ID: 1002334441

View in Genome Browser
Species Human (GRCh38)
Location 5:178468298-178468320
Sequence AAGCTCATTAATAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002334429_1002334441 30 Left 1002334429 5:178468245-178468267 CCGCCAGTGTCGAGCAGAGGGCC 0: 1
1: 1
2: 4
3: 17
4: 172
Right 1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG 0: 1
1: 1
2: 0
3: 10
4: 118
1002334437_1002334441 7 Left 1002334437 5:178468268-178468290 CCTGCAGGAAGATCGGGAAGGTC 0: 1
1: 0
2: 2
3: 7
4: 92
Right 1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG 0: 1
1: 1
2: 0
3: 10
4: 118
1002334434_1002334441 9 Left 1002334434 5:178468266-178468288 CCCCTGCAGGAAGATCGGGAAGG 0: 1
1: 0
2: 1
3: 22
4: 174
Right 1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG 0: 1
1: 1
2: 0
3: 10
4: 118
1002334430_1002334441 27 Left 1002334430 5:178468248-178468270 CCAGTGTCGAGCAGAGGGCCCCT 0: 1
1: 0
2: 0
3: 13
4: 95
Right 1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG 0: 1
1: 1
2: 0
3: 10
4: 118
1002334436_1002334441 8 Left 1002334436 5:178468267-178468289 CCCTGCAGGAAGATCGGGAAGGT 0: 1
1: 0
2: 1
3: 10
4: 121
Right 1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG 0: 1
1: 1
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002334441 Original CRISPR AAGCTCATTAATAGGCCAGA GGG Intronic
901696169 1:11009827-11009849 AAGATAATTATAAGGCCAGAGGG - Intergenic
903903316 1:26664930-26664952 AAGCCCATGACTAGGCTAGAGGG + Intergenic
904985748 1:34547117-34547139 AAGCTCCTTAAAAGGCTTGAAGG + Intergenic
909713101 1:78674253-78674275 ATGCTCATTAAGAGGCAAAATGG - Intergenic
910455981 1:87397705-87397727 AATCTAATTAATTGGCTAGAGGG + Intergenic
912229011 1:107770342-107770364 AAGCAAATAAATATGCCAGATGG - Intronic
917958403 1:180123815-180123837 GACCTCATTCATTGGCCAGAAGG + Intergenic
918472888 1:184893070-184893092 AAGCTCAAGAATAGTCAAGATGG - Intronic
923158790 1:231300235-231300257 AAGCTATTTAAAAGGCCAGATGG - Intergenic
923430088 1:233911642-233911664 AGGCACATTAATAGGCACGAGGG - Intronic
1063847164 10:10143200-10143222 CATCACATTAATAGGCCAAATGG - Intergenic
1064253499 10:13725077-13725099 AAGCTCATTTTAAAGCCAGAGGG - Intronic
1065618298 10:27551399-27551421 AAGCTCTTTAGTAGGTAAGAAGG + Intergenic
1067554266 10:47257148-47257170 AAGCTGCTTAATGGGCAAGAAGG - Intergenic
1069113977 10:64481066-64481088 AAACTTATTACTAGGCAAGAAGG + Intergenic
1070300192 10:75198031-75198053 AAGCTGATGAGGAGGCCAGAGGG - Intergenic
1074356624 10:112791358-112791380 ACGCTCAGCAAAAGGCCAGAGGG + Intronic
1074522990 10:114241514-114241536 ATGCTCATTAAAAAGCCAGGAGG - Intronic
1075620961 10:123927994-123928016 ACACTCATGAATAGGCCAGGAGG - Intronic
1080576781 11:33607033-33607055 ATGTTCATTAAAAGCCCAGAAGG + Intronic
1081815513 11:45937959-45937981 CAGCTCAGTAATATGGCAGAGGG + Intronic
1081818727 11:45969775-45969797 AAGCTCAATGATAGGTTAGATGG - Intronic
1082679031 11:56145549-56145571 AATTTCATTAATAGGCGTGATGG + Intergenic
1085439333 11:76543916-76543938 AACATCATGAATAGGCCAGACGG + Intronic
1085538856 11:77247157-77247179 CAGATCATTGCTAGGCCAGAAGG + Intronic
1097086661 12:56473713-56473735 AAGCTAATTAACAAGCCAAAAGG - Exonic
1097102622 12:56600263-56600285 AACCTCATGAGTTGGCCAGAGGG + Exonic
1099997464 12:89794911-89794933 CAGCTCAGTAATAGGGCAAATGG - Intergenic
1100210150 12:92391371-92391393 TACCTCATGAATAGTCCAGATGG - Intergenic
1100743574 12:97621266-97621288 AAGCACAGTAATTGGCAAGAAGG - Intergenic
1101640462 12:106582932-106582954 AATGTCATTGATAGGCCAGCCGG - Intronic
