ID: 1002336946

View in Genome Browser
Species Human (GRCh38)
Location 5:178486204-178486226
Sequence TCGAACACTCCCACATCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002336946_1002336948 4 Left 1002336946 5:178486204-178486226 CCTGAAGATGTGGGAGTGTTCGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1002336948 5:178486231-178486253 ATTCAGGCAGCTGCAGAATGAGG 0: 1
1: 0
2: 4
3: 38
4: 293
1002336946_1002336949 8 Left 1002336946 5:178486204-178486226 CCTGAAGATGTGGGAGTGTTCGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG No data
1002336946_1002336951 19 Left 1002336946 5:178486204-178486226 CCTGAAGATGTGGGAGTGTTCGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1002336951 5:178486246-178486268 GAATGAGGACGGTTGTCAGTGGG No data
1002336946_1002336950 18 Left 1002336946 5:178486204-178486226 CCTGAAGATGTGGGAGTGTTCGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1002336950 5:178486245-178486267 AGAATGAGGACGGTTGTCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002336946 Original CRISPR TCGAACACTCCCACATCTTC AGG (reversed) Intronic
905385619 1:37601868-37601890 TCTATCACTCCCTCATCTTTGGG + Intergenic
906216727 1:44045460-44045482 TTGAACACTCCAACATTTCCAGG - Intergenic
911729648 1:101279651-101279673 GCCAACACACCCACATCTTTCGG - Intergenic
911855418 1:102869882-102869904 TCAAACTTTCACACATCTTCCGG + Intergenic
915804684 1:158833037-158833059 TAGCAAACTCTCACATCTTCTGG + Intronic
920300691 1:204986901-204986923 TCCCACCCTCCCACCTCTTCCGG + Intronic
920907647 1:210186967-210186989 TCTAACTCTCAAACATCTTCAGG + Intergenic
922922989 1:229323860-229323882 ACGTCCACTCACACATCTTCGGG + Exonic
923488742 1:234463071-234463093 TAGAACCATCCCCCATCTTCAGG - Intronic
1066752070 10:38668242-38668264 ACAAACTTTCCCACATCTTCTGG + Intergenic
1066964964 10:42254857-42254879 CCAAACTTTCCCACATCTTCTGG - Intergenic
1070372006 10:75791591-75791613 TCTCACACTCCCAGATATTCAGG + Intronic
1073964820 10:108977279-108977301 ACAAACTTTCCCACATCTTCCGG - Intergenic
1076643812 10:131937518-131937540 TCCAACACTCCCAGATCTCATGG - Intronic
1077975024 11:7238979-7239001 TCTACCACTCCCACCACTTCTGG - Intronic
1078534870 11:12164808-12164830 TCTCACACTCCCACATCCTTGGG - Intronic
1084730046 11:71067021-71067043 TTGACCACTCCTGCATCTTCTGG + Intronic
1096917808 12:55052121-55052143 TCTAACACTCCCACAGAATCAGG - Intergenic
1097917921 12:65039630-65039652 TCAAACACACCCCCATCTTGTGG + Intergenic
1098240504 12:68462553-68462575 TTGAACAGTCCCCCATCTTTGGG + Intergenic
1098722730 12:73923710-73923732 TGGAAGATTTCCACATCTTCTGG + Intergenic
1099503812 12:83447313-83447335 TGGATCCCTCCCACAACTTCTGG - Intergenic
1107432671 13:40353822-40353844 TCTATAACTCCCACATATTCAGG + Intergenic
1109337077 13:61007350-61007372 CCAAACTTTCCCACATCTTCCGG - Intergenic
