ID: 1002337085

View in Genome Browser
Species Human (GRCh38)
Location 5:178487224-178487246
Sequence AGGGAAGCCCTGGCCTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 714
Summary {0: 1, 1: 1, 2: 3, 3: 72, 4: 637}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002337085_1002337092 -3 Left 1002337085 5:178487224-178487246 CCAGCCCAGGCCAGGGCTTCCCT 0: 1
1: 1
2: 3
3: 72
4: 637
Right 1002337092 5:178487244-178487266 CCTGGTAAATCAATCTCTGAAGG 0: 1
1: 0
2: 0
3: 12
4: 111
1002337085_1002337093 6 Left 1002337085 5:178487224-178487246 CCAGCCCAGGCCAGGGCTTCCCT 0: 1
1: 1
2: 3
3: 72
4: 637
Right 1002337093 5:178487253-178487275 TCAATCTCTGAAGGCAGTCATGG 0: 1
1: 0
2: 0
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002337085 Original CRISPR AGGGAAGCCCTGGCCTGGGC TGG (reversed) Intronic
900299358 1:1969277-1969299 TGGGAAGGCCTGGGCTGGGCAGG - Intronic
900299382 1:1969347-1969369 TGGGAAGGTCTGGGCTGGGCTGG - Intronic
900299402 1:1969412-1969434 AGGGATGGGCTGGGCTGGGCAGG - Intronic
900321558 1:2086881-2086903 TGAGAAGCCCTGGCCTGGCTGGG - Intronic
900361198 1:2289873-2289895 AGGGAAGGGGTGGCCTGGCCAGG + Intronic
900403747 1:2483577-2483599 ATGGGAGCCCAGGGCTGGGCAGG - Intronic
900494873 1:2971839-2971861 GGGGTAGCCCTGGCCTTGCCGGG + Intergenic
900566473 1:3334631-3334653 TAGGAAGCCCTGGGCTGGGCTGG - Intronic
900594975 1:3476543-3476565 AGGGCTGCCCGGGCCTGGGCTGG - Intronic
900620949 1:3587770-3587792 AGGAAATCCATGGCCTGCGCAGG - Intronic
901059894 1:6467185-6467207 AGGCCACCCCTGGCTTGGGCTGG - Exonic
901088793 1:6628061-6628083 AGGGAAGCCCTGGGGTGGTGAGG - Intronic
901204927 1:7489160-7489182 AGGTGGGCCCTGGCCTGGGAAGG + Intronic
901262703 1:7885609-7885631 AGGACAGCCCAGGGCTGGGCGGG + Intergenic
901633708 1:10659959-10659981 AGGGCAGCCCCGACATGGGCGGG - Exonic
902192555 1:14773805-14773827 AGAGCAGGCCTGGCCTGGGCTGG - Intronic
902236589 1:15061478-15061500 AGAGAATCCCAGGCCTGAGCAGG - Intronic
902372534 1:16015394-16015416 AGGGAGTCCCTGGCCTGCCCTGG + Exonic
902631153 1:17705502-17705524 AGGGAGGCCCTGGGGAGGGCTGG + Intergenic
902949972 1:19874701-19874723 ATGAAAGACCTGGCCTTGGCTGG + Intergenic
902955929 1:19924047-19924069 CAGGAGGCCCTGGCCTGGCCTGG + Intergenic
903129359 1:21268648-21268670 AGGGAAGCCCTCGCCTCAGCAGG + Intronic
903270684 1:22186334-22186356 AGGGAAAGCCTGCCCTGGCCTGG - Intergenic
903554277 1:24181711-24181733 AGGGAAAACCAGGCCTGGGCTGG - Intronic
903658959 1:24965465-24965487 AGGCCAGCATTGGCCTGGGCGGG + Intergenic
903745208 1:25582023-25582045 TGGGAAGCCCAGGCCTGCGCTGG - Intergenic
903887039 1:26546604-26546626 AGGGATGCCCAGGCATGGCCAGG - Intronic
904082669 1:27882072-27882094 AGCGAGGTCCTGGCCTGGGAAGG + Exonic
904305965 1:29590444-29590466 AGGGAAGGTCTGCCCAGGGCAGG - Intergenic
904466730 1:30712485-30712507 AGGGCAGCCCAGGCCCAGGCTGG + Exonic
904481370 1:30795862-30795884 AAGGAAGCCAAGGCCTGGGCAGG + Intergenic
905440828 1:37995965-37995987 AGCGAGGCCCGGCCCTGGGCAGG - Intergenic
905638321 1:39571020-39571042 AGGCAGGCCATGGCTTGGGCAGG + Intronic
906187061 1:43870415-43870437 AGGGAAGCCCAGGTCTGGGGAGG + Intronic
906212410 1:44019576-44019598 CTGGCTGCCCTGGCCTGGGCCGG + Intronic
906480274 1:46194878-46194900 AGGCTGGCCCTGCCCTGGGCTGG - Exonic
906509379 1:46402211-46402233 AGGGAGGGGCTGGCCTTGGCTGG - Intronic
906509392 1:46402247-46402269 AGGGAGGGGCTGGCCTTGGCTGG - Intronic
906521316 1:46468709-46468731 AGCTAAGCCCTGGCCTTGTCTGG + Intergenic
907249857 1:53130835-53130857 AGGGACACCCAGCCCTGGGCTGG + Intronic
907476038 1:54706282-54706304 AGATAAGCCCTGGCCTGTGGGGG + Intronic
908083430 1:60605229-60605251 AGGGCATCCCTGTCTTGGGCTGG - Intergenic
908202620 1:61813060-61813082 AGGGAAGTCCTGCCCTGATCAGG + Intronic
912011309 1:104966903-104966925 AGGGCATCCCTGTCCTGTGCTGG + Intergenic
912387926 1:109281795-109281817 AGTGAAGCCCAGTCCTCGGCGGG - Exonic
912950548 1:114117609-114117631 AGGGAAGCCCAGGGCTGGGAGGG - Intronic
913161539 1:116150247-116150269 AGGCATGACCTGGCCTGGGGTGG - Intergenic
913284012 1:117210845-117210867 AGGGAAGCCATGGCTGGGGAAGG + Exonic
913530002 1:119727035-119727057 TGGGAATTCTTGGCCTGGGCAGG + Exonic
914921397 1:151849982-151850004 AGGGAGTCCATGGCCTGGGCAGG + Intronic
915020565 1:152775230-152775252 AGGGATGCCCAGGCCAGGGAAGG + Intronic
915025515 1:152826116-152826138 AGGGATGCCCAGACCAGGGCAGG + Intergenic
915079497 1:153342060-153342082 TGGGAAACCCTGGCCTGGCCTGG - Intronic
915299184 1:154942293-154942315 GGGATAGCTCTGGCCTGGGCAGG - Intergenic
915631168 1:157154985-157155007 AGGGCTGCCCAGGCCAGGGCAGG - Intergenic
916144347 1:161726335-161726357 AGGGCAGCTCTGGCAGGGGCAGG + Intronic
918135885 1:181673667-181673689 ATGGAAGCCATGGGCTGGGCAGG + Intronic
918189916 1:182164077-182164099 AGGCAGGCCCTGGCATCGGCAGG - Intergenic
918437737 1:184533780-184533802 CAGGAGGCCCTGGCCGGGGCTGG + Intronic
919757370 1:201074427-201074449 AGGGAGGCCCTGTCCAGAGCTGG + Intronic
920509478 1:206540266-206540288 AGGGAAGGCCTGGAGTTGGCTGG + Intronic
920540187 1:206772361-206772383 CTGGGTGCCCTGGCCTGGGCTGG + Exonic
921835398 1:219772850-219772872 GGGGTAGCTCTAGCCTGGGCAGG + Intronic
921921986 1:220680270-220680292 ACAGAAGCACTGTCCTGGGCAGG - Intergenic
922488554 1:225996920-225996942 TGGGAAGCTCTGACCTGGGTTGG + Intronic
924261645 1:242237638-242237660 CTTGCAGCCCTGGCCTGGGCTGG + Intronic
1063395063 10:5678724-5678746 AGAGAAGCCCTGCTCTGGGCAGG + Intergenic
1063449951 10:6144747-6144769 GGGGAAGCCGGGGCGTGGGCCGG - Intergenic
1063458998 10:6203588-6203610 AGGGACGCGCGCGCCTGGGCAGG + Intronic
1063961585 10:11310315-11310337 AAGGAAGCTCTACCCTGGGCAGG - Intronic
1064766652 10:18682086-18682108 GGGGAATCCCTGGCCTGGGAAGG + Intergenic
1065190509 10:23203944-23203966 AGGAAAGCCCTGGCTGGTGCTGG - Exonic
1065381560 10:25096243-25096265 AGGGAAGACCTGGTCCTGGCAGG - Intergenic
1067431157 10:46246964-46246986 AGGGAACCCCTGGCTCAGGCAGG + Intergenic
1067471285 10:46540569-46540591 AGGGAAGCCCAGCCCTTTGCGGG + Intergenic
1067844759 10:49710848-49710870 AGGGAAGGGCTGGGCTGGGGTGG - Intergenic
1069630476 10:69894424-69894446 TGGGAAGACCTGGCCATGGCTGG + Intronic
1069797263 10:71061487-71061509 AGGGGAGACCTGAGCTGGGCTGG - Intergenic
1070824651 10:79384226-79384248 AGGGAAGCCCTGGCCTCCAGTGG + Exonic
1072607555 10:96997468-96997490 GGGTAAGGCCAGGCCTGGGCAGG - Intergenic