1108863870 13:54898011-54898033 ATGCTATTTAACAGGCCAGATGG + Intergenic
1109772432 13:66994401-66994423 AAACTTATTAAGAAGCCAGATGG + Intronic
1111150803 13:84251758-84251780 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1111151074 13:84254151-84254173 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1115091239 14:29579062-29579084 AAGCAGAGTACTAGGCCAGAGGG - Intronic
1116683466 14:48008112-48008134 ATGCTCATAAATTGTCCAGAAGG + Intergenic
1117618895 14:57563636-57563658 AAGCTCATTAAAAGTACAGATGG + Intergenic
1121405981 14:93719666-93719688 CAGCTGACAAATAGGCCAGAGGG - Exonic
1121418622 14:93796631-93796653 AAGCTCCTTAAGAATCCAGATGG + Intergenic
1121957223 14:98225609-98225631 AACCTAATTATCAGGCCAGAGGG - Intergenic
1125342131 15:38685629-38685651 AAGCTGATTAATAGGAGACAAGG - Intergenic
1125531793 15:40418380-40418402 AACCTCATCCAGAGGCCAGAGGG - Exonic
1129716996 15:77858288-77858310 AAGTTCAGTATTAGACCAGATGG - Intergenic
1130665962 15:85870295-85870317 AGGGTCATTAAAAGACCAGACGG + Intergenic
1134098146 16:11433181-11433203 ACTCTCAGTAAAAGGCCAGATGG - Intronic
1135528614 16:23233275-23233297 ATGCTCATTAACAGGCAAAATGG - Intergenic
1136864962 16:33740671-33740693 AAGCTCATTATTATACCACATGG - Intergenic
1140232243 16:73126864-73126886 CATCTCATTAAAAGGACAGAGGG + Exonic
1140240839 16:73198692-73198714 AACTTCCTTAATATGCCAGAGGG + Intergenic
1140650218 16:77079945-77079967 AATCTCAGTAAAAGCCCAGATGG + Intergenic
1141786015 16:86201372-86201394 AAGGTCCTTATGAGGCCAGAGGG + Intergenic
1203126460 16_KI270728v1_random:1588814-1588836 AAGCTCATTATTATACCACATGG - Intergenic
1156589285 18:38467743-38467765 AAGCTTAAAAATAGGCCATAAGG + Intergenic
928064627 2:28150994-28151016 AAGGAAATTAAGAGGCCAGAAGG + Intronic
931575057 2:63710161-63710183 AAGCCCATCACTAAGCCAGAAGG - Intronic
931908571 2:66869567-66869589 AAGTTCATTAAATGGCAAGAGGG - Intergenic
935125992 2:100223377-100223399 AAGCCCTTGAATAGGCAAGAGGG - Intergenic
937264237 2:120606063-120606085 AAGATCTTTAATAAGCAAGAAGG + Intergenic
938608327 2:132920120-132920142 AAAATCATGAAAAGGCCAGATGG - Intronic
939902834 2:147870734-147870756 AAACTCATTAAAAGGGAAGAAGG - Intronic
941031366 2:160515614-160515636 AAGATCACTAATAGTCGAGAAGG + Intergenic
941932394 2:170955124-170955146 AAGCTCAGCAGGAGGCCAGAGGG + Intronic
944563544 2:200964812-200964834 TAGCTAATTAAAAGCCCAGAAGG + Intergenic
945304018 2:208241590-208241612 AAGCTCATTTATTGGGCAGCAGG - Intronic
1168913590 20:1468805-1468827 AAGCTCTTTGTTCGGCCAGAGGG + Intronic
1172127023 20:32630533-32630555 ATGTCCATTTATAGGCCAGAGGG + Intergenic
1172634912 20:36403854-36403876 AAGCTCACTTATAGGGCTGATGG + Intronic
1173182863 20:40817784-40817806 AAGCTCATCCATAGGCCAGTTGG + Intergenic
1175169940 20:57073166-57073188 AAGCTCGAAAACAGGCCAGAAGG + Intergenic
1177538119 21:22455909-22455931 TAGCTCATTCCTAAGCCAGAGGG - Intergenic
1181953885 22:26574380-26574402 AAGCTCATGCATAAGCCAGCTGG + Intronic
1182813995 22:33142239-33142261 AAGCTCAGGAAAAGACCAGAAGG - Intergenic
949763865 3:7504232-7504254 GGGCACATTAATAGGTCAGATGG + Intronic
956015725 3:64880749-64880771 AATCTCATTCATAGGCCTGTTGG + Intergenic
959649486 3:108737794-108737816 AAGAGCATTAAGAGGCAAGATGG + Intergenic
962254322 3:133860075-133860097 AAGCTGAGGAATAGGCCAGAAGG + Intronic
963708684 3:148721104-148721126 AAGGTCATTAATTGGCTAGAGGG + Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964608731 3:158587478-158587500 AAGCTCTGTAAAGGGCCAGAAGG + Intronic
