ID: 1002342694

View in Genome Browser
Species Human (GRCh38)
Location 5:178527238-178527260
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002342694_1002342702 26 Left 1002342694 5:178527238-178527260 CCTGGGGCTGGTCTGAGCTGACT 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1002342702 5:178527287-178527309 TCCCTTCTGTGCTGGGGTGAAGG 0: 1
1: 0
2: 1
3: 24
4: 267
1002342694_1002342699 18 Left 1002342694 5:178527238-178527260 CCTGGGGCTGGTCTGAGCTGACT 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1002342699 5:178527279-178527301 GAGAGCTCTCCCTTCTGTGCTGG No data
1002342694_1002342700 19 Left 1002342694 5:178527238-178527260 CCTGGGGCTGGTCTGAGCTGACT 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1002342700 5:178527280-178527302 AGAGCTCTCCCTTCTGTGCTGGG 0: 1
1: 0
2: 0
3: 20
4: 213
1002342694_1002342701 20 Left 1002342694 5:178527238-178527260 CCTGGGGCTGGTCTGAGCTGACT 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1002342701 5:178527281-178527303 GAGCTCTCCCTTCTGTGCTGGGG 0: 1
1: 0
2: 3
3: 26
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002342694 Original CRISPR AGTCAGCTCAGACCAGCCCC AGG (reversed) Intronic