ID: 1002334522

View in Genome Browser
Species Human (GRCh38)
Location 5:178468671-178468693
Sequence TGTGCCCCAGAACACAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 197}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002334522 Original CRISPR TGTGCCCCAGAACACAGTTG AGG (reversed) Intronic
902996332 1:20228440-20228462 TGCGCTCCAGATCACACTTGTGG + Intergenic
904473297 1:30748806-30748828 TGAGCCCCAGAGCCCAGTGGAGG - Intronic
905562388 1:38937796-38937818 TGTGACCCAGTATACAGCTGAGG + Intronic
905807971 1:40890625-40890647 TGTGGCCAGGAACATAGTTGTGG + Intergenic
907334319 1:53690358-53690380 TGTGCTGCAGGACACAGCTGGGG + Intronic
908023745 1:59926480-59926502 TGTGCTGCAGAACAGAGTTAGGG + Intronic
908235559 1:62144334-62144356 CCTGCCCCAGAACACATTTTGGG - Intronic
909316379 1:74224295-74224317 GGTGCCCCTGAATACAGATGTGG + Intronic
912679775 1:111721690-111721712 TGTGTCCCTGAACACAGTTTGGG - Intronic
913251842 1:116918429-116918451 TGGTCCACAGAACACAGTTGGGG - Intronic
913529479 1:119723398-119723420 AGTGCCGCAGAACTCACTTGTGG + Exonic
914334507 1:146702164-146702186 AGTTCCCCAGACCATAGTTGAGG - Intergenic
914899283 1:151703345-151703367 TTTGCCCCAGAACCCAGTCAAGG + Exonic
916893790 1:169139927-169139949 TTTGCCACAGAAGACATTTGTGG + Intronic
916975648 1:170074650-170074672 TGTGCCCCAAAACACTGGAGCGG + Exonic
918231512 1:182537548-182537570 TGTATCCCAGAACAAAGTTCAGG - Intronic
918574559 1:186041675-186041697 AGAGCCCCAGAAGAAAGTTGGGG + Intronic
919578217 1:199337640-199337662 GGAGCCCAAGAACAAAGTTGGGG + Intergenic
919847273 1:201649882-201649904 TTGGCCCCGGAACACAGCTGAGG + Intronic
920850554 1:209625391-209625413 TGGGCCTCAGAACACAGTCCAGG - Intronic
921013176 1:211162412-211162434 TCTGCCACAGAACACTGGTGGGG + Intergenic
923059818 1:230460926-230460948 AGAGCCCAAGAACACAGTTCAGG - Intergenic
1063286677 10:4696015-4696037 TGTCACCCAGACCACAGTTAGGG + Intergenic
1064504092 10:16010527-16010549 TGTGTAACTGAACACAGTTGTGG - Intergenic
1065946819 10:30612320-30612342 TGTTCACCAGAACACAGCAGCGG + Intronic
1069636417 10:69927737-69927759 TGAGCCACAGAACACACTTAGGG + Intronic
1070569786 10:77632233-77632255 TGTGCCACAGAACACACTTGGGG + Intronic
1070820241 10:79350091-79350113 TGTGCCCCTGAGCACTGGTGTGG + Intronic
1072087778 10:92097722-92097744 TGTTCCACAGAACACACTTTGGG - Intronic
1072316984 10:94212739-94212761 TGTGCCCTGAAACACAGTTTGGG + Intronic
1073476644 10:103757941-103757963 TTTGCCGCAGGACACAGATGTGG - Intronic
1076370685 10:129951185-129951207 TGTGCACCAGAAGATAATTGGGG - Intronic
1076610636 10:131723759-131723781 TGGACCCCAGAACAGAGCTGCGG + Intergenic
1082054787 11:47805037-47805059 TGTACCGCAGAACACAGTATTGG + Intronic