964755317 3:160086680-160086702 AAGCTATTTAAAAAGCCAGATGG - Intergenic
968281903 3:197483664-197483686 AACCTCATTATTGGACCAGAAGG - Intergenic
971464344 4:26939432-26939454 AAGATTATTAAAAGGCCAGTGGG - Intronic
972679337 4:41290295-41290317 AAACATATTAATAGACCAGACGG - Intergenic
973548644 4:52008136-52008158 AAGCTGTTTGATAGGCTAGATGG + Intronic
974955165 4:68630531-68630553 ATGCACATTAAGAGGCCAAATGG + Intronic
984350418 4:178584687-178584709 AATATGTTTAATAGGCCAGAAGG - Intergenic
986373844 5:7110017-7110039 TAGCTCATTAACAGCCCAGTGGG + Intergenic
986564639 5:9100082-9100104 ATACCCATTATTAGGCCAGATGG - Intronic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
989095017 5:37773753-37773775 AAGATCATGAACAGGCCACATGG - Intergenic
994082934 5:95728645-95728667 AAACTAATTAATATGTCAGAGGG + Intronic
997188980 5:131912683-131912705 AAGTTCATTCAGAGGCGAGAAGG - Intronic
1001393224 5:171397518-171397540 ATGCTCATTATTAGTCCACAGGG - Intronic
1001882493 5:175256726-175256748 GAGCTCATTAATAGGTAATACGG + Intergenic
1002334441 5:178468298-178468320 AAGCTCATTAATAGGCCAGAGGG + Intronic
1002334850 5:178470553-178470575 AAGCTCATTAACAGGCCAGAGGG + Intronic
1004514852 6:16313856-16313878 AATTTCATTAACAGGCCAGGTGG - Intronic
1007919673 6:45595035-45595057 AAACTCATTAATAGGCAGAAAGG + Intronic
1008079355 6:47178386-47178408 AAGCCCAGTAACAGGCCAAAAGG + Intergenic
1008338759 6:50338664-50338686 AAGCTCTGTAAAAGGCTAGATGG + Intergenic
1008613058 6:53201942-53201964 AGGCAGATTAATAGGCGAGAAGG - Intergenic
1009305168 6:62080747-62080769 AAGCTCATCAATAACCCAAAGGG - Intronic
1009657954 6:66569906-66569928 ATGCTCATTAAGAGGCAAAATGG + Intergenic
1012206549 6:96467906-96467928 AAGCTCATCAGTAAGCCAGCAGG + Intergenic
1014020633 6:116584599-116584621 AAGGTTATTAAGAGACCAGATGG - Intronic
1015886861 6:137926451-137926473 AAGCTCATTAATAGATCAGTTGG + Intergenic
1022637457 7:32150395-32150417 ATGCTCCTTCATAGGCCAGAGGG - Intronic
1027422579 7:78031844-78031866 AAGATCATGAATACCCCAGAAGG - Intronic
1031226439 7:119043473-119043495 AAGCCCAATAGTAGCCCAGAAGG - Intergenic
1031636677 7:124109353-124109375 AAACTCATTGATACACCAGATGG + Intergenic
1031921297 7:127602692-127602714 AAAAACATTAATAGGGCAGATGG - Intergenic
1032571248 7:133001162-133001184 ATTCTCATTTATATGCCAGAAGG - Intronic
1036171595 8:6491402-6491424 AAGATTATTATTAGGACAGAAGG + Intronic
1036465497 8:8993380-8993402 AAGCTCATTTAAATGCCAAAGGG + Intergenic
1040695838 8:49997262-49997284 ATGCTCTTGAATAGGCCAGAGGG - Intronic
1044647976 8:94464838-94464860 AAGCTTATAATTAGGGCAGAAGG + Intronic
1048324561 8:133429124-133429146 ACTCTCATAAATAGGCCAAAGGG + Intergenic
1048619161 8:136112886-136112908 AAGCTCATTAATAGCCATGTAGG - Intergenic
1053009301 9:34624231-34624253 AAGTTCTGTAAAAGGCCAGATGG + Intronic
1055916417 9:81405652-81405674 AAGGTCATTAAAAGGTCACAAGG + Intergenic
1185972747 X:4682697-4682719 AAGCTCATGAACTGGCCTGATGG + Intergenic
1188649255 X:32611319-32611341 AAGGGCATAAAGAGGCCAGAAGG - Intronic
1198078245 X:133214607-133214629 AAGCACATTAGGAGGCCAGAAGG + Intergenic
1198527922 X:137520970-137520992 CAGCTGATAAATATGCCAGAAGG + Intergenic
1199618641 X:149679546-149679568 AAGAGGATTAATAGGACAGATGG - Intergenic
1199624001 X:149723703-149723725 AAGAGGATTAATAGGACAGATGG + Intergenic
1201997823 Y:20114003-20114025 AAGACCATTAACATGCCAGAAGG - Intergenic
1201998086 Y:20117517-20117539 AAGATCATGAACATGCCAGAAGG - Intergenic
1202003759 Y:20193389-20193411 AAGACCATTAACATGCCAGAAGG - Intergenic