ID: 1002337466

View in Genome Browser
Species Human (GRCh38)
Location 5:178489759-178489781
Sequence GCTCCTCGATACAGACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002337458_1002337466 17 Left 1002337458 5:178489719-178489741 CCCCAGCTTCTTGCACCTCACCA 0: 1
1: 0
2: 0
3: 33
4: 300
Right 1002337466 5:178489759-178489781 GCTCCTCGATACAGACCCAGAGG No data
1002337464_1002337466 -3 Left 1002337464 5:178489739-178489761 CCACGGGATGCAGCAATTCCGCT 0: 1
1: 0
2: 2
3: 43
4: 402
Right 1002337466 5:178489759-178489781 GCTCCTCGATACAGACCCAGAGG No data
1002337460_1002337466 15 Left 1002337460 5:178489721-178489743 CCAGCTTCTTGCACCTCACCACG 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1002337466 5:178489759-178489781 GCTCCTCGATACAGACCCAGAGG No data
1002337463_1002337466 2 Left 1002337463 5:178489734-178489756 CCTCACCACGGGATGCAGCAATT 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1002337466 5:178489759-178489781 GCTCCTCGATACAGACCCAGAGG No data
1002337459_1002337466 16 Left 1002337459 5:178489720-178489742 CCCAGCTTCTTGCACCTCACCAC 0: 1
1: 0
2: 1
3: 14
4: 192
Right 1002337466 5:178489759-178489781 GCTCCTCGATACAGACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002337466 Original CRISPR GCTCCTCGATACAGACCCAG AGG Intronic