1072618398 10:97064404-97064426 AGGAAAGCCCTGAGCTGGGACGG + Intronic
1072658809 10:97349486-97349508 AGGGAAGGGCTGGGCTGGGCTGG - Intergenic
1074165464 10:110870961-110870983 GGGAAAGCGCTGGCCTGTGCGGG + Intergenic
1074277910 10:112022469-112022491 CCTGAAGCCTTGGCCTGGGCTGG - Intergenic
1074703995 10:116115481-116115503 AGGGCAGGGCTGGGCTGGGCTGG - Intronic
1074712336 10:116187868-116187890 AGCAGAGCCCTGGCCAGGGCTGG + Intronic
1075052314 10:119191910-119191932 AGGGAAGCCTTGGCCGGGTGTGG - Intergenic
1075069381 10:119310680-119310702 AGGGAAGCCCCAGGCAGGGCGGG + Intronic
1075074850 10:119343826-119343848 AGGGAAGCCATGGACAGAGCAGG + Intronic
1075085844 10:119413899-119413921 ACGGGAAGCCTGGCCTGGGCGGG - Intronic
1075686999 10:124371240-124371262 GGGGAAGCTCTGGCTTGGGCTGG - Intergenic
1076120431 10:127932726-127932748 AGAGAAGCCTGGGCCTGGCCTGG + Intronic
1076135925 10:128045737-128045759 AGGGAAGCTCTGCTGTGGGCAGG + Intronic
1076214048 10:128678712-128678734 AGGGGGGCACTGGCCTTGGCTGG - Intergenic
1076443480 10:130496141-130496163 ATGGCAGCCCTAGCCTGAGCCGG + Intergenic
1076992770 11:284399-284421 AGGTGAGGCCTGGCCTGGGAGGG + Exonic
1077046737 11:550020-550042 TGGGGAGGCCTGGGCTGGGCCGG + Intronic
1077097483 11:805158-805180 AGGTACGCGCCGGCCTGGGCGGG - Exonic
1077164020 11:1127029-1127051 GAGGGAGCCCTGGCCTGCGCTGG + Intergenic
1077218780 11:1406070-1406092 AGGGACACCCTGACCTCGGCAGG - Intronic
1077329427 11:1977426-1977448 TCGGGTGCCCTGGCCTGGGCAGG - Intronic
1077331813 11:1987272-1987294 AGGGCAGGGCTGGGCTGGGCAGG + Intergenic
1077331833 11:1987332-1987354 AGGGATGAGCTGGGCTGGGCAGG + Intergenic
1077331856 11:1987392-1987414 AGGGCAGGGCTGGGCTGGGCTGG + Intergenic
1077331877 11:1987452-1987474 AGGGATGAGCTGGGCTGGGCAGG + Intergenic
1077488326 11:2849312-2849334 AGGGCCACCCTGGCCTGGGAGGG - Intergenic
1077635903 11:3841089-3841111 TGGCAAGCCCGGGACTGGGCCGG - Intergenic
1077672276 11:4167380-4167402 AGGGTGGCCTTGGCCTTGGCAGG + Intergenic
1078110037 11:8385001-8385023 GGGGAAGGCCAGGCCTGGGCTGG - Intergenic
1078421881 11:11219346-11219368 AGGGAAGCCATGGCGTGGAGGGG - Intergenic
1078523823 11:12085617-12085639 TGGGATGCCTGGGCCTGGGCTGG + Intergenic
1079243579 11:18737714-18737736 AGGGAAGCGCTGCCCTGGTGAGG - Intronic
1080473674 11:32570419-32570441 AGTGAAGCCCTGGCCAGGCGTGG - Intergenic
1080596338 11:33777136-33777158 AGGAGAGCCCTTTCCTGGGCTGG + Intergenic
1080638786 11:34146441-34146463 AGGAGGGCCCTGGACTGGGCAGG - Exonic
1081546909 11:44078088-44078110 AGGGAAGACCCTCCCTGGGCAGG - Intronic
1081604434 11:44518556-44518578 AGCGGAGGCCTGGCCTGGCCTGG + Intergenic
1081619921 11:44613341-44613363 AGGGAGGCCCTGCCCTCAGCGGG + Intronic
1081854767 11:46296337-46296359 AGGGCTGCCCTGGCGTGTGCGGG - Intronic
1081967819 11:47180135-47180157 CAGGAAGCCGTGCCCTGGGCGGG + Intronic
1081968441 11:47183281-47183303 ACAGAGGCCCTAGCCTGGGCAGG - Intronic
1083153949 11:60811029-60811051 AAGGAAGCCGTGTCCTGGGAAGG - Intergenic
1083262481 11:61530736-61530758 TGGGAAGGCCTGGGCTGGCCAGG + Intronic
1083614249 11:64018544-64018566 TGAGAGGCCCTGCCCTGGGCTGG - Intronic
1083882573 11:65555775-65555797 AGGGCAGCCATGGGGTGGGCAGG - Intronic
1083966542 11:66047161-66047183 AGAGAAGGGCTGGCCTGGCCTGG + Intronic
1084445406 11:69200685-69200707 TGGGGAGCCCTGGCCCGTGCCGG - Intergenic
1084592726 11:70099861-70099883 TGGGACGGCGTGGCCTGGGCTGG - Intronic
1084674862 11:70628419-70628441 AGGGAAACCGAGGCCTGGGTAGG - Intronic
1084938026 11:72597537-72597559 AGGGAAGCCCTTGGCCAGGCTGG - Exonic
1084961856 11:72721067-72721089 AGGCCAGGCCAGGCCTGGGCTGG - Intronic
1085016118 11:73175055-73175077 TGAGAAGTCCTGGACTGGGCGGG - Intergenic
1085284243 11:75349855-75349877 AGGGGAGCCCTGCTCTGTGCTGG - Intronic
1085470287 11:76753207-76753229 GGAGAAGGCCTGGACTGGGCAGG + Intergenic
1088095244 11:106092235-106092257 AGGGATGCCCTGGCCTAGCTTGG + Intronic
1089001141 11:115053484-115053506 AGGGTAGGGCTGGCCAGGGCTGG - Intergenic
1089058485 11:115607068-115607090 GGGGAAATCCTGGCCTTGGCTGG - Intergenic
1089255219 11:117190471-117190493 AGGGGTGGGCTGGCCTGGGCAGG - Intronic
1089326901 11:117663623-117663645 GGGGAAGTTCTGGCCTGGCCGGG - Intronic
1089794913 11:120972577-120972599 AAGGATGCCCTGGCCAGGACAGG + Intronic
1090266773 11:125358361-125358383 AGGGAAGCGATGGGATGGGCAGG + Intronic
1090955838 11:131512398-131512420 AGGACAGCCCCTGCCTGGGCTGG - Intronic
1202812407 11_KI270721v1_random:32605-32627 TCGGGTGCCCTGGCCTGGGCAGG - Intergenic
1202814794 11_KI270721v1_random:42448-42470 AGGGCAGGGCTGGGCTGGGCAGG + Intergenic
1202814814 11_KI270721v1_random:42508-42530 AGGGATGAGCTGGGCTGGGCAGG + Intergenic
1202814837 11_KI270721v1_random:42568-42590 AGGGCAGGGCTGGGCTGGGCTGG + Intergenic
1202814858 11_KI270721v1_random:42628-42650 AGGGATGAGCTGGGCTGGGCAGG + Intergenic
1091618703 12:2069105-2069127 AGGGAAGCCATGGAATGGGCTGG + Intronic
1091717463 12:2789370-2789392 CTGGAAGCCCTGGCCAGGGGTGG - Intergenic
1092109551 12:5949242-5949264 TGGGAAGTCCTGGCTTAGGCAGG + Intronic
1092140841 12:6182461-6182483 AGGGAAGGCCAGGCCTGGGTGGG + Intergenic
1092524452 12:9301261-9301283 CGGCAGGCCCTGGCCTGGGGAGG - Intergenic
1094499984 12:31012507-31012529 TGGGAAGTGCTGGCCTGAGCAGG - Intergenic
1095820788 12:46476513-46476535 AGGTCAGCCCTGGGCTAGGCAGG + Intergenic
1095938850 12:47712690-47712712 GGGGAAGCCTTGGCATGGGGTGG - Intronic
1095989666 12:48026122-48026144 AGGGAGGTCCTGCCCCGGGCTGG + Intergenic
1096819251 12:54221041-54221063 AGGGAGGCTCTGGCCTGTACAGG - Intergenic
1097018233 12:56002277-56002299 AGGCAAGTCCTGGGATGGGCTGG - Intronic
1097187891 12:57205293-57205315 AGCCAAGCCCTGGCCTGGGGTGG + Intronic
1097225666 12:57475706-57475728 TGGAGAGCCCTTGCCTGGGCCGG - Intronic
1097722824 12:63041859-63041881 TGTGAAGCAGTGGCCTGGGCTGG + Intergenic
1098277034 12:68823034-68823056 AAGGAAGCCCTAGGCTGGGTGGG - Intronic
1100464524 12:94833541-94833563 AGGAAATCCCTGGTCTTGGCTGG - Intergenic
1101995705 12:109523596-109523618 AGGGCAGCCATGGCATTGGCAGG - Intronic
1102111783 12:110370780-110370802 CGGGAAGCCCTGCGCTGGGAGGG - Intergenic
1102301911 12:111777444-111777466 AGAGAAGCACTAGGCTGGGCTGG - Intronic
1102447944 12:113018058-113018080 AGAGAAGAACAGGCCTGGGCTGG + Intergenic
1103276212 12:119713714-119713736 AGAGAAGCCCAGGCGTTGGCTGG - Intronic
1103553489 12:121751971-121751993 AGGAAAGACCTGGCCTTGACGGG - Intronic
