 TCCTACCAGCAGACTGAAGACGG + Intronic
1152481868 17:80559589-80559611 TCTGAGCAGGAGAGAGAGGATGG + Intronic
1152920300 17:83063219-83063241 CCCAAGCAGCAGCTTGAGGAGGG + Intergenic
1153485879 18:5597225-5597247 TCTGAGAAGCAGAATGACTAAGG - Intronic
1154463187 18:14617222-14617244 TCCGAATAGCAGAAAAAGGATGG + Intergenic
1155784145 18:29876534-29876556 TCTGAACAGCAGAAAGAGGATGG + Intergenic
1155958643 18:31975259-31975281 TCCAAACAGCAGAAAGAGGATGG - Intergenic
1157565537 18:48676771-48676793 GCCAAGCAGAAGAACGAGGAAGG - Intronic
1158870257 18:61679920-61679942 TACGAGCAACAGAAGGAGGATGG - Intergenic
1159704170 18:71666066-71666088 TGCCAGCAGAAGGATGAGGAGGG + Intergenic
1160506324 18:79428589-79428611 GCCCAGCAGTACAATGAGGATGG + Intronic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161922824 19:7279339-7279361 TTCTGGCAGCAGAATGAAGAAGG + Intronic
1162804120 19:13128047-13128069 TCCAAGGATCTGAATGAGGAGGG + Intronic
1163200082 19:15760611-15760633 TCAGACCAGCAGATGGAGGAGGG + Intergenic
1164801332 19:31079281-31079303 TCTTAGCAGGAGAAAGAGGAAGG + Intergenic
1164821385 19:31254064-31254086 TCCTTGCAGCAGAATTAGTATGG - Intergenic
1165363881 19:35352237-35352259 GCAGAGCAGCAGCGTGAGGAGGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
925431818 2:3801325-3801347 CCCTTGCAGAAGAATGAGGAAGG - Intronic
926903536 2:17784558-17784580 TCCCAGTTCCAGAATGAGGAAGG + Exonic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927000723 2:18791636-18791658 TCCCAGCACGACAATGAGGAAGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927863123 2:26572798-26572820 TCCGAGGAGGAGAAGGAGGGAGG + Intronic
928097685 2:28414499-28414521 TCCAAGCAGCAGAATGAGCCAGG + Exonic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
935260387 2:101350785-101350807 TCCCTGCAGCAGAATGAGAGAGG - Exonic
935277934 2:101491885-101491907 TCCAAGCAGCAAAATGTTGAAGG + Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
939732983 2:145808365-145808387 TCCTAGCAGCAGAAACAGCAGGG - Intergenic
940640529 2:156341590-156341612 TCCGGGCAGCAGAAAGGGGATGG + Intronic
942998166 2:182290697-182290719 TCTAAGCAGAAGAATGAGAAAGG - Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
947119374 2:226799661-226799683 TCCGAGGAGGAGGAGGAGGAGGG - Exonic
947399052 2:229714349-229714371 TCCGAGCAGCAGCAGCAGCAGGG + Exonic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948618187 2:239215057-239215079 TTCGAGCGGCAGAATCAAGATGG + Intronic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168824148 20:797945-797967 TCCGCACAGCAGAGAGAGGATGG + Intergenic
1169241625 20:3986276-3986298 TCCAAGCGACAGAGTGAGGAGGG - Intronic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1170624174 20:18018906-18018928 TCTGTGCAGCAGAATGGGGATGG - Intronic
1170978852 20:21192053-21192075 TCCAAGGAGCAGGATCAGGACGG + Intronic
1171193725 20:23180607-23180629 TCGGAGCAATAGACTGAGGAAGG - Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171983079 20:31640536-31640558 TCAGAGCAGGAGACTGTGGAGGG + Intronic
1172699272 20:36843021-36843043 TCCCAGTGGCAGCATGAGGAGGG - Intronic
1174703837 20:52635967-52635989 TCCAGGCAGCAGAAAGAGAAAGG - Intergenic
1176811334 21:13541148-13541170 TCCGAATAGCAGAAAAAGGATGG - Intergenic
1178166875 21:29988568-29988590 TCAGAGCAGCAGGAATAGGAGGG + Intergenic
1178701625 21:34838392-34838414 TCTTAGCAGAAAAATGAGGAAGG + Intronic