1082091299 11:48091837-48091859 TGGGCCCCAGAAAACAGGTTTGG - Intronic
1084581301 11:70025105-70025127 TGTGCCTCAGAACACAGCTTTGG + Intergenic
1084930067 11:72547979-72548001 TGTTCCACAGAACACAGTTTAGG - Intergenic
1085512202 11:77094052-77094074 TGTCCCCCCCAACACTGTTGGGG + Intronic
1089231024 11:116976702-116976724 TAGGACCCAGAACGCAGTTGTGG + Intronic
1089533655 11:119148319-119148341 AGGTCCCCAGAACACACTTGGGG - Intergenic
1089548466 11:119250136-119250158 TGTGTCCCAGAACACAGCTTAGG - Intronic
1090736832 11:129617968-129617990 TGGGCCCCAGAAATCAGTAGAGG + Intergenic
1091695287 12:2624187-2624209 TGTTCTACAGAACACAGTTCTGG + Intronic
1092242089 12:6841367-6841389 GGGGCCCCAGAAAACAGCTGGGG + Intronic
1093327999 12:17803362-17803384 TGTGCCCTGGGACACAGGTGAGG + Intergenic
1095584245 12:43833509-43833531 TGAGCCACAGCACTCAGTTGAGG - Intergenic
1097845724 12:64363493-64363515 TGTGCCCCAAAACACTTTTATGG - Intronic
1100261099 12:92932963-92932985 AGGGCCCCAGAACAGAGTAGGGG - Intergenic
1101159063 12:101955301-101955323 TATGCCCCAAATCACAGTTTGGG + Intronic
1103751478 12:123166443-123166465 TGTGCCACTGAGCACAGGTGGGG + Intronic
1106107740 13:26748672-26748694 TCTGCCCAAGAACAAAGTTCTGG + Intergenic
1106288470 13:28338737-28338759 TGTGATCCAGAACATAATTGAGG - Intronic
1106363299 13:29052055-29052077 TGTGACCCCGAACACATTTGGGG - Intronic
1108438342 13:50423559-50423581 TGTTTCCCAGAACACATTTTGGG + Intronic
1111016344 13:82387065-82387087 TGTGCCCATGAACAAAGTGGGGG - Intergenic
1113283493 13:108817707-108817729 TGTCCAGCACAACACAGTTGAGG + Intronic
1113750669 13:112774566-112774588 CGTGTACCAGATCACAGTTGCGG + Intronic
1114537442 14:23432007-23432029 TGTGCATCAGAAGACAGTTGTGG - Intronic
1116950541 14:50874636-50874658 TGTGCTCCAGAAGGAAGTTGGGG + Intronic
1118592138 14:67409921-67409943 AGGGCCCCAGAACCCTGTTGTGG - Intronic
1123156208 14:106228935-106228957 TCTCCCCCAGATCGCAGTTGAGG - Intergenic
1123215378 14:106804504-106804526 TCTCCCCCAGATCTCAGTTGAGG - Intergenic
1123222558 14:106870756-106870778 AGTGCCTCAGAACACAGGTGTGG + Intergenic
1123553829 15:21406964-21406986 TGAGCCAGAGAACAAAGTTGTGG - Intergenic
1124605792 15:31169578-31169600 TGAGCCCCTGAACAGAGTGGGGG + Intergenic
1125891282 15:43268912-43268934 GGTGCCGCAGTACACAGTTCTGG - Intergenic
1126873691 15:53015530-53015552 TGTTCCACAGAACACACTTTGGG - Intergenic
1127850662 15:62909383-62909405 TGCTCCCCAGAACAGAGCTGGGG - Intergenic
1129255184 15:74330338-74330360 TGAGGCCCAGAACACGGGTGAGG + Exonic
1135060785 16:19269698-19269720 TGTGCCCCAGTACACAGTTAAGG - Intergenic
1137025255 16:35467641-35467663 TGTGGCCCAGAGAAGAGTTGGGG + Intergenic