1114898098 14:27018791-27018813 ACGCACACACACACATCTTCAGG - Intergenic
1118620383 14:67609536-67609558 CCCAACACACACACATCTTCAGG - Intergenic
1126973825 15:54151147-54151169 TATAAGACTCCCCCATCTTCGGG + Intronic
1128230625 15:66032354-66032376 TCAAACCCTTCCACATTTTCAGG - Intronic
1130580884 15:85135813-85135835 TCAAACTCTTCCACATCTTCAGG - Intronic
1131768025 15:95701422-95701444 CCAAACATTCCCACATTTTCTGG + Intergenic
1132774038 16:1581970-1581992 TTGAACGCCCCCACCTCTTCAGG - Intronic
1133366886 16:5217185-5217207 TCATCCACACCCACATCTTCAGG - Intergenic
1136052227 16:27660007-27660029 TCGCAAACTCCGACATCCTCAGG - Intronic
1136730652 16:32408854-32408876 CCAAACTTTCCCACATCTTCTGG - Intergenic
1140070252 16:71642890-71642912 AACAACACTCCCACATCTTACGG + Intronic
1202995745 16_KI270728v1_random:108415-108437 CCAAACTTTCCCACATCTTCTGG + Intergenic
1203022432 16_KI270728v1_random:420757-420779 CCAAACTTTCCCACATCTTCTGG + Intergenic
1143514601 17:7413524-7413546 TCTCAGACTCCCACATCCTCTGG + Intronic
1143633018 17:8149515-8149537 TAGAAGACTCCCACATCCTGGGG + Exonic
1148559914 17:48600058-48600080 TCAAACACTCCCACAGAGTCAGG - Intronic
1153365290 18:4248875-4248897 TCCATCACTCCCACTGCTTCAGG + Intronic
1155548226 18:26937456-26937478 TACTACACTCCCACCTCTTCTGG - Intronic
1155931791 18:31716270-31716292 TCAAAAAGTCCCACATCTCCAGG + Intergenic
1157576033 18:48744096-48744118 CCAAACCCTCCCACATCTTGGGG - Intronic
1160313309 18:77818264-77818286 TAGAACTCTCCTAAATCTTCTGG - Intergenic
1160443790 18:78912315-78912337 TCCAACACATCCACGTCTTCAGG + Intergenic
925669987 2:6301076-6301098 TCACTCACTCCCACATCTTTAGG + Intergenic
927400840 2:22708031-22708053 CCAAACTTTCCCACATCTTCCGG + Intergenic
928742526 2:34371821-34371843 TCAAACACAGCCACATCCTCTGG - Intergenic
935115941 2:100136307-100136329 TCCACCTCTCCCACATCTCCGGG - Intronic
939675715 2:145069699-145069721 TCCAACCCTCCCACTGCTTCTGG - Intergenic
942957250 2:181787742-181787764 TTACACACTCCCACAGCTTCTGG + Intergenic
947414089 2:229875480-229875502 TCTAACACTCCCTCATCATACGG + Intronic
948484407 2:238271365-238271387 TGGAACACGCCCACATCGTGAGG + Exonic
1171143646 20:22763874-22763896 TCGAACTGTCCCACACCTTCTGG + Intergenic
1172232743 20:33348073-33348095 TCCAACACCCCCTCATGTTCGGG - Intergenic
1179437780 21:41374141-41374163 CGGAACCCTCCCACATCCTCAGG + Intronic
1180541824 22:16456270-16456292 CCAAACTTTCCCACATCTTCTGG + Intergenic
1182228025 22:28815152-28815174 ACGCACATTCCCACATTTTCTGG - Intergenic
1184420523 22:44380315-44380337 CCGAACACTCCCGCAGCTGCAGG + Intergenic
1185034840 22:48468357-48468379 TCAAGCACTCCCATATCCTCGGG + Intergenic
953362819 3:42313793-42313815 TCACACACACACACATCTTCTGG - Intergenic
