ID: 1002344432

View in Genome Browser
Species Human (GRCh38)
Location 5:178537517-178537539
Sequence CCTCAGAGGGAGTCTGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002344424_1002344432 5 Left 1002344424 5:178537489-178537511 CCTGGGACTGACGGAGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 387
Right 1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG 0: 1
1: 0
2: 1
3: 48
4: 445
1002344421_1002344432 14 Left 1002344421 5:178537480-178537502 CCACAGATGCCTGGGACTGACGG 0: 1
1: 0
2: 0
3: 10
4: 165
Right 1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG 0: 1
1: 0
2: 1
3: 48
4: 445

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002344432 Original CRISPR CCTCAGAGGGAGTCTGTGGC AGG Intronic
900929816 1:5729417-5729439 CCTCAGATGGGGTCCTTGGCTGG + Intergenic
900929998 1:5730410-5730432 CTTCTGAGTGAGTCTCTGGCCGG - Intergenic
901158321 1:7155330-7155352 TCTCGGAGGGAGCCTGTGGGAGG + Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
901293559 1:8143484-8143506 CCCCAGCGGCAGCCTGTGGCAGG - Intergenic
901319268 1:8329854-8329876 CCTCGGAGGGAGGATGTGCCCGG + Intronic
901517758 1:9760773-9760795 GCTCTGAGGGAGGCTGAGGCAGG - Intronic
901932109 1:12602437-12602459 CCCCTGAGGGCTTCTGTGGCAGG + Intronic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902441424 1:16432656-16432678 CCTCAAAGGAATTCAGTGGCTGG - Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903324215 1:22560610-22560632 CCTCAGAGGAGGACTGGGGCAGG - Intergenic
903581418 1:24373606-24373628 CTTCACAGGGAGTCTTTGGAAGG - Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904044950 1:27603356-27603378 CCCCAGCGGGGGTCTGGGGCTGG + Intronic
904677789 1:32208971-32208993 AGGCAGAGGGAGACTGTGGCAGG - Intergenic
904781184 1:32950079-32950101 GCTACTAGGGAGTCTGTGGCAGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
904869620 1:33608297-33608319 CATCACAGGGATTCAGTGGCAGG + Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
907336894 1:53705678-53705700 TCTCAGAAGGAGTCTGGGGTTGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
909810408 1:79925726-79925748 CATGAGAGGGACTCAGTGGCAGG + Intergenic
910316932 1:85896604-85896626 ACTCAGGGGGAGGCTGAGGCAGG - Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
911728325 1:101265927-101265949 TCTTAGAGGGAGTCTCTGGGTGG - Intergenic
911728807 1:101270127-101270149 AGTCTGAGGGAGTCTGAGGCAGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912828535 1:112929249-112929271 CCCCAGATGGAGGCTGGGGCTGG - Exonic
912937963 1:114020431-114020453 CCTCATAGGGACTCTGTGTGGGG - Intergenic
913291840 1:117280744-117280766 TTTCAGAGGGAGGCTGAGGCAGG + Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915626708 1:157118378-157118400 CCTCACAGGCAGTAAGTGGCAGG + Intergenic
915897807 1:159825082-159825104 ACTCAGCGTGAGTCTGTGGCTGG - Intergenic
916699020 1:167271669-167271691 CCTCAGAGAGTTTCTGTGGAAGG + Intronic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
919667308 1:200304334-200304356 CCTCAGAGAGAGAATGTGCCAGG - Intergenic
920060768 1:203225555-203225577 CCACACAGTGGGTCTGTGGCAGG + Intronic
920461296 1:206142576-206142598 CCTCCAAGGGATTCTGAGGCAGG - Intergenic
920501551 1:206488478-206488500 CCTCACAAGGATGCTGTGGCAGG + Intronic
920861204 1:209708520-209708542 GCCCAGAGAGAGTCTGTGTCTGG - Intronic
921712348 1:218385624-218385646 ACACAGAGGGTGTCTTTGGCTGG + Intronic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
922915855 1:229257109-229257131 CCTCACAGGGATCCTGAGGCAGG + Intergenic
924857212 1:247885702-247885724 CCTCAAGAGGAGTCTGAGGCAGG - Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1067231539 10:44415048-44415070 CCCCAGAGGAACTCTGTGGAGGG - Intergenic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1070586532 10:77770982-77771004 CCTCAGAGAGACTCAGCGGCAGG - Intergenic
1072323577 10:94274367-94274389 CCTGAGAGCAAGTCTGTAGCTGG - Intronic
1072591728 10:96833070-96833092 CCTCAGCGGGCGGCGGTGGCCGG + Exonic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1072721317 10:97782625-97782647 CCCTGGAGGGAGGCTGTGGCCGG - Intergenic
1073168408 10:101478825-101478847 CCTCTGTGGGAGGCTGAGGCAGG + Intronic
1073193524 10:101669369-101669391 CCTCCCAGGGAGTTTGTGTCAGG - Intronic
1073490360 10:103849246-103849268 ACTCAGAGTAATTCTGTGGCAGG - Intronic
1075119258 10:119651998-119652020 GCGCAGCGGGAGTGTGTGGCGGG - Intronic
1075710280 10:124527057-124527079 TCTCAGAGGGGCTCTGTGGCGGG - Intronic
1076547148 10:131253046-131253068 CCTCAGGGACAGTCTGTGACCGG - Intronic
1076807365 10:132865665-132865687 CCCCAGAGGGTGTCTCTGCCAGG - Intronic
1077164436 11:1128827-1128849 CCTCAGACGGCCTGTGTGGCTGG - Intergenic
1078150063 11:8750810-8750832 GCCAAGAGGGTGTCTGTGGCAGG + Intronic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078748403 11:14137269-14137291 CCTAAGAGGGATTCTGAGGCTGG - Intronic
1079119460 11:17671641-17671663 TCACAGAGGGAGTTGGTGGCTGG - Intergenic
1079135362 11:17773446-17773468 CCTCGGTGGGAGGCTGTTGCTGG - Intronic
1080255197 11:30282436-30282458 CCTCAGGCAGAGGCTGTGGCCGG - Intergenic
1080277954 11:30524139-30524161 ACTCAGTGGGAGGCTGAGGCAGG + Intronic
1082960753 11:58916642-58916664 CCTCAGAGGAAGGCTTTGACTGG - Intronic
1083678302 11:64340160-64340182 CTGCACAGGGTGTCTGTGGCTGG + Intergenic
1084529141 11:69716937-69716959 ACACAGTGGGAGCCTGTGGCAGG - Intergenic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1085519906 11:77131643-77131665 CCTCAGGGGGCCTCTGAGGCAGG + Intronic
1087045973 11:93844302-93844324 TCCCAGAGTGAGTCTGGGGCAGG + Intronic
1087202930 11:95364326-95364348 CTTCAGAGGGTGTCTGGGGAAGG + Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088287856 11:108206467-108206489 CCTCACAGGGAGCCAGTGCCTGG - Intronic
1089002475 11:115063613-115063635 CCTCAGAGGCAGTGTGGGCCAGG + Intergenic
1089295044 11:117462290-117462312 TCTCAGAGGGAGAGTGTGACTGG - Intronic
1089388942 11:118086908-118086930 CCTCAGAGGAGCACTGTGGCCGG + Intronic
1089405901 11:118197189-118197211 CCTCAGAGGATTTATGTGGCAGG + Intronic
1089735524 11:120547971-120547993 ACTCAGAGGGTGGCTGTGGGAGG + Intronic
1090210856 11:124920407-124920429 CCTCCGAGGGAGGCTGTGGGAGG + Exonic
1090780659 11:130003354-130003376 CTTCGGAGGCAATCTGTGGCGGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1090963743 11:131580414-131580436 CCTCAGAGGGCAGGTGTGGCAGG - Intronic
1091014766 11:132040034-132040056 CTCCAGAGGGAGGCTGAGGCAGG - Intronic
1092039217 12:5368827-5368849 CTGCAGAGGGGGTCTGGGGCAGG - Intergenic
1092159170 12:6306421-6306443 CTTAAGAAGGATTCTGTGGCTGG - Intergenic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092808617 12:12251040-12251062 CCTACGAGGGAGGCTGAGGCAGG - Intronic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093390391 12:18612096-18612118 TGACTGAGGGAGTCTGTGGCTGG - Intronic
1093916528 12:24808546-24808568 GCTACGAGGGAGGCTGTGGCAGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094767905 12:33618913-33618935 CCTCAGTGGGACTCTGTGTGGGG - Intergenic
1095269847 12:40204811-40204833 CCTCAGAGGTACCCTGTGGACGG + Intronic
1095927428 12:47592854-47592876 TCTCACAGGGATTCTGTGCCAGG - Intergenic
1096665790 12:53163258-53163280 CCACAGTGGGAGTCTGAGGCAGG + Intronic
1096818420 12:54216141-54216163 CCTGAGTGGGGGTGTGTGGCGGG + Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1098548747 12:71739939-71739961 ACTCGGAGGGAGGCTGAGGCAGG - Intergenic
1099572959 12:84348518-84348540 CCTCAGACAGAAGCTGTGGCTGG + Intergenic
1100306540 12:93355062-93355084 GCACATAGGGAGGCTGTGGCAGG + Intergenic
1101552445 12:105775356-105775378 CCTCTGAGGGACTGAGTGGCTGG - Intergenic
1102050490 12:109858297-109858319 TCTCACAGGCAGTCTATGGCTGG + Intronic
1102151379 12:110690772-110690794 CCACAGAGTGAGACTGTTGCCGG - Intronic
1102530707 12:113544441-113544463 TCTCACAGTGAGTCTGTGGCTGG + Intergenic
1103239911 12:119404464-119404486 CCTGAGAGGGAGTTTGGGGGTGG + Intronic
1103767824 12:123294470-123294492 CTTCAGAAGTAGTCTGTGACGGG - Exonic
1103846012 12:123902517-123902539 CCTTAGAGGGTGGCTCTGGCTGG + Intronic
1104203055 12:126610359-126610381 CCTCACAGGGAGTCTGGAGGTGG - Intergenic
1106082742 13:26514102-26514124 CGTCAGAGGCAGTCAGGGGCTGG - Intergenic
1108030860 13:46228168-46228190 CCTCACAGGCAGTCTGTGATAGG + Exonic
1111795192 13:92910495-92910517 CCTCAGAGGAAGACTGAGGGAGG + Intergenic
1112160177 13:96859018-96859040 CCTAAGAGGGGCTCTGCGGCAGG - Intergenic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1113956997 13:114104373-114104395 CACCAGTGGGTGTCTGTGGCTGG - Intronic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114470550 14:22957993-22958015 GCTAATAGGGAGTCTGTGGTGGG - Intronic
1114665283 14:24374022-24374044 CCAGAGACAGAGTCTGTGGCAGG - Intronic
1114873772 14:26689817-26689839 TCTCAGAGGGAGTCTCTCGTGGG + Intergenic
1114873828 14:26690663-26690685 TCTCAGAGGGAGTCTGTCTTGGG + Intergenic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1115812332 14:37123457-37123479 AGTCAGAGGGAGTATCTGGCAGG - Intronic
1116326169 14:43535634-43535656 CCGCAGGGGGAGCCTGTGGCAGG - Intergenic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1117137194 14:52747743-52747765 CCTCAATGGGAGGCTGAGGCAGG + Intronic
1119207197 14:72803224-72803246 CCTGAGAGAGAGGCAGTGGCAGG - Intronic
1122071669 14:99209201-99209223 CCTCATTGTGACTCTGTGGCAGG - Intronic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1123106824 14:105845689-105845711 ACACAGTGGGAGTCTGAGGCTGG + Intergenic
1123667303 15:22617655-22617677 CATCAGAGGGGATCTGTGGCTGG + Intergenic
1124321145 15:28712222-28712244 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124481352 15:30083132-30083154 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124487807 15:30135228-30135250 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124522242 15:30414061-30414083 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124536423 15:30552157-30552179 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124542897 15:30604205-30604227 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124562858 15:30791651-30791673 CATCAGAGGGGATCTGTGGCTGG - Intergenic