1103592843 12:122004450-122004472 AGGGAGGCCCCGGCCTCTGCTGG - Intergenic
1103724220 12:122989821-122989843 AGGCAAGCCCTGGCCTGGAGAGG - Exonic
1103896803 12:124278473-124278495 GGGGAGGCCCCGGGCTGGGCTGG - Intronic
1103946276 12:124528446-124528468 ATGGAAGCCCAGGAATGGGCTGG - Intronic
1104517691 12:129443066-129443088 AGGGGAGCTCTGGAGTGGGCTGG - Intronic
1104590691 12:130082230-130082252 ATGGCAGCCCTGCCCTGGGCTGG + Intergenic
1104641142 12:130468205-130468227 TGGGAAGCCCTGGCCTTTGCAGG - Intronic
1104744861 12:131204337-131204359 AGGGCAGCTCTGGGCTGGCCGGG - Intergenic
1104954356 12:132457218-132457240 AGGGAGGGCCTGGCCCGGACGGG + Intergenic
1105034375 12:132908302-132908324 AGGGAAACCCGGGCCGGGGTCGG + Intronic
1105665672 13:22553032-22553054 AGGGAATCCCTGGACCTGGCGGG + Intergenic
1105680121 13:22717575-22717597 AGGCAAACCATGGCCTGGCCTGG + Intergenic
1107124996 13:36837344-36837366 GGGCAGTCCCTGGCCTGGGCAGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107873055 13:44764625-44764647 AGGGATGCGCTGGCAGGGGCAGG - Intergenic
1113043058 13:106125351-106125373 AAGAGAGCCCTGGCCTTGGCAGG - Intergenic
1113484223 13:110642611-110642633 AGGGAAGCCCAGGGCTGGGTGGG - Intronic
1113750236 13:112771917-112771939 CCGGGAGCCCTGGGCTGGGCGGG + Intronic
1113991264 14:16029764-16029786 CGGGAAACACTGGCCCGGGCAGG - Intergenic
1114259136 14:21025076-21025098 CGGGAAGCCCGAGCCGGGGCGGG - Intronic
1119172419 14:72545259-72545281 AGTGAAACCCTGGCCCTGGCTGG + Intronic
1119310869 14:73645195-73645217 AGAGAAGCCCTGGCCGGGGGTGG + Intronic
1119519796 14:75277417-75277439 AGGGAAGACCGGGGCTGTGCGGG + Intergenic
1119646073 14:76349426-76349448 AGGGATGCACTGGTCTGGGAAGG + Intronic
1119729102 14:76939894-76939916 TGGGCAGCCAAGGCCTGGGCTGG + Intergenic
1119772272 14:77227679-77227701 AGGGGAGCCTTGTCCTGGCCTGG - Intronic
1121342647 14:93114865-93114887 AGGGAAGCGGTGGCCGGTGCGGG - Intronic
1121568039 14:94925406-94925428 TGGGAAACCCAGGCCAGGGCAGG + Intergenic
1121570219 14:94941545-94941567 TGGGAAGCCCAGGCATTGGCAGG - Intergenic
1121600073 14:95196776-95196798 AGGGACGCCCTGGCTGGGCCTGG - Intronic
1121779993 14:96616144-96616166 AGGCAAGGCCTGGCCTCTGCAGG - Intergenic
1122297169 14:100712162-100712184 GGGGAAACCGAGGCCTGGGCGGG + Intergenic
1122399249 14:101457735-101457757 AGGGAGGCGCGGGCCTGGCCTGG + Intergenic
1122420124 14:101570998-101571020 AGGGAGGCCATGGCCAGGGCTGG + Intergenic
1122632133 14:103111908-103111930 AGGGAGGGCTTGGCCTGGTCTGG + Intergenic
1122745036 14:103892449-103892471 AGGCAGGCCCTGGCCTGGAGAGG - Intergenic
1122818350 14:104326468-104326490 AGGGAGCCCCTGGCCTGTACTGG + Intergenic
1122916867 14:104863553-104863575 AGAGAAGCCCTGGGTAGGGCAGG + Intergenic
1123010832 14:105348815-105348837 AGGGCAGCTCTGCCCTGGGAAGG - Intronic
1123016357 14:105377398-105377420 TGGGGTGGCCTGGCCTGGGCAGG + Intronic
1123041111 14:105490584-105490606 AGGGAAGCGCTGCCGCGGGCGGG + Intronic
1123060270 14:105591269-105591291 TGAGCTGCCCTGGCCTGGGCTGG - Intergenic
1124640150 15:31391978-31392000 GGGGGAGCCCTCGGCTGGGCGGG + Intronic
1124955782 15:34359512-34359534 AGGAAAGCACTGGGCTGGGAGGG - Intronic
1125680764 15:41528845-41528867 AGGCAAGGCATGGCCTGAGCTGG + Intronic
1126341824 15:47649400-47649422 AGGGAAGCCCCTTCCTGTGCAGG - Intronic
1126567090 15:50112291-50112313 AGGGAGGGGCTCGCCTGGGCAGG - Intronic
1126694824 15:51317043-51317065 AGGGTAGCCCAGGACTGGGAAGG - Intronic
1127836928 15:62797634-62797656 AAGGAAGGCTTGGCCTGGCCCGG + Intronic
1128496432 15:68201032-68201054 AAGGGACCCCTGGTCTGGGCTGG - Intronic
1128526697 15:68417122-68417144 AGGGCAGGCCTGGGCTGGGTGGG - Intronic
1129051627 15:72786002-72786024 AGGAAAGGGCTGGGCTGGGCAGG + Intergenic
1129261685 15:74372100-74372122 ACATAAGCCCTGGCCCGGGCAGG - Intergenic
1129296591 15:74603436-74603458 AGTGAAGGCAGGGCCTGGGCCGG - Intronic
1129503277 15:76060033-76060055 GGGGAAGCTCTGGCCGCGGCCGG - Intronic
1129663060 15:77563990-77564012 TGGGCAGCCGTGGGCTGGGCTGG - Intergenic
1129695407 15:77738173-77738195 AGGCAAGAGCTGGCCAGGGCGGG - Intronic
1129925338 15:79358873-79358895 AGGAGAGCCGTGGCCTGGACAGG + Intronic
1131072195 15:89472899-89472921 AGGGACACCCTTGCCTGGACTGG - Intronic
1131367891 15:91854623-91854645 AGTGTGGCCCTGGCCTGAGCCGG + Intronic
1131422537 15:92319283-92319305 AGGAAAGCCCTGGGCTCGGAGGG + Intergenic
1131510414 15:93046796-93046818 CGGGCAGCCTTGGCCGGGGCTGG + Intronic
1132570994 16:643921-643943 AGAGGAGCCCTGGGCAGGGCAGG + Intronic
1132599329 16:767020-767042 AGGGAGTCCCTGGCCAGGGTGGG + Intronic
1132892505 16:2211113-2211135 AGGGCAGCCCAGGCCCGGCCAGG + Exonic
1133267119 16:4591928-4591950 AGGGAAGCTCTGGCCTGAGCTGG + Intronic
1133270595 16:4609318-4609340 ACGGCACCCCTGGGCTGGGCTGG + Exonic
1134107375 16:11494138-11494160 GGGGAGGCAGTGGCCTGGGCGGG + Intronic
1134132520 16:11659284-11659306 AGGCAGGCCCTGGCCTGTCCTGG - Intergenic
1134669119 16:16041590-16041612 AGGAAAACCCTGTCCTAGGCTGG + Intronic
1135322754 16:21507946-21507968 AGGGAAGCACGCGCCTGTGCTGG - Intergenic
1135483043 16:22838896-22838918 AGGGCAGCAATGGCCTGGACTGG - Intronic
1135587278 16:23680524-23680546 AGGGCAGCCCTTTGCTGGGCTGG + Intronic
1136280410 16:29205466-29205488 AGGGCAGGCTGGGCCTGGGCTGG - Intergenic
1136334238 16:29601109-29601131 AGGGAAGCACGCGCCTGTGCTGG - Intergenic
1136787728 16:32945712-32945734 AGTGATGCCGTGGGCTGGGCTGG + Intergenic
1136882053 16:33908077-33908099 AGTGATGCCGTGGGCTGGGCTGG - Intergenic
1137250564 16:46737735-46737757 TGGGTTGCCCTGGCCTGGGCTGG + Exonic
1137251819 16:46746869-46746891 AGGGGAGCTCTGGCCTGGTGCGG + Intronic
1137291411 16:47054528-47054550 AAGGAAGCCATGGCCAGGCCTGG + Intergenic
1137982607 16:53082660-53082682 AGGCAAGCTCTGTCCTGGGAAGG - Intronic
1138024193 16:53510135-53510157 AGGGAAGCCCCGGCCCGGGTGGG + Intergenic
1138230320 16:55331540-55331562 CTGGAAGGCCTGGCCTGGCCGGG - Intergenic
1138352458 16:56353234-56353256 AGGGTAGCCCTGGCCTGAGGGGG - Intronic
1138583417 16:57956066-57956088 AGGGAGGCCCTGGCCACAGCTGG + Intronic
1138763098 16:59567622-59567644 AGGAAGGGCATGGCCTGGGCTGG - Intergenic
1138893990 16:61180799-61180821 AAGGAAGCCCTGGACTGTGAAGG - Intergenic
1139491549 16:67288680-67288702 AGTAAAGGCCTAGCCTGGGCTGG - Intronic
1140256949 16:73345858-73345880 AGGGAAGCAGGGCCCTGGGCTGG - Intergenic
1140514623 16:75533025-75533047 AGGGAAGGGCTGGGCTGGCCAGG - Intronic
1141134895 16:81458659-81458681 AGGGAAGGACTGACCTGGGCAGG - Intronic
1141479913 16:84299681-84299703 ATGCAGCCCCTGGCCTGGGCAGG + Intronic
1141690774 16:85595019-85595041 AGGAACGTCCTGGCCTGTGCAGG - Intergenic
1141702047 16:85647037-85647059 AGGGGAGCCCTGGTCTGAGAAGG + Intronic
1141720495 16:85752730-85752752 AGGGATCCCCTGGGATGGGCAGG - Intergenic
1141762599 16:86038642-86038664 AGGGAAGCCCAGGCCAATGCGGG - Intergenic
1142034952 16:87856966-87856988 AGGGAAGCACGCGCCTGTGCTGG - Intronic
1142084778 16:88171424-88171446 AGGGCAGGCTGGGCCTGGGCTGG - Intergenic
1142211535 16:88810940-88810962 AGGGAAACCCTGCCCCGGCCTGG + Intronic
1142289333 16:89185566-89185588 TGGGGAGCCCTGCCCTGTGCCGG - Intronic
1142614079 17:1125000-1125022 AGGGAAGCCCGAGCCTGAGAGGG + Intronic
1142699234 17:1649386-1649408 AGCGCAGCCCCGGCCAGGGCAGG - Intronic
1142757037 17:2022735-2022757 AGAGAAGCCCTTCACTGGGCTGG - Intronic
1142807837 17:2380711-2380733 ATGGAGGCCCTGCCCGGGGCTGG + Exonic
1142890241 17:2938476-2938498 AGGGGATCCCTGGGCTGAGCCGG + Intronic
1144024086 17:11262276-11262298 AGGGAAGCCTTGGGGTGGGCAGG + Intronic
1144737845 17:17564833-17564855 AGGGGTGCCCTGGCCAGGGAGGG + Intronic
1144763514 17:17720814-17720836 ATGGAAACCCTGACCTGGCCAGG - Intronic
1145006888 17:19343325-19343347 GGGGAAGCTCTGGGGTGGGCTGG + Exonic
1145014570 17:19387828-19387850 AGAGGGGCCCTGGCCTGAGCTGG - Intergenic
1146057805 17:29589733-29589755 AAGGAAGCCCGGGCGCGGGCAGG + Intronic
1146305145 17:31724814-31724836 TGGGCAGCCCTGGCCTGGACAGG + Intergenic
1147211328 17:38874140-38874162 AGGGAAGCCATGGACTTTGCAGG + Intronic
1147338483 17:39740513-39740535 AGGGAGTCCCTCGCCTGGGAAGG - Intronic
1147556470 17:41482370-41482392 GGGGAAGGCCTGGCCAGGACTGG - Intergenic
1147659951 17:42112092-42112114 AGGTGAGTCCTGGGCTGGGCAGG - Exonic
1147813849 17:43193908-43193930 AAGGGACTCCTGGCCTGGGCTGG + Intronic
1147976193 17:44249529-44249551 AGACAAGCCCTGCCCTGGGGTGG - Exonic
1148324344 17:46774416-46774438 TGGGAGGCTCTGGGCTGGGCTGG - Intronic
1148331663 17:46817375-46817397 AGGAGAGCCTTGGCCTGGGCGGG - Intronic
1148489766 17:48015385-48015407 AGGGAACTCCTGGCTTGGGAAGG - Intergenic
1150575294 17:66425401-66425423 GGGGAAGGCCTGGCCTGGGTGGG - Intronic
1150656662 17:67044175-67044197 AGGGCAGCCCAGGCCAGGGGAGG - Intergenic
1151459743 17:74247497-74247519 AGAGCAGGCCTGGCCTGGGAGGG + Intronic
1151595236 17:75074421-75074443 GGGGAAGCCTGGGCCTGGGGTGG - Intergenic
1151678622 17:75612806-75612828 GTGGCTGCCCTGGCCTGGGCAGG - Intergenic
1151853785 17:76707995-76708017 AGGGCAGCACAGGCCAGGGCAGG - Intronic
1151890653 17:76948940-76948962 AAGGAAGCTCCGGCCTGGGGGGG - Exonic
1151905175 17:77043259-77043281 AGGGTAGCACTGGCATAGGCAGG - Intergenic
1151930448 17:77228654-77228676 ACTGGAGGCCTGGCCTGGGCGGG - Intergenic
1151988261 17:77557785-77557807 ATGGCAGCCCTTTCCTGGGCGGG + Intergenic
1152070687 17:78132311-78132333 AGGGAGGCCGGGGCCGGGGCTGG - Intronic
1152089717 17:78239844-78239866 AGGGAGGCCTTGGCCTGAGACGG - Exonic
1152144704 17:78561323-78561345 AGGGGAGCCCCGGCTTGGCCTGG - Intronic
1152267912 17:79306894-79306916 AGGGAACCCCTCTCCTGGTCTGG + Intronic
1152345526 17:79748461-79748483 CGGGCACCCCTGACCTGGGCGGG - Intergenic
1152546770 17:81004193-81004215 CGGGAAGGGCTGGGCTGGGCTGG - Intronic
1152635700 17:81429755-81429777 ACGAAAGCCCTGGGCTGGGGAGG - Intronic
1152686297 17:81695344-81695366 AGGGCAGGCCAGGGCTGGGCTGG - Intronic
1152759311 17:82099655-82099677 AGGGAAGACAGGGCCGGGGCTGG + Intergenic
1152828665 17:82483843-82483865 AGGGCAGCCCTGGGCCTGGCAGG - Intronic
1153666471 18:7371101-7371123 AGTAGGGCCCTGGCCTGGGCAGG + Intergenic
1153741987 18:8138725-8138747 AGGGAAGCCCTTGCAGAGGCGGG - Intronic
1154405886 18:14090662-14090684 AGGGGAGCCCCTTCCTGGGCTGG + Intronic
1154412304 18:14148090-14148112 CTGGGAGCCCTGGGCTGGGCAGG - Intergenic
1155209226 18:23586552-23586574 CGGGACTCCCTGGCCCGGGCTGG + Exonic
1156461202 18:37322314-37322336 CTGGATGCCCTGGCCTGGGTGGG - Intronic
1156480779 18:37435064-37435086 AGGGAAGCCCAGACAGGGGCTGG - Intronic
1156502985 18:37571364-37571386 AGGGGAGCCCTGGCTCTGGCAGG + Intergenic
1157392017 18:47310921-47310943 ATGGACGGCCTGGCCTGGTCTGG + Intergenic
1157606657 18:48930154-48930176 AGTGCGGCCCTGGCCTGGCCAGG - Intronic
1157706658 18:49813401-49813423 AGCGGAGGCCTGGCCTGGGGAGG + Intronic
1157814385 18:50720462-50720484 TGGGAATCCATGGCCTGGGGCGG - Intronic
1157856567 18:51110296-51110318 GGGCAAACCCTGGCCAGGGCGGG - Intergenic
1160393902 18:78558337-78558359 AGGGAGGCAAGGGCCTGGGCCGG - Intergenic
1160534352 18:79584321-79584343 AGACAAGCACTGGGCTGGGCGGG - Intergenic
1160747787 19:720017-720039 ATGGAAGCCCCTTCCTGGGCGGG + Intronic
1160806501 19:994425-994447 AGGAGAGTCCAGGCCTGGGCTGG - Exonic
1160837965 19:1133335-1133357 AGGGGAGCCCGTGGCTGGGCCGG + Intronic
1160844367 19:1159978-1160000 AGAGCAGCACTGGCGTGGGCAGG - Intronic
1160868211 19:1265501-1265523 TGGGATGGCCTGGCCGGGGCAGG + Intronic
1161019024 19:1999167-1999189 AGTCAAGCCCTGGGCTGGACCGG - Intronic
1161102446 19:2427778-2427800 AGGGAGGCCCTGACTTGGCCGGG + Exonic
1161267674 19:3372343-3372365 AGGGAGACCCTGGACAGGGCTGG - Intronic
1161380837 19:3964205-3964227 TGGGCAGCCCCGGCCTGGGGAGG - Intronic
1161660698 19:5544173-5544195 AGGGAGGCTCTGGCAGGGGCGGG - Intergenic
1161663702 19:5562315-5562337 AGGTGAGCCCTGGCAGGGGCAGG - Intergenic
1162320213 19:9967161-9967183 AAGGAAGGTCTGGCCTGGGAGGG - Intronic
1162421001 19:10566032-10566054 GAGGAAGCCCTGGACGGGGCGGG + Intronic
1162948890 19:14058996-14059018 TGGGGAGCCCTGGGCGGGGCTGG + Intronic
1163290048 19:16373306-16373328 TGGGAAGCCCTGGGGTGGCCAGG + Intronic
1163314253 19:16531572-16531594 AGGGGAGCAAGGGCCTGGGCTGG + Intronic
1163596177 19:18222251-18222273 AGTCCAGCCCTGGCCTGGGCCGG - Exonic
1163801481 19:19368355-19368377 AGTCAAGCCAGGGCCTGGGCCGG - Intergenic
1163815203 19:19460847-19460869 GGGGAAGCACTGGCCCAGGCCGG - Intronic
1165060904 19:33204814-33204836 ACGGAAGCCCTGGGCCTGGCCGG - Exonic
1165108887 19:33489750-33489772 CAGGCAGCCCTGGCCAGGGCAGG - Intronic
1165145708 19:33728728-33728750 AGGGGAGCCCAGGCCAGGGAAGG + Intronic
1165152752 19:33770621-33770643 AAGGAGGCCCATGCCTGGGCTGG - Intronic
1165255586 19:34575757-34575779 AGGAAAGCCCTTGTCTGAGCAGG + Intergenic
1165262840 19:34635755-34635777 GGAGAAGGCCTGACCTGGGCAGG + Intronic
1165331527 19:35143219-35143241 GGGGGAGCCCTGGCGTGGGGGGG - Intergenic
1165925479 19:39323463-39323485 AGGGTAGGCCTGGGCTGGACAGG + Intergenic
1166108356 19:40608536-40608558 AGGGAAGCTCAGGGCCGGGCCGG - Exonic
1166283593 19:41810475-41810497 AGGCTAGCCCTGCCCTGGCCAGG + Intronic
1166334834 19:42099532-42099554 TGGGAAGCCCGGCCCGGGGCTGG + Exonic
1166851800 19:45764900-45764922 AGGGAATCTTTGGTCTGGGCCGG + Exonic
1167148557 19:47696262-47696284 GGGGAAGACCTGGGCTGGGCTGG - Intronic
1167158662 19:47754405-47754427 AGGAAAGCCTGGGCCGGGGCGGG + Intronic
1168148596 19:54433028-54433050 AGGGCAGCCCTGGGCTGGGTGGG - Intronic
1168155401 19:54471426-54471448 AGTGAAGCCCTCGCCGGGCCGGG - Intronic
1168469226 19:56627459-56627481 AGGGAAGCCCAGGGCAGGTCAGG + Intergenic
924961149 2:35703-35725 AGGGGAGCCCTGCCTTGGGTAGG - Intergenic
925746626 2:7049093-7049115 AGGGAAGGCAGGGCCTGGGGAGG + Intronic
926239035 2:11070795-11070817 CGAGAAGCCCTGTCCTGGGTGGG - Intergenic
926251206 2:11156445-11156467 GGGGAAGGCCTGGCCTGGCCAGG - Intronic
926345537 2:11941637-11941659 AAGGAATCCCGGGTCTGGGCCGG - Intergenic
926735917 2:16073212-16073234 AATGAATCCCTGGCCTGTGCAGG - Intergenic
927199570 2:20569976-20569998 AGAAAAGCCCTGGGCAGGGCTGG - Intronic
927443383 2:23136031-23136053 AGGCAGGCGCTGGCCTGGGTGGG + Intergenic
927508745 2:23631132-23631154 AGGGCAGCCATGTGCTGGGCTGG - Intronic
927696457 2:25242716-25242738 CGGGAAGCCCTTGGCTGGGGGGG + Intronic
927884580 2:26710588-26710610 AGGGAAGCCCTGGCAGGAGATGG + Intronic
927949627 2:27158881-27158903 AGCTCAGCCCCGGCCTGGGCCGG - Intergenic
927962295 2:27248613-27248635 GGGGAAGCCATGTCCAGGGCAGG + Intergenic
928829473 2:35462409-35462431 AGGTAAGCCCTGGACTGGCTGGG - Intergenic
928922791 2:36542681-36542703 TGTGAAGCCCTGGACTAGGCAGG + Intronic
929084019 2:38149695-38149717 AGGTAAGCCATGGCCTGGCCTGG + Intergenic
930024424 2:47021562-47021584 AGGAAAGCCAGGGCCGGGGCAGG - Intronic
932420075 2:71596390-71596412 AGGGAAGCACGGGGCGGGGCGGG + Intronic
932481549 2:72042380-72042402 AGGGAAGCCTGGGCCTGGGGAGG + Intergenic
932695824 2:73955582-73955604 AGGGAAGTCCTGGCCGGGCACGG + Intronic
932707552 2:74038377-74038399 GGGGAAGACCTAGCCTGGGATGG + Intronic
933808644 2:86018226-86018248 TCTGAAGGCCTGGCCTGGGCGGG - Intergenic
934476841 2:94599304-94599326 AGGGGAGCCCAGAGCTGGGCTGG - Intronic
934736340 2:96691660-96691682 AGAGAAGCCAGGGCCTGGCCTGG + Intergenic
935091680 2:99900697-99900719 AGAGAATCCCAGGCCTGGTCTGG - Intronic
935147204 2:100403957-100403979 AGAGAGGCCCTGGGCTGGGGTGG - Intronic
935194951 2:100807725-100807747 AGGGAAGCACTGGCCTGAGCAGG + Intergenic
935487398 2:103674534-103674556 AGGGCTGCCCTGGGCTGGGAAGG + Intergenic
936481038 2:112885028-112885050 AGGGTGGCCCTGGCCTGACCCGG + Intergenic
937252639 2:120534205-120534227 AGGGCAGCTCTGGCCAGGCCAGG + Intergenic
941725261 2:168853596-168853618 AGGGAAGCCTTGGACTGGTATGG + Intronic
941908585 2:170740792-170740814 TGGGATGCCCTGGGCAGGGCAGG - Intergenic
941911906 2:170771561-170771583 CGGGAAGCCCTGGGATGGGCTGG - Intergenic
942208678 2:173648959-173648981 GGGGCAGCCATGGCCTGGCCGGG + Intergenic
942294807 2:174507204-174507226 AGGCAAGGCCTGGGCTGTGCTGG + Intergenic
942528799 2:176886070-176886092 AGGGAAGCAGAGGCCTTGGCAGG - Intergenic
944539975 2:200745570-200745592 AGGGAAACCAAGGCCTGGGGAGG - Intergenic
944626644 2:201576476-201576498 AAAGGAGCCCTGGTCTGGGCTGG - Intronic
945010978 2:205463344-205463366 AGAGTAGCCATGGCCTGGCCAGG + Intronic
945972661 2:216245634-216245656 AGGAAAACCCTGGCCTAGGAAGG + Intergenic
946278713 2:218650461-218650483 AGGTACACCCTTGCCTGGGCAGG - Exonic
946307655 2:218865320-218865342 AGGGAGTGCCTGGCCTAGGCAGG - Intronic
947578184 2:231293378-231293400 AGAGAACTCCTGGCCTGGGAGGG - Intronic
947640984 2:231707868-231707890 AGGGGTGCCCTGCCCTGGGAGGG + Intronic
947822402 2:233081233-233081255 AGGGGAGCCCTGTCTGGGGCAGG + Intronic
947935350 2:233999165-233999187 AGGGCAGAGCTGGGCTGGGCTGG + Intronic
948088161 2:235267694-235267716 CAGGGAACCCTGGCCTGGGCTGG - Intergenic
948541365 2:238693491-238693513 AGGGAGGCCTTGGGCTGTGCTGG + Intergenic
948586980 2:239025820-239025842 CGGGACGACCTGGCCTGGGGGGG - Intergenic
948633908 2:239321782-239321804 GGGGAAGTCCTGGTGTGGGCGGG - Intronic
948876379 2:240831934-240831956 GGGGATGCCCTGACCTGCGCTGG + Intergenic
948902844 2:240964987-240965009 AGGGGAGGCCTGGCCTCTGCAGG + Intronic
949059303 2:241947554-241947576 CGGTAAGCCCAGGTCTGGGCAGG - Intergenic
1169748147 20:8963954-8963976 ACTGCAGCCCTGGCCTTGGCAGG + Intronic
1170026337 20:11892277-11892299 GGGAAAGCCCTTGGCTGGGCAGG - Intronic
1170810181 20:19668070-19668092 AGGGAAGAATTGGCCTGGGGGGG + Intronic
1171449540 20:25225989-25226011 AGGGGAGCTCTGCCCTGGGGAGG - Exonic
1171813328 20:29762721-29762743 CGGGAAACACTGGCCCGGGCAGG + Intergenic
1172004702 20:31811023-31811045 AGTGAAGCTCTGGCCTGGCGCGG - Intergenic
1172115802 20:32572807-32572829 AGGGAAGCCAGAGCCTGTGCAGG - Intronic
1172304406 20:33871089-33871111 AGGCAGCCCCTGGCCTGGCCTGG - Intergenic
1173177738 20:40777317-40777339 AGGGGAATCCTGGCCTGGGACGG + Intergenic
1173617328 20:44411558-44411580 AGGGAAGCCGTGCTCTGAGCTGG + Intronic
1174052724 20:47778533-47778555 CAAGAAGCCCTGGCCTGGGCTGG + Intronic
1174393335 20:50231567-50231589 AGGGAGGACCTGGCCTGGACAGG + Intergenic
1174725703 20:52859598-52859620 AGGGAATTCCAGGCCTGGGAGGG - Intergenic
1175223577 20:57431997-57432019 GGGGAAGCGTGGGCCTGGGCTGG + Intergenic
1175229636 20:57465591-57465613 AGGGAAGTCCTTGCCTGGCCTGG - Intergenic
1175788365 20:61725953-61725975 AGGGAAGCCAGGCCCTGGGGTGG - Intronic
1175800040 20:61796362-61796384 TGGGCAGCCCTGGCCCGTGCTGG - Intronic
1176038131 20:63050196-63050218 AGGGAAGCCCGGCCCAGGGCAGG + Intergenic
1176111024 20:63410780-63410802 AATGAAGCCCAGGCCTGAGCTGG - Intronic
1176130882 20:63496341-63496363 AGGGGAGCCCTCGCCCGGGAGGG - Intronic
1176239039 20:64067468-64067490 AGGGAAGGGCTGGGCTGGGCTGG + Intronic
1176275395 20:64263363-64263385 AGGGAAGCCTTGGCCTGGGCTGG + Intronic
1176300255 21:5095894-5095916 TGGGCAGCCCTGGCCCAGGCAGG - Intergenic
1176860701 21:14010167-14010189 CTGGGAGCCCTGGGCTGGGCAGG + Intergenic
1178493659 21:33070189-33070211 AGGAACGCCCTGGGGTGGGCCGG - Exonic
1178934541 21:36850416-36850438 AGGTAACCCCTGACCTGGTCAGG + Intronic
1179331027 21:40401778-40401800 TGGAAGGCCCTGGCTTGGGCTGG - Intronic
1179856767 21:44166017-44166039 TGGGCAGCCCTGGCCCAGGCAGG + Intergenic
1179878815 21:44285062-44285084 AGGGATGCTGTGGCCTGGACAGG - Intergenic
1179885697 21:44313392-44313414 AAGGAAGTCCTGGGCTGGCCAGG + Intronic
1179892633 21:44344660-44344682 AGGGAGGCCCAGGGCTGGGCAGG - Intergenic
1180163049 21:46006626-46006648 GGGGAAGAGCGGGCCTGGGCCGG - Intergenic
1180222364 21:46367161-46367183 AGGAGAGGCCTGCCCTGGGCTGG - Intronic
1180316004 22:11277760-11277782 CGGGAAACACTGGCCCGGGCAGG + Intergenic
1181438718 22:22924862-22924884 AGGGAGGGCTTGGGCTGGGCTGG - Intergenic
1181456680 22:23063881-23063903 AGGTGAGGCCTGGCCTAGGCTGG - Exonic
1181519741 22:23438363-23438385 AGGGAAGCCCTGGCAGGAGGAGG - Intergenic
1181572256 22:23773937-23773959 AGGGCAGCCTTGTCCTGTGCTGG + Intronic
1182518576 22:30872606-30872628 ACGGAAGCTGTGCCCTGGGCTGG + Intronic
1182975364 22:34619246-34619268 ATTGAAGCCCTGGGCTGGGCAGG + Intergenic
1183475929 22:38035746-38035768 GGGGAAGCCCTGGCGGGAGCGGG + Intronic
1183616410 22:38948483-38948505 AGGGAAGACAGGGCCTGGGAGGG + Intergenic
1183737062 22:39649981-39650003 GGGGCTGCCCAGGCCTGGGCAGG - Intronic
1184073422 22:42161232-42161254 AAGGAAGTGCTGGCATGGGCAGG + Exonic
1184090150 22:42288870-42288892 AGGGCAGTGCAGGCCTGGGCTGG + Intronic
1184293563 22:43510356-43510378 TGGGAAGCCAGGGCCTGGGATGG - Intergenic
1184465524 22:44667335-44667357 AGGGATGTCCTGGCCTTGGAGGG - Intergenic
1184474348 22:44712464-44712486 CGGGAAGCCCTGGCCAGTCCCGG + Intronic
1184645419 22:45892339-45892361 AGGGATGCCCCGGGCTGGGCAGG - Intergenic
1184686033 22:46096760-46096782 TGGGAAGCCTGGGCCTGGGGAGG + Intronic
1185032113 22:48449623-48449645 AGGGAAGCCCTGGGATCGGCAGG + Intergenic
1185065015 22:48627809-48627831 AGGGAGGCACAGGCCTGGCCTGG + Intronic
1185229224 22:49670752-49670774 AGGGAAGCGCTCTCCCGGGCCGG - Intergenic
1185275528 22:49948887-49948909 AGGACAGCCCTGGCCAGGGCTGG - Intergenic
950371167 3:12531933-12531955 TGAGAAGTCCTGGCCTGGCCAGG - Intronic
950465819 3:13153131-13153153 AGAGGAGCCCTAGCCTGGCCTGG - Intergenic
950668878 3:14513495-14513517 AGGGAAGCCTTGGCACGGGAGGG - Intronic
951899421 3:27642210-27642232 AGGAAAGCCCTGAGCAGGGCTGG + Intergenic
952386492 3:32845239-32845261 ATGGAAGCCCTGGCATGGTCTGG - Intronic
952411265 3:33052047-33052069 AGGGAAGCCCTGGCATTGGAAGG - Intronic
952848355 3:37707853-37707875 AGGGCTGCCCTGCCCTTGGCTGG + Intronic
952898555 3:38095183-38095205 AGCCAAGTGCTGGCCTGGGCAGG - Intronic
953785106 3:45905629-45905651 TGGGAAGGCCTGGCTTGGGCAGG - Intronic
954121167 3:48500976-48500998 AGGGATCCCCTGTTCTGGGCTGG - Intronic
954194752 3:48990050-48990072 AGAGAAGCCCCAGCGTGGGCTGG + Exonic
954334647 3:49909228-49909250 AAGGCAGCCCTGGGATGGGCTGG - Intronic
954413346 3:50380838-50380860 AGGAAAGGGCTGGCCTGGGTAGG + Intronic
954632835 3:52056396-52056418 CGGGCAGCCCTGCCCTGGGACGG + Exonic
954801431 3:53189247-53189269 GTGGAGGCCCTGGGCTGGGCTGG + Intronic
955392264 3:58530452-58530474 TGGGCACCCCTTGCCTGGGCCGG + Exonic
956786914 3:72650497-72650519 GGGGCAGCCTTGGCCTGGGTAGG + Intergenic
960918259 3:122719524-122719546 AGGGAAGCCCTGTCTTGTGTAGG + Intronic
961206924 3:125091442-125091464 GGTGAAGCCCTGGACTGGCCCGG + Exonic
961372192 3:126438353-126438375 ACGGCAGCCTCGGCCTGGGCAGG - Exonic
961441985 3:126958726-126958748 AGGGAAGCCCTGGGTAGGACAGG + Intronic
961491241 3:127258006-127258028 AGGGAATTCCAGGCCTGGGTCGG - Intergenic
961562438 3:127740034-127740056 GGGGAAGCCCTGGCCTCAGCAGG + Intronic
961634000 3:128321577-128321599 AGGAGTGCCGTGGCCTGGGCAGG - Intronic
961712158 3:128836024-128836046 AGGTCAGCCCTGGGCAGGGCAGG - Intergenic
961737548 3:129011604-129011626 AAGCAAGCCCTGTCCAGGGCAGG + Intronic
963001369 3:140684791-140684813 AGCCAAGCCCTGGCCTAGGGAGG - Intronic
963800360 3:149670014-149670036 TTGGAAGCACTGGCCTGGTCGGG - Intronic
964722566 3:159781814-159781836 AGAGAAGCCCTGTCCTGGGAAGG - Intronic
966696828 3:182798406-182798428 AAGGAAGCACTGGCCTAGGGTGG + Intronic
967184093 3:186930680-186930702 AGGGGAGTCCTGGGCAGGGCCGG + Exonic
967306494 3:188064607-188064629 GGAGAAGCCTTGGCCAGGGCAGG - Intergenic
968523218 4:1043884-1043906 GGGGAGGCCCTGGGCTGGGGCGG - Intergenic
968552311 4:1229919-1229941 AGGGGAGCCCTGGGCTAGCCTGG + Intronic
968578332 4:1378158-1378180 CGGGAAGCCAGGGCCTGGCCAGG + Intronic
968897908 4:3415554-3415576 AGAGACGCCTTGGCCTGGCCCGG + Intronic
968947170 4:3671108-3671130 AGGGAGCCCCTGCCCCGGGCCGG - Intergenic
968964136 4:3761018-3761040 CAGGGAGCCGTGGCCTGGGCTGG - Intergenic
968981693 4:3853622-3853644 AGGGATCTGCTGGCCTGGGCTGG - Intergenic
969112968 4:4855084-4855106 AAGGAAGCCCGGGCCTGGGACGG + Intergenic
969225957 4:5798518-5798540 AGAGAAGCTCTGGCCAGGACTGG - Intronic
969290363 4:6235190-6235212 GAGGAAGCCGAGGCCTGGGCTGG - Intergenic
969317684 4:6391748-6391770 GGGGAAGCCCTGGGTGGGGCTGG + Intronic
969366217 4:6695800-6695822 AGGGCAGGGCTGGGCTGGGCTGG + Intronic
969429823 4:7147643-7147665 TGGGGGGCCCAGGCCTGGGCAGG - Intergenic
969533182 4:7740670-7740692 AGGGAGGCCCCGGCCTCTGCGGG - Exonic
969675339 4:8611350-8611372 GGGGAAGCTCTGGGCTGGGAAGG + Intronic
969695923 4:8734833-8734855 CAGGCAGCCCTGGCCTGGCCAGG - Intergenic
970899940 4:21147113-21147135 AGGGAGTGCCTGGCCTGAGCTGG + Intronic
972192319 4:36609838-36609860 AGGGCAGCAGTGGCTTGGGCTGG + Intergenic
977828571 4:101562976-101562998 AGGGAATGCGTGGCCTGGTCTGG + Intronic
979488632 4:121298210-121298232 AGAGAAGCCCAGGCCTTGGTAGG - Intergenic
979636002 4:122954711-122954733 AGACAACCCCTGGCCTGTGCTGG + Intronic
982067157 4:151664409-151664431 ACAGGAGACCTGGCCTGGGCAGG + Intergenic
982927200 4:161353349-161353371 AGGGAAGGCTAGGCCAGGGCAGG - Intergenic
984557714 4:181235065-181235087 AGGGAAGCCCTGGTGCAGGCTGG + Intergenic
984864161 4:184266911-184266933 AGGCACGCACTGGGCTGGGCTGG + Intergenic
985115965 4:186591107-186591129 AGGTTAGCCAGGGCCTGGGCAGG - Intronic
985484031 5:139079-139101 AGGGTGGCCCTGACCAGGGCTGG + Intergenic
985805297 5:2038931-2038953 AGGGCAGGGCTGGGCTGGGCTGG + Intergenic
985822461 5:2169617-2169639 AGGGAGGCCCTCGACTGGGCTGG - Intergenic
985963117 5:3318710-3318732 AGAGAAGCTCAGGCCTAGGCTGG - Intergenic
986006639 5:3673834-3673856 AGGGAAGCCAGGACCTTGGCTGG - Intergenic
986017594 5:3771252-3771274 AGGGAAGGCTGGGCTTGGGCAGG - Intergenic
986605009 5:9514099-9514121 AGGGAAGCCCTAGCCCAGGGAGG - Intronic