1178822859 21:35991336-35991358 ACAGAGCAGGAGAGTGAGGAGGG + Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1180211827 21:46299501-46299523 TGGGAGCAGAAGGATGAGGACGG - Intergenic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG + Intronic
1181058038 22:20268968-20268990 CCCGAGCAGAAGATTGAGAAGGG - Intronic
1181372435 22:22429037-22429059 CCAGAGCAGGAGAATGAGGCTGG - Intergenic
1182166862 22:28183480-28183502 TCAGCAAAGCAGAATGAGGAGGG - Intronic
1183145405 22:35986287-35986309 TATGAACAGCAGGATGAGGAAGG + Intronic
1183940001 22:41288668-41288690 TCCTATCAGCTGGATGAGGACGG - Intergenic
1184712762 22:46262876-46262898 TCCGAGCAGCCGCAGGCGGAAGG + Exonic
1185167888 22:49272893-49272915 CCCATGCAGCAGAAGGAGGAGGG + Intergenic
949535225 3:4989916-4989938 TCCAAGCAGGAGAAGAAGGAGGG + Intergenic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952178571 3:30894086-30894108 TCAGAGCTGCAGATTGAGAACGG - Intronic
953225261 3:41013096-41013118 TCTGATTAGCAGAATAAGGAAGG - Intergenic
953721178 3:45356542-45356564 TCCAAGCGACAGAAAGAGGAAGG + Intergenic
956974009 3:74559213-74559235 TCTCAACAGCAAAATGAGGAAGG + Intergenic
960271185 3:115676307-115676329 TCCGAGGAGAAGAAGGGGGAGGG + Exonic
964490110 3:157227258-157227280 CCTGAGCAGCTGAATGTGGAGGG + Intergenic
967834555 3:193950138-193950160 GCCTCGCAGCAGAATCAGGACGG + Intergenic
968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG + Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969349296 4:6589016-6589038 ACCGAGGAGAAGAATGAGGCTGG - Intronic
972357188 4:38291127-38291149 TCTGAGCATCAGAGTGAGGAGGG + Intergenic
972573755 4:40333418-40333440 GCCCAGCAGCAGAGTGGGGATGG - Intergenic
973598479 4:52516673-52516695 TCAGAGCAACTGAAGGAGGAAGG + Intergenic
974818851 4:67040567-67040589 TCCAAGCAGGATAATGAGTATGG + Intergenic
978311119 4:107385973-107385995 TCTGAGCAGTGGAAAGAGGACGG + Intergenic
978453161 4:108859206-108859228 TCCCATCTACAGAATGAGGATGG - Intronic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
985727064 5:1522184-1522206 TCCGAGCAGCAGAGTGCAGGAGG + Intronic
986498866 5:8376699-8376721 TCGGAACAGCATAATGAGGTGGG + Intergenic
989613580 5:43317805-43317827 TCCGCACAGCAGAGAGAGGATGG - Intergenic
991323336 5:65401447-65401469 TCCCAGCAGCAGAAGGGGAAAGG - Intronic
993828795 5:92727468-92727490 TCCAGGCAGCAGGAGGAGGAGGG - Intergenic
994178130 5:96734343-96734365 TCCGAGCTGCAGAAGGATTAAGG + Intronic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996441139 5:123492069-123492091 TCAGAGCAGCAGATGGAGGTGGG + Intergenic
996785301 5:127230661-127230683 TCCCAGCAGCACAGTGAGGCAGG + Intergenic
998656389 5:144185162-144185184 GCTGAGCAGTAGAGTGAGGATGG + Intronic
999142139 5:149369481-149369503 TCCCAGCAGAAGAAAGAAGAAGG + Exonic
1000578502 5:163006798-163006820 ACAGACCAGAAGAATGAGGATGG + Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001398603 5:171433556-171433578 CCTGAGCAGCAGGATGTGGAAGG + Intronic
1001667708 5:173447010-173447032 TCCGAGCAGCTGAACGTGGCTGG - Intergenic
1001763895 5:174229767-174229789 TCTAAACAGCAGTATGAGGAAGG - Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1003115856 6:3283625-3283647 TCCAGGCAGCAGCAGGAGGAAGG - Intronic
1003775165 6:9352280-9352302 CCAGAGCAGGAGAAAGAGGAGGG - Intergenic
1004582131 6:16964663-16964685 TCGGAGCAGAAGAAAGAGCATGG + Intergenic
1007239784 6:40416725-40416747 CCCTAGCAGGAGAAGGAGGAAGG - Intronic
1008130473 6:47715068-47715090 TCCCAGCAGTGGAGTGAGGATGG - Exonic
1011610397 6:89145785-89145807 CCACAGCAGCAGAATGAGAACGG - Intergenic
1012957399 6:105586185-105586207 TCAGAGCAGGAGAATGAAGAGGG + Intergenic
