ID: 1002335681

View in Genome Browser
Species Human (GRCh38)
Location 5:178476655-178476677
Sequence TGGAGTTCACAGAATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002335681_1002335691 25 Left 1002335681 5:178476655-178476677 CCAGCAGCATTCTGTGAACTCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1002335691 5:178476703-178476725 GTGCCTGTCAACAACATGGGCGG No data
1002335681_1002335689 21 Left 1002335681 5:178476655-178476677 CCAGCAGCATTCTGTGAACTCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1002335689 5:178476699-178476721 GTGTGTGCCTGTCAACAACATGG 0: 1
1: 0
2: 0
3: 10
4: 150
1002335681_1002335690 22 Left 1002335681 5:178476655-178476677 CCAGCAGCATTCTGTGAACTCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1002335690 5:178476700-178476722 TGTGTGCCTGTCAACAACATGGG 0: 1
1: 0
2: 0
3: 11
4: 153
1002335681_1002335693 27 Left 1002335681 5:178476655-178476677 CCAGCAGCATTCTGTGAACTCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1002335693 5:178476705-178476727 GCCTGTCAACAACATGGGCGGGG 0: 1
1: 0
2: 2
3: 3
4: 59
1002335681_1002335686 -1 Left 1002335681 5:178476655-178476677 CCAGCAGCATTCTGTGAACTCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1002335686 5:178476677-178476699 ACAAGGGCCCTGGATGTGCGTGG 0: 1
1: 0
2: 0
3: 11
4: 126
1002335681_1002335692 26 Left 1002335681 5:178476655-178476677 CCAGCAGCATTCTGTGAACTCCA 0: 1
1: 0
2: 1
3: 17
4: 211
Right 1002335692 5:178476704-178476726 TGCCTGTCAACAACATGGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002335681 Original CRISPR TGGAGTTCACAGAATGCTGC TGG (reversed) Intronic
903003461 1:20282821-20282843 TGGAGTGTACAGATGGCTGCTGG - Intergenic
903529882 1:24022024-24022046 TGCAGCTCACAGTCTGCTGCTGG - Intergenic
903655699 1:24947753-24947775 TGGAGTTCCCTGAATCCTTCTGG + Intronic
910260701 1:85291000-85291022 TGGAGATGACAGAAAGCTGTGGG - Intergenic
913543273 1:119842132-119842154 TTGAGTATACTGAATGCTGCTGG + Intergenic
913666186 1:121051169-121051191 TGGAATTCACAGAAAGCTTGGGG + Intergenic
913990687 1:143609034-143609056 TTGAGTATACTGAATGCTGCTGG + Intergenic
914017876 1:143838283-143838305 TGGAATTCACAGAAAGCTTGGGG + Intergenic
914381528 1:147120775-147120797 TTGAGTATACTGAATGCTGCTGG + Intergenic
914656485 1:149746814-149746836 TGGAATTCACAGAAAGCTTGGGG + Intergenic
914835599 1:151204132-151204154 TGGAGTTAACAGATTACTGCAGG - Intronic
914940712 1:152020619-152020641 TTGAGTATACTGAATGCTGCTGG - Intergenic
915579905 1:156807309-156807331 CAGAGTTCTCAGAATGCAGCTGG + Exonic
916194464 1:162210537-162210559 AGGACTTCACAGAAAGATGCTGG - Intronic
916281391 1:163055021-163055043 TGGAGTTCAGGTAATGCAGCTGG + Intergenic
918046390 1:180943906-180943928 AGGAGTTCACAAAATGATGGGGG - Intronic
918824430 1:189304396-189304418 TGGAGTTCAGACATTGCTGTGGG + Intergenic
919068511 1:192724278-192724300 TGGAGCTAACAGAATGCTTCAGG + Intergenic
922744639 1:228037249-228037271 TGGGGTTCACAGAATAGGGCAGG - Intronic