1137588426 16:49678787-49678809 GGTGCCACAGCACACAGTTTGGG + Intronic
1139781935 16:69359145-69359167 TGTGCCACATAACAAAGTTTTGG - Intronic
1139999115 16:71009068-71009090 AGTTCCCCAGACCATAGTTGAGG + Intronic
1140454555 16:75097396-75097418 GCTCCCCCAGAACACAGCTGAGG - Intronic
1140890104 16:79277875-79277897 TGTTCCCCAGATCACACTTTAGG - Intergenic
1142262094 16:89047887-89047909 TGGGCCCCAGAGCACATTTTGGG + Intergenic
1143720112 17:8803388-8803410 TGGGCCCCAGAACATGGTTCTGG + Exonic
1144128868 17:12226554-12226576 TGAGACACAGAACACACTTGGGG + Intergenic
1144230156 17:13194313-13194335 TGTGCCCTAGGACACAGGTAAGG - Intergenic
1144921130 17:18765497-18765519 TATTCCCCACAACACAGATGAGG - Intronic
1146481068 17:33205338-33205360 TGTTCCCCAGAACATATTTTTGG - Intronic
1146485361 17:33238343-33238365 TGTGGCCCAGAGCAATGTTGAGG + Intronic
1148645353 17:49217112-49217134 TGTGCGCTAGAACACTGTGGCGG - Intronic
1150571813 17:66393478-66393500 TGTTCTCCAGCACACATTTGGGG - Intronic
1151555894 17:74846566-74846588 TGTGTCTCAGAACACAGCTGTGG - Intronic
1154950068 18:21201464-21201486 TGTATCCCAGGACACAGCTGTGG - Intergenic
1156401996 18:36747857-36747879 TTTGTCACAGAACACGGTTGAGG + Intronic
1157689269 18:49667827-49667849 TCTGACCCAGATCACAGGTGTGG - Intergenic
1158385668 18:56988233-56988255 TATGCCTCACAACACACTTGGGG - Intronic
1158466000 18:57690328-57690350 TGAGCACCAGATCACACTTGGGG + Intronic
1158883413 18:61803155-61803177 TGTCTAGCAGAACACAGTTGGGG - Intergenic
1159855696 18:73585135-73585157 TGTTCCTCAGTACACTGTTGTGG - Intergenic
1160608104 18:80067260-80067282 CCTGCCCCAGAACTCAGTTGGGG + Intronic
1161616443 19:5273478-5273500 TGTGGCCCAGAACTCGGTTGGGG - Exonic
1161716016 19:5876760-5876782 TGTGCCCCAGATCTCACATGTGG - Intronic
1162524865 19:11201329-11201351 TGTACCCCAGAACCAGGTTGGGG - Intronic
1162554145 19:11375892-11375914 TGGGCCCCAGAACAGAGTGGTGG + Exonic
1164923353 19:32106235-32106257 CGTGCCAAAGAAGACAGTTGTGG - Intergenic
1165912199 19:39236542-39236564 GGAGCCCCAGAACTCTGTTGGGG + Intergenic
1166661429 19:44649810-44649832 CAAGCCCCAGAACACAGCTGAGG + Exonic
1167156277 19:47741243-47741265 TGCGCCCCAGCACTGAGTTGGGG - Exonic
928211316 2:29326063-29326085 TGTAGCCAAGAACACAGTGGGGG + Intronic
928592191 2:32828354-32828376 TGTCCCCCAGGAGACACTTGGGG - Intergenic
930688964 2:54339485-54339507 TGTTCCACAGAACACAATTTTGG + Intronic
933166448 2:79082079-79082101 TGTGAGCCAGAAGACAGTGGGGG - Intergenic
934624459 2:95835241-95835263 TCAGCCCCAGAACACTGGTGAGG - Intergenic
934809019 2:97265766-97265788 TCAGCCCCAGAACACTGGTGGGG + Intergenic
934809049 2:97265869-97265891 TCAGCCCCAGAACACTGGTGGGG + Intergenic
934809201 2:97266487-97266509 TCAGCCCCAGAACACTGGTGGGG + Intergenic