1015993632 6:138975116-138975138 TCTGGGCAGCAGAGTTAGGAGGG - Intronic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1019035192 6:169048776-169048798 TCTGCTCAGCAGAATGAGGGAGG - Intergenic
1020933390 7:14428829-14428851 TCCTAGCATCTGAATGAGCATGG - Intronic
1022089321 7:27097213-27097235 GACGTGCAGCAGAATGAGGAAGG - Intergenic
1023053737 7:36275206-36275228 TCCAGGAAGCAGGATGAGGATGG + Intronic
1023868849 7:44252073-44252095 TCCGAGACTCAGACTGAGGAGGG + Intronic
1024302875 7:47901459-47901481 TCCTAACAGCAGAGTCAGGACGG + Intronic
1025550769 7:62245465-62245487 TCCAAGCAGCTGAATGAAAAGGG - Intergenic
1026192275 7:68140307-68140329 TCTGAGCAGCAGAGTGAGTAGGG - Intergenic
1029009910 7:97248853-97248875 TGAAAGCAGCAGTATGAGGAAGG + Intergenic
1029451389 7:100643280-100643302 TCCAAGCAGGAATATGAGGAGGG - Exonic
1030369790 7:108685930-108685952 TCTGAGCTGCTGAATGAGAAGGG + Intergenic
1032563697 7:132918348-132918370 TCCCAGCAGCCCATTGAGGAGGG - Intronic
1033097593 7:138444271-138444293 TCCGCACAGCAGAGAGAGGATGG - Intergenic
1033712015 7:143957229-143957251 GCAGAGCAGGAGAAGGAGGAAGG + Intergenic
1034129929 7:148706335-148706357 TCCAAGCAGCAGAAAGCTGAGGG - Intronic
1036686290 8:10913862-10913884 TCCCAGCAGCAGCACGAGGCAGG + Intronic
1037189012 8:16099694-16099716 TCCAAACAGCAGAAAGCGGATGG + Intergenic
1037550881 8:19970256-19970278 TCTGAGCAGCAGAATGTGATAGG + Intergenic
1038136359 8:24790558-24790580 TCGGAGCTGGAGAATGGGGAGGG - Intergenic
1039059900 8:33565252-33565274 TCCGACCAGCAAAAGGAGGAAGG + Intronic
1039443893 8:37614918-37614940 TCTTAGCAGCAGAATGTGGTGGG - Intergenic
1039825477 8:41170225-41170247 TCCCAGAAGGAGAAAGAGGAAGG + Intergenic
1042767308 8:72337621-72337643 TCCCCGCAGCTGCATGAGGAGGG - Intergenic
1042948640 8:74179044-74179066 ACCAATCAGCAGGATGAGGATGG - Intergenic
1044932014 8:97260127-97260149 TCCCAGCAGGAGAAGGAGGAGGG + Intergenic
1044944435 8:97377498-97377520 TCCAAGCAGCAGAATGTAGCTGG + Intergenic
1046644595 8:116771813-116771835 TCTGAGAAGCAGAATGCAGAAGG + Exonic
1047348553 8:124051712-124051734 TCTGGGGAGCATAATGAGGAAGG + Intronic
1048268032 8:133004812-133004834 TCCCAGCACCAGCATGAGAATGG + Intronic
1048387728 8:133928202-133928224 GCCGACCAGCAGAAACAGGATGG - Intergenic
1050292081 9:4165588-4165610 TCACTGCAGCAGAATCAGGAAGG + Intronic
1050480810 9:6085262-6085284 TCCGGACAGCGGAAAGAGGATGG + Intergenic
1052741165 9:32394383-32394405 TCTGAGCATCTGAAGGAGGATGG + Intronic
1052959402 9:34281930-34281952 TCCCACCAGCAGTATGAGGATGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1058492814 9:105520060-105520082 TCCCAGCGGCAGAAAGTGGAGGG - Intronic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1059463854 9:114452951-114452973 TCCCAGCAGAAGCATCAGGATGG - Intronic
1060463850 9:123884801-123884823 ACCAAGCAGCAGAATCAGCATGG + Intronic
1062138313 9:134941535-134941557 TCAGACAAGCAGAATGAGGATGG + Intergenic
1062540548 9:137040008-137040030 TCGGATGAGGAGAATGAGGACGG - Exonic
1185856926 X:3544496-3544518 TCCGCGCAGCAGGGTGAGGATGG + Intergenic
1186927602 X:14352296-14352318 TCTGGGCAGCAGAATGGAGATGG + Intergenic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1186958551 X:14709759-14709781 TCAAAGCAGCAGAGTAAGGAGGG - Intronic
1191055164 X:56233141-56233163 TCCGGGCTGGAAAATGAGGAGGG - Exonic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1198272662 X:135068985-135069007 TCCGAGCAGGGGAATGAGGTAGG + Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic