ID: 1002337085

View in Genome Browser
Species Human (GRCh38)
Location 5:178487224-178487246
Sequence AGGGAAGCCCTGGCCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 637}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002337085_1002337092 -3 Left 1002337085 5:178487224-178487246 CCAGCCCAGGCCAGGGCTTCCCT 0: 1
1: 1
2: 3
3: 72
4: 637
Right 1002337092 5:178487244-178487266 CCTGGTAAATCAATCTCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
1002337085_1002337093 6 Left 1002337085 5:178487224-178487246 CCAGCCCAGGCCAGGGCTTCCCT 0: 1
1: 1
2: 3
3: 72
4: 637
Right 1002337093 5:178487253-178487275 TCAATCTCTGAAGGCAGTCATGG 0: 1
1: 0
2: 0
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002337085 Original CRISPR AGGGAAGCCCTGGCCTGGGC TGG (reversed) Intronic