934809340 2:97267018-97267040 TCAGCCCCAGAACACTGGTGGGG - Intergenic
934809604 2:97268150-97268172 TCAGCCCCAGAACACTGGTGGGG - Intergenic
934828110 2:97489934-97489956 TCAGCCCCAGAACACTGGTGGGG + Intergenic
934828304 2:97490682-97490704 TCAGCCCCAGAACACTGGTGGGG - Intergenic
934828456 2:97491300-97491322 TCAGCCCCAGAACACTGGTGGGG - Intergenic
934828486 2:97491403-97491425 TCAGCCCCAGAACACTGGTGGGG - Intergenic
936624956 2:114138809-114138831 TGTCCCTCAGAAGAAAGTTGGGG + Intergenic
937077282 2:119116556-119116578 TGTGCCCTAGAACAGTCTTGTGG - Intergenic
939085031 2:137708421-137708443 TCTGCAGCAGAACAAAGTTGTGG - Intergenic
939772803 2:146344058-146344080 TGTGCCACATATCACAGTTGGGG + Intergenic
940804807 2:158174888-158174910 TGTGCCCCATAACAGTGTTTTGG - Intronic
941241476 2:163044054-163044076 TCTGCCCCAAAACACAGAAGGGG + Intergenic
945711482 2:213302136-213302158 TGTGACCCAGAAATCTGTTGAGG - Intronic
948932093 2:241138441-241138463 TATGCCCCAGTTCACAGGTGAGG + Intronic
949000938 2:241612750-241612772 TCTGCCACAGAACGCAGCTGTGG - Intronic
949066512 2:241993969-241993991 TGTGCCGATGAGCACAGTTGGGG + Intergenic
1168850242 20:971842-971864 CCTGCCCCAGGACACAGTAGAGG - Intronic
1170194278 20:13674508-13674530 TGTTGCACAGAACACACTTGTGG - Intergenic
1170329381 20:15191477-15191499 TGTGCTGCAGCACACAGTTTTGG - Intronic
1170571490 20:17635313-17635335 TGTGCTCCAGGGCACAGTCGAGG + Intronic
1171974898 20:31588058-31588080 TGCGCCCCCGAACAAAGTCGGGG + Intergenic
1172846877 20:37934857-37934879 TCTGGCCCAGGGCACAGTTGGGG + Intronic
1173014582 20:39213534-39213556 TGTTTCACAGAACAGAGTTGAGG + Intergenic
1173288879 20:41696971-41696993 TGTGTCCAAGAACACAGGTCAGG + Intergenic
1174798707 20:53544354-53544376 TGTGCCAAAGAACACAGTTTTGG + Intergenic
1177487900 21:21782957-21782979 TGTGACCCAGTACACACTTAGGG - Intergenic
1177921542 21:27158577-27158599 TGAGGCCCAGGACACAATTGTGG + Intergenic
1178162319 21:29933352-29933374 TGCTCCCCAGAGCACACTTGAGG - Intronic
1178475200 21:32932054-32932076 TGGGCCCCAAAGCACAGCTGTGG + Intergenic
1180219270 21:46347786-46347808 TGTGTCCCAGAACACAGCTCAGG - Intronic
1181594302 22:23904420-23904442 GGTGACCCAGAACACTCTTGAGG + Intergenic
1181769299 22:25113741-25113763 TGTGGCCCAGAACAAATTAGTGG + Intronic
1183431469 22:37768471-37768493 CCTGCCCCAGAGCACAGTTTTGG + Intronic
1183490641 22:38113733-38113755 TGTGCCCCAGAGCCCAGTCTTGG - Intronic
1185103710 22:48855448-48855470 TGTGGCATAGAACAGAGTTGAGG - Intergenic
950462386 3:13133185-13133207 TGTGTCCCAGAAGACAGAAGTGG + Intergenic
952919270 3:38274148-38274170 AGTGCCTCAGTACACAGTTTGGG + Intronic