923551125 1:234964435-234964457 TGAAGTTCACAGAGGGCTTCTGG + Intergenic
924585948 1:245361489-245361511 TGGTGATCACACAATGGTGCGGG - Intronic
924830163 1:247585623-247585645 TGGAGAAAACAGAATGCTGTTGG + Intergenic
1063753550 10:8979898-8979920 AGGAGTTCACAGACTGGTGAAGG - Intergenic
1068106244 10:52620459-52620481 TGAAGTTTACTGAGTGCTGCAGG + Intergenic
1068272364 10:54745591-54745613 TGGATTCCACATAATGCTGTTGG + Intronic
1069548857 10:69348452-69348474 TGGAGTTCCCATCATGCAGCTGG + Intronic
1069943325 10:71969995-71970017 AAGAGATGACAGAATGCTGCTGG + Intronic
1070894416 10:79970313-79970335 TGGAGCTAAAAGAATGCAGCTGG - Intronic
1071687026 10:87769434-87769456 TGGAATTTACAGAATCCAGCTGG - Intronic
1072620284 10:97074980-97075002 GGGAGTACACAGAGGGCTGCTGG + Intronic
1073559748 10:104486716-104486738 TGGAGTTCACAGTCTTCTGAGGG + Intergenic
1073704555 10:105968421-105968443 TGAAGTGCTCAGAATGCGGCTGG + Intergenic
1076516525 10:131048225-131048247 TGGACTTCACACACCGCTGCAGG + Intergenic
1076607889 10:131701283-131701305 TGGACTTCCCAGAGTTCTGCAGG + Intergenic
1076718401 10:132380343-132380365 TGCAGTCCACAGTGTGCTGCTGG + Intergenic
1080407749 11:31994828-31994850 TGTAGTGGACAGGATGCTGCAGG - Intronic
1080865972 11:36195358-36195380 TGGTGTTCACAGTGTGCTTCTGG - Intronic
1082736730 11:56864264-56864286 TGGAGCTCACAGATTACTGAAGG + Intergenic
1083544613 11:63538955-63538977 AGGAGCTCACAGCATCCTGCTGG - Intronic
1084126078 11:67099900-67099922 GGGAATTCACAGAGTGCAGCAGG + Intergenic
1084951029 11:72665528-72665550 TTGAGTCCACAGAGTGCTCCTGG - Intronic
1094208110 12:27861916-27861938 GTGACTTCCCAGAATGCTGCTGG + Intergenic
1096684672 12:53280070-53280092 TTAAGTTTACAGACTGCTGCAGG + Intronic
1097119914 12:56723880-56723902 TGGGTTTCACACAATGATGCAGG + Intronic
1097257990 12:57694986-57695008 TGGAGTCCACTGAATGAGGCAGG + Intronic
1097540546 12:60936911-60936933 AGGACTTCACAGAAACCTGCCGG - Intergenic
1101507237 12:105358847-105358869 TGGAGTCCAAAGAGTGCTGGAGG - Intronic
1101791812 12:107934417-107934439 TGGAGTGCACAGGATGGAGCTGG - Intergenic
1103860253 12:124006748-124006770 TCGAGTGCACAGGATGCTGGGGG + Intronic
1104198961 12:126568567-126568589 TGGAGGTCAGAGAATGCAGGTGG - Intergenic
1104609119 12:130213950-130213972 AGGAGATGACAGAATCCTGCGGG - Intergenic
1105787827 13:23767185-23767207 TGGGGGTCACACAAGGCTGCAGG - Intronic
1106435891 13:29722506-29722528 TGGAGTTCACAGAGAGCCGAAGG + Intergenic
1107879793 13:44822932-44822954 CGGAGTTCACAGAAGGCTTTCGG - Intergenic
1107951093 13:45462911-45462933 TGGGGAACACAGCATGCTGCTGG + Intergenic
1109759000 13:66801468-66801490 TGAAGTTTACATATTGCTGCAGG + Intronic
1110685849 13:78373125-78373147 TGGAGTAACAAGAATGCTGCTGG - Intergenic
1113704986 13:112424367-112424389 TGAAGTCCACAGACTCCTGCAGG - Intronic
1113933199 13:113979361-113979383 TGGAGGTCTCGGACTGCTGCCGG + Exonic
1114350078 14:21840589-21840611 TGGAGATAACAGAATGCTATGGG + Intergenic
1114439137 14:22732219-22732241 TGGGGTTCTCAGATGGCTGCTGG - Intergenic
