ID: 1002342699

View in Genome Browser
Species Human (GRCh38)
Location 5:178527279-178527301
Sequence GAGAGCTCTCCCTTCTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002342694_1002342699 18 Left 1002342694 5:178527238-178527260 CCTGGGGCTGGTCTGAGCTGACT 0: 1
1: 0
2: 3
3: 30
4: 241
Right 1002342699 5:178527279-178527301 GAGAGCTCTCCCTTCTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002342699 Original CRISPR GAGAGCTCTCCCTTCTGTGC TGG Intronic