988497558 5:31758040-31758062 AGATGAGCCCCGGCCTGGGCAGG - Intronic
988781858 5:34529587-34529609 AGTGGGGCCGTGGCCTGGGCTGG - Intergenic
991933790 5:71782298-71782320 AGGGAAGCCATTGGCTGGGCTGG - Intergenic
993754261 5:91708054-91708076 AAGGAAGTCCTGGCCGGGGATGG - Intergenic
995208469 5:109509724-109509746 TGGAGAGCCCAGGCCTGGGCTGG + Intergenic
998755271 5:145371171-145371193 AGGGCAGCCTTGTCTTGGGCCGG + Intergenic
998849286 5:146338628-146338650 AGGGTAGCCCTGGGCTGAGCTGG - Intronic
999176030 5:149632287-149632309 AGGGAAGACCAGGCCAGGGTGGG + Exonic
999382169 5:151129040-151129062 GGGGAACCTTTGGCCTGGGCCGG - Intronic
999458687 5:151739542-151739564 GGGGGAGCTCTGGCCTGGCCTGG - Intergenic
1001103111 5:168830242-168830264 ATGGAGGCCCTGGGCTGAGCGGG - Intronic
1002026747 5:176400960-176400982 AGGGAAGGGCAGGCCAGGGCAGG + Intronic
1002069662 5:176671829-176671851 TGGGAAGTCCTTCCCTGGGCTGG - Intergenic
1002105979 5:176879630-176879652 GGGGAGGCCCTGCCCTGGGGTGG + Intronic
1002337085 5:178487224-178487246 AGGGAAGCCCTGGCCTGGGCTGG - Intronic
1002827320 6:785268-785290 AGAAAAGGCCTGGCCTTGGCAGG - Intergenic
1002921310 6:1575285-1575307 AGAGGAGGCCTGGCCAGGGCAGG - Intergenic
1002941054 6:1716597-1716619 AGAGAAGGCCTGGCCAGGGCAGG + Intronic
1005927306 6:30454013-30454035 TGAGAAGCCCTGGACTGCGCGGG + Intergenic
1005930835 6:30482393-30482415 TGAGAAGCCCTGGACTGCGCGGG + Intergenic
1006250495 6:32779271-32779293 AGGGAAGCACTGCCCTGAGGTGG + Intergenic
1006295264 6:33167391-33167413 AGGGAAGGGCTGGGCTGGGGTGG - Intronic
1006334894 6:33415321-33415343 AGAGGAGCACTGACCTGGGCAGG - Exonic
1006764737 6:36494875-36494897 AGGAGAGCCCAGGCCTAGGCAGG - Exonic
1006887618 6:37395653-37395675 AGGGAAGACCTGGGGTGAGCAGG - Intergenic
1007139928 6:39561775-39561797 AGGGAAGCCATGGGCAGGACAGG + Intronic
1007747045 6:44049623-44049645 AGCCAGGCCCTGGGCTGGGCAGG - Intergenic
1010138432 6:72583235-72583257 AGGGCATCCCTGTCCTGTGCCGG + Intergenic
1011653260 6:89526477-89526499 ATTGCAGCCCTGGCCTGAGCTGG + Intronic
1011806747 6:91080667-91080689 TGGGAAACCCTGGCCTAGGGTGG - Intergenic
1013276415 6:108589331-108589353 AGGGCAGCCAAGGCCTGGCCCGG - Intronic
1016218060 6:141627610-141627632 AGGGAAGCCCAAGGCTGGCCTGG - Intergenic
1017113033 6:150950319-150950341 AGGGCAACACTGGCCTAGGCAGG - Intronic
1018247211 6:161834799-161834821 ATGGTTGCCCTGGCCTGGGAGGG - Intronic
1018252221 6:161882426-161882448 AGGGAAGCTGCCGCCTGGGCTGG - Intronic
1018756334 6:166852771-166852793 AGGGACCCTCAGGCCTGGGCAGG - Intronic
1018933035 6:168254684-168254706 AGGCAGACCCTGTCCTGGGCAGG - Intergenic
1018997381 6:168720158-168720180 GGGGATGCCCTGGGCTGGCCTGG + Intergenic
1019134055 6:169897248-169897270 AGGGAGGCCCTGGGCTGCCCAGG - Intergenic
1019170042 6:170128788-170128810 AGGGGAGCCCTGCCGTGGGCAGG + Intergenic
1019226668 6:170517027-170517049 TGGGCAGGCCTGGACTGGGCAGG - Intergenic
1019257830 7:63083-63105 ATGGAAGTCATGGCCAGGGCAGG - Intergenic
1019286907 7:228246-228268 AGGCGACCCCTGCCCTGGGCAGG + Exonic
1019406565 7:887139-887161 ACGGACGCCCTGGCCGAGGCGGG - Intronic
1019428159 7:987023-987045 AGTGGAGCCCAGGGCTGGGCTGG + Intronic
1019442081 7:1052560-1052582 AGGGACGGCCTGGCCTGGGAGGG + Intronic
1019447633 7:1079678-1079700 AGGCAGGCCCTGGCGGGGGCTGG + Intronic
1019473105 7:1231611-1231633 AGGAGAGCTCCGGCCTGGGCTGG - Intergenic
1019490797 7:1312312-1312334 GGGCAAGGCCTGGGCTGGGCAGG + Intergenic
1019530434 7:1500358-1500380 TGGGCAGCACTGGCCGGGGCAGG + Exonic
1019568037 7:1694351-1694373 TGGGAGGCGCTGGGCTGGGCCGG - Intronic
1019591521 7:1837909-1837931 AGGGAAGCCCTGGCAGGAGGAGG + Intronic
1019624936 7:2011242-2011264 GGGGCATCCCTGGCTTGGGCTGG + Intronic
1019641872 7:2107613-2107635 AGGGCAGCCGGGGGCTGGGCAGG - Intronic
1019743804 7:2688532-2688554 AGGGAAGGCCGGGCCAGGGAAGG + Intronic
1020083163 7:5297125-5297147 GGGGCAGGCCAGGCCTGGGCAGG + Exonic
1020083721 7:5299481-5299503 AGGGAGGCCCTGGCCTATCCGGG + Intronic
1020272757 7:6607060-6607082 GGGGCAGCCCTCGCCTCGGCTGG + Intronic
1022097955 7:27152472-27152494 AGGGAAGCCCCGGCCAGGCCAGG - Intronic
1023603295 7:41902398-41902420 AGGGAGGCCCAGCCCTGTGCAGG + Intergenic
1023820688 7:43978994-43979016 AGGGAGGCCCAGACCTGGACAGG + Intergenic
1024117205 7:46205730-46205752 AGGGAAGGCCTGCCCTTGGGTGG - Intergenic
1024236557 7:47403117-47403139 AAGGAGGCCCTGCGCTGGGCGGG - Intronic
1024294776 7:47833345-47833367 AGGACAGGCCTGGCATGGGCGGG + Intronic
1024766781 7:52669182-52669204 ACGGAAAGCGTGGCCTGGGCGGG - Intergenic
1025158483 7:56631272-56631294 AGGGAATCCTGGGCCTGTGCTGG + Intergenic
1025211120 7:57020062-57020084 GGGGCAGGCCAGGCCTGGGCAGG - Intergenic
1025253208 7:57365679-57365701 TGGGACACCATGGCCTGGGCTGG + Intergenic
1025637412 7:63335195-63335217 AGGGAATCCTGGGCCTGTGCTGG - Intergenic
1025645285 7:63412904-63412926 AGGGAATCCTGGGCCTGTGCTGG + Intergenic
1025660835 7:63556785-63556807 GGGGCAGGCCAGGCCTGGGCAGG + Intergenic
1025728120 7:64086990-64087012 AGGGAATCCTGGGCCTGTGCTGG - Intronic
1025757248 7:64356896-64356918 AGGGAATCCTGGGCCTGTGCTGG - Intergenic
1026846952 7:73703903-73703925 GGGGGAGCCCGGGCCTGGGACGG - Intronic
1029111426 7:98214734-98214756 CAGGAAGCCCTGGGCTGCGCTGG - Exonic
1029748968 7:102532425-102532447 AGGGAGGCCCAGACCTGGACAGG + Intergenic
1029766911 7:102631531-102631553 AGGGAGGCCCAGACCTGGACAGG + Intronic
1032098355 7:128951736-128951758 AGGGGAGCCCTAGCCTGGCTTGG - Intergenic
1032238103 7:130141583-130141605 AGGGAGGCCCTGGGCCGAGCTGG - Intergenic
1033473273 7:141667743-141667765 AGGACAGCCCTGGCTTGGACAGG - Intronic
1033562115 7:142542153-142542175 AGGTATGCCCTAGCCTGGTCAGG + Intergenic
1034245257 7:149639043-149639065 AGGGAGGCCAGGGCTTGGGCAGG - Intergenic
1034268221 7:149791324-149791346 AGGGAAGCCCTGTCCTGTTGGGG - Intergenic
1034391729 7:150792452-150792474 AGGGAAGCCCTTAGCTGGTCTGG + Intronic
1034818792 7:154197930-154197952 AGGGAGGCCCTTTCCTGGGTGGG - Intronic
1034982490 7:155487955-155487977 AGGGCAGCCCTGGCGTGTGAAGG + Intronic
1034997140 7:155584620-155584642 AGGGGCTCCCTGGGCTGGGCTGG + Intergenic
1035056673 7:156040590-156040612 AGGGAGGAGCTGGGCTGGGCTGG - Intergenic
1035221083 7:157406944-157406966 CGGGAAGCCCTGGTCGAGGCTGG + Intronic
1035314538 7:157989894-157989916 AGCGCAGCCCTGGGCAGGGCGGG - Intronic
1035349828 7:158238163-158238185 AAGGACGCCCTGGGCTTGGCTGG + Intronic