1115422936 14:33218549-33218571 TGCACTTCACATGATGCTGCAGG - Intronic
1116839700 14:49807489-49807511 TGGAGAACATAGAATACTGCTGG - Intronic
1117088978 14:52230502-52230524 TGGAATTCCCAGAATGATGGAGG - Intergenic
1118606984 14:67511712-67511734 CGGAGGTCACAGAGTGATGCTGG - Intronic
1120388082 14:83870688-83870710 TGGAATTCACAGACAGCTGCTGG - Intergenic
1121312269 14:92941587-92941609 GGGAGGCCACACAATGCTGCTGG + Exonic
1121641680 14:95488799-95488821 TGGAATTCACACATGGCTGCTGG - Intergenic
1122557782 14:102591059-102591081 TGGAGTGCCCTGGATGCTGCAGG - Intergenic
1122631302 14:103108950-103108972 TGGAGCTCACAGAAAGCCCCTGG + Intronic
1124268011 15:28254752-28254774 GGGACTTCACAGAAGGATGCTGG - Intronic
1124552696 15:30696296-30696318 TGGTGTCCAGAGAATGCTGCTGG + Intronic
1124678546 15:31709374-31709396 TGGTGTCCAGAGAATGCTGCTGG - Intronic
1125257586 15:37783338-37783360 TGGAGTTCCCAGAACCCTCCAGG - Intergenic
1126731872 15:51691788-51691810 TTGAGTTCACAGAATCCACCAGG - Intronic
1126840959 15:52717225-52717247 TGCAGTTCACAGAATGCATTTGG + Intergenic
1127255643 15:57290524-57290546 TGGTCTTCACACCATGCTGCAGG + Intronic
1129900192 15:79141901-79141923 TGGAGTTCTCAGAGAGCTGATGG - Intergenic
1129978389 15:79843743-79843765 TGGAGCTCACAGTATGGTGAAGG + Intronic
1130949764 15:88576196-88576218 TGGAGTTCTTAGAACACTGCTGG - Intergenic
1132097434 15:98998128-98998150 TGGAATTCACCAAGTGCTGCCGG + Intronic
1133105470 16:3505575-3505597 TGGAGTTTAAAGAATGCTGTGGG + Intronic
1134098232 16:11433768-11433790 TGGGGTTCACAGAGAGCTTCTGG + Intronic
1134394819 16:13853196-13853218 TGCAGTTGACAAATTGCTGCAGG + Intergenic
1134618645 16:15670960-15670982 TGGAGACCACAGAGTGCAGCTGG + Intronic
1135046126 16:19157373-19157395 TGGAGTTCAGAGAAGGCATCCGG + Intronic
1136085444 16:27881737-27881759 TGGAGTGCACAGAATTCAGGAGG - Intronic
1137979038 16:53054671-53054693 TGGGGTGCACTGAAAGCTGCTGG + Intergenic
1140374519 16:74434154-74434176 TGGAGGTTGCAGAAGGCTGCAGG - Intergenic
1142375834 16:89706739-89706761 TGAGGTGCACAGAAGGCTGCCGG - Intergenic
1143574513 17:7782979-7783001 TGGAGGTCACAGGATGATGGTGG + Intronic
1146363825 17:32202586-32202608 TGAAGTACACAGAATGCAGAAGG - Intronic
1147731391 17:42605572-42605594 TGGAGTTCACAGAATTGTTTGGG - Intronic
1149203425 17:54215052-54215074 AGGAGTTCAGAGGAAGCTGCAGG + Intergenic
1150996985 17:70329829-70329851 GGGAGCTCAGAGAATGGTGCAGG + Intergenic
1151549330 17:74812903-74812925 TGGAGTGAAGAGAAGGCTGCTGG + Intronic
1151692017 17:75692405-75692427 CAGAGTTCACAGAAAGTTGCTGG - Intronic
1152718193 17:81909891-81909913 TGGAGCCCACTGAAAGCTGCAGG + Intronic
1153524847 18:5985294-5985316 TGGAGGTAACATAATGTTGCAGG + Intronic
1158377535 18:56888105-56888127 GGGTTTTCACAGAATGCTTCAGG - Intronic
1159244534 18:65788621-65788643 TGGTGTTTTCAGAAGGCTGCAGG - Intronic
1161743387 19:6039778-6039800 TGAAGTTCAAAGAACTCTGCAGG + Intronic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1162525510 19:11204004-11204026 TGGTGTTCACTGATGGCTGCTGG + Intronic
