ID: 1002336949

View in Genome Browser
Species Human (GRCh38)
Location 5:178486235-178486257
Sequence AGGCAGCTGCAGAATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002336943_1002336949 18 Left 1002336943 5:178486194-178486216 CCTTGAATGTCCTGAAGATGTGG 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG No data
1002336946_1002336949 8 Left 1002336946 5:178486204-178486226 CCTGAAGATGTGGGAGTGTTCGA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002336949 Original CRISPR AGGCAGCTGCAGAATGAGGA CGG Intronic
No off target data available for this crispr