1035431859 7:158828914-158828936 AGGGAAGCGCCTGCCTGGACCGG + Intronic
1035589563 8:802350-802372 AGGGAAGCTGTGGCCTGAGGTGG - Intergenic
1035721436 8:1796375-1796397 AGGGAGGCTCGGGGCTGGGCAGG - Intergenic
1036019649 8:4830064-4830086 TGGGTATCCCTGGCCTAGGCAGG - Intronic
1036701190 8:11015086-11015108 AGGGAAGCCGGGACCTGGGTTGG + Intronic
1037457871 8:19082172-19082194 AGGGAACCCCTGCCCAGGGTTGG - Intronic
1037707327 8:21326208-21326230 AGGGAGGCCAAGGCATGGGCAGG + Intergenic
1037904907 8:22710546-22710568 AGGGATCGCCTGGCCAGGGCTGG + Intergenic
1037947206 8:22996962-22996984 GGGGCAGTCCTGGCCAGGGCTGG + Intronic
1038411069 8:27360404-27360426 AGAGGAGGCCTGGCCTGGGCAGG + Intronic
1039379389 8:37070739-37070761 GAGGAAGCCCTGGCCTGTCCAGG - Intergenic
1039440836 8:37594345-37594367 AGAGTAGGCCTGGCCTTGGCGGG - Intergenic
1039741278 8:40385162-40385184 ATGGAAGCCCTGCCCTGAACTGG - Intergenic
1040372729 8:46793823-46793845 AGGGAATCCTGGGCCTGTGCTGG - Intergenic
1040413705 8:47179828-47179850 AGGGAAGCTCCGGCCTTGGGAGG - Intergenic
1040567829 8:48582742-48582764 AGGGAAGCCTGGGTCTGGGCTGG + Intergenic
1040834411 8:51717584-51717606 ATGAAAGCCATGACCTGGGCTGG + Intronic
1041633330 8:60113728-60113750 AGGGTAGACCTGGCCTGGCAAGG - Intergenic
1042590547 8:70393680-70393702 AGGGAAGCAAAGGCTTGGGCAGG - Intronic
1044015295 8:87043264-87043286 AGGGAAGCCCAGGTCAGGGAGGG - Intronic
1044136133 8:88588402-88588424 AAGGAAGCCATGGGATGGGCAGG - Intergenic
1048173277 8:132129112-132129134 TGGGAAGCCCCTGCCTGGGTGGG + Exonic
1048282406 8:133114996-133115018 TGGGAGGCCTTGCCCTGGGCTGG + Intronic
1048375995 8:133822717-133822739 TGGGAAGCCTTGGCTTGGGCTGG + Intergenic
1048584169 8:135757203-135757225 TGGGAAGCGGTGGGCTGGGCAGG + Intergenic
1048921595 8:139236274-139236296 GGGGAAGCCCTGACCTAGCCTGG + Intergenic
1049167148 8:141133502-141133524 TGGGGAGCCCTGGGCTGGGTGGG + Intronic
1049263720 8:141653709-141653731 AGGAAACGCCTGGCCTGGCCAGG - Intergenic
1049265516 8:141665920-141665942 AGGGGAGCGCTGGCCCTGGCTGG + Intergenic
1049329135 8:142040658-142040680 AGGGAATCCCTGGAATGGGCAGG - Intergenic
1049329844 8:142044622-142044644 AGGGGAGGCCTGGGCTGGTCTGG - Intergenic
1049361398 8:142213967-142213989 CGGGAAGCCCTGGCCTTTCCAGG + Intronic
1049431602 8:142567741-142567763 AGGGAGGCCTGAGCCTGGGCTGG - Intergenic
1049478705 8:142809916-142809938 GGGGCTGCCCTGGGCTGGGCTGG + Intergenic
1049690151 8:143954748-143954770 AGGGGTGCCCTGGTGTGGGCAGG - Intronic
1050382303 9:5042676-5042698 AGGGCAGGCCTGGCCTGGAGGGG + Intronic
1051721210 9:20039400-20039422 AGGGAAACCCAGTCCAGGGCAGG + Intergenic
1052988430 9:34504262-34504284 AGTGTATCTCTGGCCTGGGCAGG - Intronic
1053489186 9:38487067-38487089 AGGAAAGCCCTGCCCTGGCATGG - Intergenic
1053931212 9:43115105-43115127 AGGGGAGCCCAGAGCTGGGCTGG + Intergenic
1056464377 9:86839330-86839352 AGGGGAGCCCTGGGGAGGGCCGG + Intergenic
1056675639 9:88674823-88674845 AGGAAAACCATGGCCTGGGTTGG - Intergenic
1057078476 9:92154166-92154188 TGGGATGCCCTGGCCTTGCCTGG - Intergenic
1057293110 9:93819608-93819630 AGGGAAGCCCTGTGCTTGGTGGG - Intergenic
1057303504 9:93899743-93899765 TGGGGAGCCCTGGCTGGGGCTGG + Intergenic
1057799303 9:98180394-98180416 AGGGGAGCCATGGCCTGCGAGGG - Intronic
1057799540 9:98181792-98181814 AGGGGAGCCATGGCCTGCGAGGG - Intronic
1059954012 9:119497054-119497076 ATGCACGCCCTGTCCTGGGCAGG - Intronic
1060102994 9:120856659-120856681 AGGGAAGCCCTTGCCAGTGGGGG - Exonic
1060182875 9:121546097-121546119 AGGGACGGCCTGGGCTGAGCTGG - Intergenic
1060350575 9:122855216-122855238 TGGGAAGCAGTGGCCTGGACAGG + Exonic
1060548311 9:124473589-124473611 AGGCCAGCCCTGGCATGGGGAGG - Intronic
1060555836 9:124506786-124506808 AGGGAAGCCTAGACCTGGCCCGG + Intronic
1060667210 9:125439088-125439110 GGGAAGGCCCTGACCTGGGCCGG + Intronic
1061038642 9:128127418-128127440 AGGTAAGGCCTGGCCCGGCCGGG - Exonic
1061090229 9:128421823-128421845 GGTGGAGCCCTGGCCTGGGGAGG + Intronic
1061307038 9:129738077-129738099 AGGGGTGACCTGGCCGGGGCAGG + Intergenic
1061702201 9:132424430-132424452 GGAGCAGCCCTGGCCTGGCCTGG + Intronic
1061917528 9:133763081-133763103 AAGGAAGCCCTGCCAGGGGCTGG + Exonic
1062020837 9:134318698-134318720 CGCGAAGGGCTGGCCTGGGCTGG + Intronic
1062076757 9:134593943-134593965 TGGGAAGCGCTGGCCTGGGCAGG + Intergenic
1062144370 9:134980732-134980754 GGAGAGGCCCTGGCCTGGGAAGG - Intergenic
1062249463 9:135587064-135587086 AGGGGAGCCCTGGGCTGTGTTGG - Intergenic
1062254116 9:135613126-135613148 AGGGATGCCATGGTCTGTGCAGG - Intergenic
1062340205 9:136090781-136090803 AGGGCAGCCCGGCCCTGGGCTGG - Intronic
1062340822 9:136093355-136093377 AGGGCTGCTCTGCCCTGGGCAGG - Intronic
1062384567 9:136304049-136304071 TGGGCAGCCCGGCCCTGGGCTGG + Exonic
1062410035 9:136418956-136418978 AGGGACGCCCAGGTCTGGACAGG - Intronic
1062457648 9:136646994-136647016 AGAGAGGCGCTGGCCTGGCCCGG + Intergenic
1062458832 9:136654357-136654379 AGGGAAGCCAGGGCCAGGGAAGG + Intergenic
1062717780 9:138019645-138019667 AAGGAAGCACTGGGCAGGGCGGG - Intronic
1062732687 9:138118696-138118718 TGGGGAGCCCCAGCCTGGGCTGG + Exonic
1203364304 Un_KI270442v1:243714-243736 CGGGAAACACTGGCCCGGGCAGG + Intergenic
1189341184 X:40205834-40205856 AGGGAAGAGCTGTCCTGTGCTGG + Intergenic
1190183376 X:48213613-48213635 AGGGATCCCCTGGGCTGGGACGG - Intronic
1190193942 X:48300916-48300938 AGGGAACCCCTGGGCTGGAATGG + Intergenic
1190204077 X:48388136-48388158 AGGGATCCCCTGGGCTGGGACGG - Intronic
1190206459 X:48407267-48407289 AGGGATCCCCTGGGCTGGGACGG + Intronic
1190660458 X:52649575-52649597 AGGGATCCCCTGGGCTGGGATGG + Intronic
1192195677 X:69026336-69026358 ATGTGAGCCTTGGCCTGGGCTGG + Intergenic
1192284600 X:69721502-69721524 AGGGAAGCTCAGGCCTGGTGGGG + Intronic
1194493326 X:94578111-94578133 AAGGAAACTCTGGCATGGGCTGG + Intergenic
1195910848 X:109887196-109887218 AGAGAAGCCCTGGTGAGGGCTGG + Intergenic
1197512335 X:127385620-127385642 AGGGAAGCCCTGGCCGGGTGTGG - Intergenic
1199556479 X:149114308-149114330 GGAGCAGCTCTGGCCTGGGCTGG + Intergenic
1199666075 X:150097540-150097562 AGGGAAGCCAGGGCCTAGGTGGG - Intergenic
1199871430 X:151902074-151902096 AGGGAAAACATGGCCTGGGCTGG + Intergenic
1199884965 X:152010833-152010855 AGGGCATCCCTGTCTTGGGCCGG - Intergenic
1200057759 X:153470579-153470601 AGTGAAGCCAGGGCATGGGCGGG - Exonic
1200059785 X:153479115-153479137 AGGGAAGGGCTGGGGTGGGCAGG + Intronic