1163943138 19:20513260-20513282 TGGATTTCACAGAAATGTGCAGG - Intergenic
1164578263 19:29418670-29418692 TTGAGCTCACACAGTGCTGCAGG - Intergenic
1164981709 19:32619343-32619365 TGGAGTCCACGGAGCGCTGCGGG + Exonic
1167985493 19:53311220-53311242 GGGATTTCACAGGCTGCTGCTGG - Intergenic
1202678263 1_KI270711v1_random:27039-27061 TTGAGTATACTGAATGCTGCTGG + Intergenic
925251874 2:2445578-2445600 TGCCTTTCACAGAGTGCTGCTGG - Intergenic
925640437 2:5981575-5981597 CGGGGATCACAGGATGCTGCCGG - Intergenic
925958163 2:8989559-8989581 TGGATTTCACAGAAGACTGAGGG + Intronic
927149232 2:20186230-20186252 TGGAGATCACAGCATCCTGCCGG - Intergenic
927445907 2:23161393-23161415 TGGAGTTCACAGAGTGGAGTGGG + Intergenic
933241082 2:79920964-79920986 TTTAGTTCACAGCATTCTGCAGG + Intronic
933816607 2:86073701-86073723 TGGAGTTGACAGCATGGTGGGGG - Intronic
935221028 2:101012989-101013011 TGGATTTCCCAGAATAGTGCTGG + Intronic
935701407 2:105815504-105815526 TGAAGTCCACAGAGTGCTCCAGG + Intronic
936045593 2:109185532-109185554 AGGATTTCACAGAATGCTGGGGG + Intronic
937471386 2:122176724-122176746 TGCAGTGCACAGCATGCAGCAGG - Intergenic
937533970 2:122863566-122863588 TGGAGCTCACTGAATGCCACTGG - Intergenic
937645554 2:124262471-124262493 TTAAGTTTACAGAATGATGCTGG - Intronic
942063333 2:172247904-172247926 TGGTGTTCCTAGAATGCAGCTGG + Intergenic
942989178 2:182178715-182178737 TGGGGTTGACTGAATACTGCAGG - Intronic
943725746 2:191249638-191249660 TGGATTCCTCAGAATGCTCCTGG + Intronic
947266092 2:228283619-228283641 TGGAGTTCACAGCATCTCGCAGG + Intergenic
948171644 2:235908164-235908186 TGTAGTTCTCTGATTGCTGCTGG + Intronic
1169178222 20:3538453-3538475 TGAAGTCCACAAAATGCTACAGG - Intronic
1169848504 20:10023091-10023113 TGGAGTTCACATACTGGTGCGGG - Intronic
1169858680 20:10129935-10129957 GTGACTTCACAGAAGGCTGCAGG - Intergenic
1171127589 20:22616939-22616961 TGGAGTTTACGGAATGCTTGTGG + Intergenic
1171213768 20:23336965-23336987 TGGGGGTCACAGAGTGCTGAGGG - Intergenic
1172186081 20:33031829-33031851 TGGAGCTCACGGGATGCTCCAGG - Intronic
1172702366 20:36861580-36861602 TGGAGCTCACAGCATGCTGCTGG - Intronic
1172834023 20:37861247-37861269 TGGAGTTCCCCAAATGCTGCTGG + Intronic
1172996383 20:39072999-39073021 TGGACTTCACAGCATGCTAGAGG + Intergenic
1173177600 20:40776440-40776462 TGGAGCTCCTAGAATGTTGCTGG - Intergenic
1173357714 20:42309845-42309867 TGGAGCTCTCAGCATGCTGTGGG + Intronic
1174344254 20:49918160-49918182 TGGAGTTCACTGACTTCTGGGGG - Intergenic
1174445223 20:50586611-50586633 TGGAGCTCACAGACGGCGGCTGG - Exonic
1176590055 21:8639698-8639720 TGGTGTTCCCAGCATGCAGCTGG + Intergenic
1177460853 21:21408151-21408173 GGGAAATCACAGAATGCTGTGGG + Intronic
1178101859 21:29278558-29278580 TGGAGCTCACACATTGCTGATGG + Intronic
1179659555 21:42865643-42865665 GGGAGGTCACAGAATGGGGCAGG + Intronic
1184308141 22:43622933-43622955 TAGATTTCACTGAATGCAGCTGG + Intronic