955953225 3:64262937-64262959 TGTGCCACAGAACACACTTGGGG - Intronic
956508658 3:69971220-69971242 TGTTCCAAAGAACACAGTTTGGG + Intergenic
956657405 3:71565879-71565901 TCTGCCCCAGAAGTCATTTGGGG + Intronic
956802695 3:72776224-72776246 TGTGCCACATAACAACGTTGTGG + Intronic
957158139 3:76572706-76572728 TGTGACTCAGAATAAAGTTGTGG - Intronic
961586542 3:127932461-127932483 AGTGACCCAAAACACAGTGGAGG - Intronic
964132085 3:153300849-153300871 TGTTCTGCAGAACACATTTGGGG + Intergenic
966289807 3:178342915-178342937 TGTGCACCAGAACTCATTTTTGG + Intergenic
966416622 3:179695871-179695893 GGTGCCTCAGAACACAGTTTGGG - Intronic
968861820 4:3177957-3177979 CTTGCCCCAAAACACAGTGGAGG - Intronic
974140442 4:57879898-57879920 TGTGTTCCAGAACACAGCTTAGG + Intergenic
975059938 4:69985093-69985115 TGTGCCCCAGAACAGTGTTTTGG - Intergenic
976588861 4:86829033-86829055 TGACCCCCAGAACACATTTATGG - Intronic
976777763 4:88724556-88724578 TGTGCCTCAAAACACAGGTTTGG - Intergenic
980067474 4:128205661-128205683 TGTGCCCTAGATCCCAGGTGTGG - Intronic
982729959 4:158945266-158945288 TGTCACCCAGAACACGGATGAGG - Intronic
984693572 4:182756047-182756069 TATGCCCCAAACCACAGCTGCGG - Intronic
985875843 5:2593455-2593477 TGTGTCTAAGAACACAGATGGGG + Intergenic
986148350 5:5102393-5102415 TGTGCTCCAGAACAGACCTGTGG + Intergenic
986734278 5:10656620-10656642 TGTGGCACAGAACACGGCTGGGG + Intergenic
987395633 5:17420614-17420636 TGTGACAGAGAACAGAGTTGGGG - Intergenic
993696846 5:91071445-91071467 TGTGCCCTGGAACACACTTTGGG - Intronic
994998470 5:107095988-107096010 TGTGCCTCAGAACTTTGTTGTGG - Intergenic
995188058 5:109291400-109291422 TGAGCCAGAGAACAAAGTTGGGG + Intergenic
997528295 5:134567357-134567379 TGTTTCCCAGCACACAGCTGGGG - Intronic
998878918 5:146627678-146627700 CTTGCCCCAGATCACAGTGGAGG - Intronic
1000342912 5:160291288-160291310 TGTGCCACAGAACACACATTAGG - Intronic
1002334522 5:178468671-178468693 TGTGCCCCAGAACACAGTTGAGG - Intronic
1004415652 6:15421875-15421897 GGTGCCCCTCAGCACAGTTGTGG - Intronic
1006618239 6:35343926-35343948 TGTGCTCCAGAAAATACTTGTGG + Intronic
1007095069 6:39207954-39207976 TGTATCCTTGAACACAGTTGGGG + Intronic
1008020862 6:46575742-46575764 GGGGCCCCAGAACAAAGCTGTGG + Intronic
1014212607 6:118722216-118722238 TCTGCTCCAGAATGCAGTTGTGG - Intergenic
1014893003 6:126865463-126865485 TGCACCACAGAACACAGTTTGGG - Intergenic
1016298331 6:142600518-142600540 TGGGAACCAGAGCACAGTTGTGG - Intergenic
1017488824 6:154926366-154926388 TGTTCCCCAGCTCACACTTGGGG + Intronic
1018035973 6:159881556-159881578 TGTGCCTGAGAACACAGTAGGGG - Intergenic
1021031214 7:15738875-15738897 TTTGCTCCAGAACACAGTTGTGG - Intergenic
1022377129 7:29824616-29824638 GGAGGCCCAGAACACAGTGGAGG + Intronic