956517415 3:70064370-70064392 TTGAACACTGCACCATCTTCTGG - Intergenic
957350681 3:79019143-79019165 GCGGACACTCGCACGTCTTCTGG + Intronic
958116451 3:89225328-89225350 TCGAACACACCAAAATCTTTTGG - Intronic
962563424 3:136632667-136632689 TCAAAGACTCCCACGTATTCTGG + Intronic
964908178 3:161744178-161744200 TCGTACACTCCCACCTCTTTTGG + Intergenic
966761150 3:183420141-183420163 CCAAACTTTCCCACATCTTCCGG + Intronic
967805647 3:193712492-193712514 TCGAACACTCCCCCATCCCATGG + Intergenic
971541213 4:27819158-27819180 TCTAAAATTCCCAGATCTTCAGG + Intergenic
971894655 4:32576808-32576830 TTTAACACCCCCACATTTTCTGG + Intergenic
973580909 4:52343271-52343293 CCAAACTTTCCCACATCTTCCGG + Intergenic
973874084 4:55197644-55197666 CCCAACACTCCCACCTCTCCAGG + Intergenic
977245779 4:94629682-94629704 TCAAATATTTCCACATCTTCAGG - Intronic
977947303 4:102928477-102928499 CCAAACTTTCCCACATCTTCTGG + Intronic
982112357 4:152068413-152068435 TAGAACAGTCCCACTTCTTAGGG + Intergenic
996179228 5:120398978-120399000 CCAAACTTTCCCACATCTTCTGG - Intergenic
1002336946 5:178486204-178486226 TCGAACACTCCCACATCTTCAGG - Intronic
1006173068 6:32106507-32106529 CCCAACACGCACACATCTTCTGG + Intronic
1008473907 6:51915639-51915661 CAGTACACTCCCACATCTTGGGG + Intronic
1012922628 6:105235140-105235162 TCGAACACTCCTCCAACTTCTGG - Intergenic
1014301576 6:119688830-119688852 TCTATCATTCCCACATTTTCAGG + Intergenic
1028915139 7:96250846-96250868 TCTAAGAATCCCACCTCTTCTGG + Intronic
1035189434 7:157152847-157152869 TCCAACAGTCCTACATCTTTTGG + Intronic
1041388553 8:57329391-57329413 GTGAACACTCCAACATCTACTGG + Intergenic
1051428641 9:16960069-16960091 TGAAACACCCCCACGTCTTCAGG - Intergenic
1053565499 9:39246105-39246127 GGGAACACTCCCCCAACTTCTGG - Intronic
1053589952 9:39502547-39502569 TCTAACAATCCCACTTCTTATGG + Intergenic
1053831267 9:42083961-42083983 GGGAACACTCCCCCAACTTCTGG - Intronic
1054131649 9:61372934-61372956 GGGAACACTCCCCCAACTTCTGG + Intergenic
1054576348 9:66862744-66862766 TCTAACAATCCCACTTCTTATGG - Intronic
1054599280 9:67103477-67103499 GGGAACACTCCCCCAACTTCTGG + Intergenic
1054790459 9:69251859-69251881 AAGAAAACTCCCACATCTACTGG - Intronic
1186810101 X:13179805-13179827 TCAAATATTCCCACATCCTCAGG - Intergenic
1190145197 X:47884645-47884667 AAGGACACTCCCACATTTTCAGG - Intronic
1194506972 X:94745235-94745257 CCAAACTTTCCCACATCTTCCGG - Intergenic
1194548980 X:95273151-95273173 CCAAACTTTCCCACATCTTCTGG + Intergenic
1200718173 Y:6573942-6573964 TTGAACACGCCCATATTTTCTGG + Intergenic
1202161619 Y:21940873-21940895 TGGACCACTCCCACAGATTCAGG - Intergenic
1202229737 Y:22645500-22645522 TGGACCACTCCCACAGATTCAGG + Intergenic
1202313419 Y:23550665-23550687 TGGACCACTCCCACAGATTCAGG - Intergenic
1202557384 Y:26119930-26119952 TGGACCACTCCCACAGATTCAGG + Intergenic