1184558824 22:45249144-45249166 TGGAGCTCACAGAATTTTGAGGG + Intergenic
1185135505 22:49069520-49069542 TGGACTGTACTGAATGCTGCAGG + Intergenic
949137227 3:581989-582011 TGGTGTTCCCAGCATGCAGCTGG - Intergenic
949515069 3:4800246-4800268 TGGAGGTCAAAAAATGCTGATGG + Intronic
954419929 3:50413338-50413360 TGGTTTTCAGAGAATACTGCAGG + Intronic
954448821 3:50560866-50560888 TGGAGGACAGAGGATGCTGCAGG + Intronic
957227501 3:77468854-77468876 TGGAGTTGTCAGCATGCTACAGG + Intronic
957540299 3:81560080-81560102 TGGATTTCTCAGAATGCACCAGG + Intronic
958761317 3:98311693-98311715 TTGAGTTTATAGAATGTTGCGGG - Intergenic
960175245 3:114510023-114510045 GGTATTTCACAGACTGCTGCGGG - Intronic
961471477 3:127115843-127115865 TGCTGTTGACAGAATGGTGCTGG + Intergenic
961502943 3:127350468-127350490 AGGAGTTCACAGGGTCCTGCAGG + Intergenic
964517586 3:157529666-157529688 TGGAGTGCACAGAATGGGGTGGG + Intronic
967714798 3:192750367-192750389 AGGAATTCAAAGAATGCTTCAGG + Intronic
970737696 4:19193949-19193971 TGGAGTACACAGAGTGTTACTGG - Intergenic
975992327 4:80269290-80269312 GGGAGCTCAGAGAATGCTTCTGG + Intronic
976222262 4:82766191-82766213 TGGAGTCCACAGAATGGTGGTGG - Intronic
977597581 4:98900682-98900704 TTGAGTTCACTGAATGCTGATGG - Intronic
979943280 4:126790901-126790923 TGGAATTCATAAAATGCTGCTGG - Intergenic
983069338 4:163250777-163250799 TGGAACTCAGAGAATGGTGCAGG + Intergenic
985350994 4:189061225-189061247 TGAAATTTGCAGAATGCTGCAGG + Intergenic
986404553 5:7412719-7412741 TTGAGTTCACTGTCTGCTGCAGG + Intronic
988724255 5:33909946-33909968 CGGAGCTCACAGATTACTGCAGG + Intergenic
989214012 5:38885009-38885031 TGTGGCTCACAGAATGCTTCGGG - Intronic
989331878 5:40269307-40269329 TAGAGTTCACAGAATATAGCAGG - Intergenic
989368927 5:40684681-40684703 CCCAGTTCAAAGAATGCTGCAGG - Intronic
990501736 5:56403264-56403286 TTAAGTTGATAGAATGCTGCTGG - Intergenic
991299945 5:65120484-65120506 TTGAGTTCAAAGAACTCTGCAGG + Intergenic
997702455 5:135912298-135912320 TGGAGTCCACACAATGGTGCCGG - Intergenic
997815927 5:137017020-137017042 TGGGGGCCACAGCATGCTGCAGG - Intronic
998182581 5:139955826-139955848 TGGAGTGCAGAGCATGCTCCAGG - Intronic
998825266 5:146095072-146095094 TGTAATTCTGAGAATGCTGCTGG - Intronic
1002335681 5:178476655-178476677 TGGAGTTCACAGAATGCTGCTGG - Intronic
1003108565 6:3234324-3234346 AGGAGTTCTCAGAATGGGGCAGG - Intronic
1004064847 6:12233922-12233944 AGGAGTTTACATAATGCTGTAGG + Intergenic
1005637971 6:27769137-27769159 TGTAGTTCTCAGAATACTGTAGG + Intergenic
1011401675 6:86969569-86969591 TACAATGCACAGAATGCTGCAGG - Intronic
1012601862 6:101108587-101108609 TGGTGTTCATAGAATGTTACAGG + Intergenic
1012609682 6:101201082-101201104 TTGAGTTCACAGAAGTATGCTGG + Intergenic
1014465849 6:121755866-121755888 TGAAGTTCTCAGCATGGTGCTGG + Intergenic
1015636014 6:135274989-135275011 TTGAGTTCAGTGAATGCTACTGG + Intergenic
1017525086 6:155235345-155235367 AGGAGTGCACAGAAGGCTGGGGG + Intronic
1017562679 6:155646628-155646650 CGGAATTCACAAAATGCTGACGG + Intergenic