1023214726 7:37849217-37849239 CGTGCCCCAGAAAACACTAGTGG + Intronic
1025159088 7:56637216-56637238 GGAGCCACAGAACACAGTTGGGG + Intergenic
1025727502 7:64081015-64081037 GGAGCCACAGAACACAGTTGGGG - Intronic
1025756635 7:64350880-64350902 GGAGCCAGAGAACACAGTTGGGG - Exonic
1028035210 7:85972810-85972832 TGTGCCACAAAGCAAAGTTGTGG - Intergenic
1028638482 7:93017071-93017093 TGTGCTCCAGTAGTCAGTTGGGG - Intergenic
1029705893 7:102275392-102275414 TGGGCCCAAGGACACAGTTGGGG + Intronic
1033015785 7:137670163-137670185 TGTTCTCCAGAACACAATTTTGG + Intronic
1035534463 8:380400-380422 TGTCCCCCAGGACCCAGGTGGGG - Intergenic
1038074557 8:24057152-24057174 TGTGCCACAGAACAGGGATGCGG - Intergenic
1040482818 8:47841907-47841929 TTTTGCCCAGCACACAGTTGTGG - Intronic
1041427379 8:57738230-57738252 GGGGCCACAGAACAAAGTTGTGG - Intergenic
1044781099 8:95744307-95744329 CATGCCCCAGAAGACAGCTGTGG - Intergenic
1045290287 8:100826983-100827005 TGTAACCCAGAACACCTTTGCGG - Intergenic
1045746193 8:105425219-105425241 TGAGCCACAGAAGAGAGTTGCGG + Intronic
1047698893 8:127430897-127430919 AGTGCCCCAGAATGCGGTTGTGG - Intergenic
1048874753 8:138827954-138827976 TGTTTCCCAGAACCCTGTTGTGG - Intronic
1050382931 9:5049999-5050021 TGTGCCCCATAACAATGTTTTGG - Intronic
1050596586 9:7210694-7210716 TCTGACCCAGAAAAAAGTTGAGG + Intergenic
1051460000 9:17301263-17301285 TGTACCCCAGATCACAATTTAGG - Intronic
1054968740 9:71060217-71060239 TCTTCCACAGAACACAGTTATGG - Intronic
1055765466 9:79658461-79658483 TATGCCCCAAAATACAGATGCGG - Intronic
1057839405 9:98473401-98473423 TGTGCCCTGGAAGACAGGTGGGG + Intronic
1059913644 9:119074846-119074868 TTTGCCTCAGAGCACAGATGAGG + Intergenic
1060909878 9:127341011-127341033 TGTTCTCCAGGACAAAGTTGTGG - Intronic
1060995206 9:127871927-127871949 TGTGCCCCAGGAGACAGTGTTGG - Exonic
1061570741 9:131476156-131476178 TTGTCCCCAGAACACAGTTTGGG - Exonic
1062411712 9:136429132-136429154 TGGGCCCCAGAGCCCAGCTGAGG - Exonic
1185686625 X:1934138-1934160 TCTGCCCATGAGCACAGTTGAGG + Intergenic
1188493165 X:30756774-30756796 GGTGCCAGAGAACAAAGTTGGGG + Intergenic
1189492901 X:41483474-41483496 TGTACCCCAGACCACAGTGGGGG - Intergenic
1189960502 X:46320123-46320145 TCTGACCCAGAACAAAGTTTTGG + Intergenic
1189988569 X:46574541-46574563 GGTGCGCCAGGACACAGTGGCGG - Exonic
1193836400 X:86349489-86349511 TGTGCCCTAGGACCCAGGTGAGG - Intronic
1193933395 X:87583934-87583956 TGTGACCCAGCACATAGTGGTGG + Intronic
1194685484 X:96908911-96908933 AGTGCCGCAGAACACAGATCAGG - Intronic
1194953383 X:100152977-100152999 TCAGCCACAGAACACAGGTGGGG + Intergenic
1198675534 X:139126694-139126716 TGTGCTCCAGTAGACAGGTGTGG + Intronic