1021856707 7:24864234-24864256 TGCTGTTCACTGAATGCTGATGG + Intronic
1022219865 7:28302911-28302933 TGCTGTTCACAGAATGATGGCGG + Intronic
1027847823 7:83406049-83406071 TGGTTTTCACAGAATGATGTAGG - Exonic
1032456929 7:132080225-132080247 AGGAGCTCACAGAAAGCTGGAGG - Intergenic
1034675228 7:152888069-152888091 TCGAGTTCACAGGTGGCTGCAGG - Intergenic
1035069460 7:156131164-156131186 TGTGGTTCAGAGAAAGCTGCAGG - Intergenic
1035464644 7:159066499-159066521 TGAATCCCACAGAATGCTGCAGG - Intronic
1038901262 8:31846659-31846681 GGGAGTGCACACAATGCTGTAGG + Intronic
1039839088 8:41280767-41280789 AGGAGACCACAGAAGGCTGCTGG + Intronic
1041253090 8:55953711-55953733 TTTAGTTCACAGACTGCGGCAGG + Intronic
1041734650 8:61096958-61096980 CAGCGTTCACAGAATCCTGCAGG - Intronic
1042959599 8:74289488-74289510 TGGTGTTCCCACAGTGCTGCTGG + Intronic
1043023219 8:75032186-75032208 TGCAGTTTACAGAATCCTCCAGG + Exonic
1044066845 8:87708709-87708731 ATTAGTTCACAGAATGTTGCGGG - Intergenic
1044602086 8:94015383-94015405 TGGAGTTAGCACAGTGCTGCAGG + Intergenic
1044890448 8:96829456-96829478 TGGAATTCACAGAATGAAGATGG + Intronic
1048220372 8:132535403-132535425 TGGAATACACATAATGGTGCAGG - Intergenic
1049131420 8:140847188-140847210 TGGAGTCCAAAATATGCTGCTGG - Intronic
1049586115 8:143433091-143433113 TGGTCCTCACAGAATTCTGCAGG + Intergenic
1050030513 9:1380782-1380804 TGGAGTTTATAGAAAACTGCGGG + Intergenic
1051227877 9:14921712-14921734 TGGAGTGGAAAGAATGTTGCTGG - Intergenic
1052013651 9:23440763-23440785 TGGAGCTTACAGTATGATGCTGG - Intergenic
1052081081 9:24206250-24206272 TGTAGTTCACAAATTGCTGGAGG - Intergenic
1053369823 9:37551410-37551432 TAGATTTCAAAGGATGCTGCAGG - Intronic
1057385776 9:94604904-94604926 TGGTGTTCCCAGCAGGCTGCAGG - Intronic
1057560811 9:96126735-96126757 TGCAGTTGAAAGAAAGCTGCGGG - Intergenic
1058271335 9:102975529-102975551 TACATTTCAAAGAATGCTGCAGG - Intergenic
1058774164 9:108267509-108267531 TGGAGGTCTCAGAATCCTGGCGG - Intergenic
1059060627 9:111032307-111032329 TGGAGGTCAGGGAATGCTCCTGG - Intronic
1059388875 9:113986385-113986407 TGCTGTTAACAGAATGCTGTGGG + Intronic
1061492867 9:130955961-130955983 TGCAGGTCACAGAGTGGTGCTGG - Intergenic
1062253132 9:135608284-135608306 TGGAGTGCACAGTGTGCTGTGGG - Intergenic
1189996915 X:46647611-46647633 TGGAGCTCACAGTCCGCTGCGGG - Intronic
1192528545 X:71868007-71868029 TGGGGCTCTCAGAATGCTGGAGG - Intergenic
1193198206 X:78658104-78658126 TGGAGTTCCCAGGCTGCTGGGGG + Exonic
1195011639 X:100737916-100737938 GGGAGTTCACAGAATGGGGTAGG + Intergenic
1195321842 X:103727236-103727258 TGGAGTTGACAGGAGGATGCAGG - Intronic
1197009566 X:121544799-121544821 AGGACTTCACAGAAGTCTGCCGG + Intergenic
1198919700 X:141711617-141711639 TGGAGTTCAGGGAATGCTGAGGG + Intergenic
1199303148 X:146236180-146236202 TGGAGTGCACAGAATGCATCTGG + Intergenic
1199737271 X:150695808-150695830 TGGAGTTCACAGAAGAATGATGG + Intronic
1201429098 Y:13887603-13887625 GGAAGTTCACAGAATGCAGGGGG + Intergenic