1124597703 15:31104200-31104222 CCTCAGAGGGAATAAGAGGCCGG + Intronic
1124755721 15:32403093-32403115 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124762228 15:32455435-32455457 CATCAGAGGGGATCTGTGGCTGG + Intronic
1124776401 15:32593633-32593655 CATCAGAGGGGATCTGTGGCTGG - Intronic
1124960454 15:34389590-34389612 CGTCGGAGGGGATCTGTGGCTGG + Intronic
1124977083 15:34535811-34535833 CGTCGGAGGGGATCTGTGGCTGG + Intronic
1125479316 15:40069569-40069591 CCTCAGAGGCAGCCTGGGACAGG - Intergenic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126325576 15:47473361-47473383 CTTGAGAGAGGGTCTGTGGCTGG + Intronic
1126419051 15:48452172-48452194 TCTGAGAGGGATTCTGTGGAAGG + Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1127978823 15:64018902-64018924 CCTCAGAGGCAGTCAGCAGCAGG - Intronic
1128828806 15:70747353-70747375 CCTAAAAGGGAGGCTGAGGCGGG - Intronic
1129242768 15:74261433-74261455 CCCCAAAGGGAGTGTGGGGCAGG - Intronic
1129838232 15:78727292-78727314 CATCAAAGGGGATCTGTGGCTGG - Intronic
1130260359 15:82349240-82349262 CATCGGAGGGGATCTGTGGCTGG + Intronic
1130268370 15:82430193-82430215 CATCGGAGGGGATCTGTGGCTGG - Intronic
1130280873 15:82519767-82519789 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130472244 15:84235948-84235970 CATCGGAGGGGATCTGTGGCTGG - Intronic
1130479737 15:84350519-84350541 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130483872 15:84386952-84386974 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130492033 15:84437610-84437632 CATCGGAGGGGATCTGTGGCTGG + Intergenic
1130503650 15:84516650-84516672 CATCGGAGGGGATCTGTGGCTGG + Intergenic
1130594542 15:85240585-85240607 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1130893054 15:88149720-88149742 ACTCAGTGGGAGTGTGTGTCTGG - Intronic
1131455635 15:92580455-92580477 CAGCAGAGGGGGTCTGTGGCTGG - Intergenic
1132433994 15:101781888-101781910 CGTCAGAGGGGATCTGTGGTTGG + Intergenic
1133103573 16:3493529-3493551 CCTCTCAGGGAGGCGGTGGCGGG + Exonic
1133171659 16:3985819-3985841 CCAGAGGGGGAGGCTGTGGCAGG - Intronic
1133296894 16:4758311-4758333 CCTGAGAGGGAAGCTGTGTCTGG + Intronic
1135164722 16:20129099-20129121 CCTCAGCAGGACTCTGTGCCTGG + Intergenic
1135603651 16:23804325-23804347 TCTCTGAGGGGGTTTGTGGCAGG - Intergenic
1136424761 16:30162289-30162311 CCTCCTGGGGAGACTGTGGCAGG + Intergenic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1138168538 16:54826730-54826752 CCTCAGAGGGAGGTTGTGGATGG - Intergenic
1138812508 16:60167259-60167281 GCTACGAGGGAGGCTGTGGCAGG + Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139789891 16:69424985-69425007 CCTCAGAGGGAAACTGGGGTGGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1139953309 16:70682036-70682058 CCTCAGAGGGAGGCTCTGCCTGG + Intronic
1140679089 16:77366444-77366466 CCTAGTAGGGAGTCTGAGGCAGG + Intronic
1140825663 16:78703505-78703527 ACTCAGAGGGAGGCTGAAGCAGG + Intronic
1140991683 16:80219193-80219215 CATGAGAGGGACTCTGTGGGAGG + Intergenic
1141097465 16:81172948-81172970 CCACAGAGGGACTCTCTGGTAGG - Intergenic
1141669550 16:85484734-85484756 GCTGAGAGGGACTCTGTGCCAGG - Intergenic
1142698429 17:1645825-1645847 CCTGAGAGGGAGGGGGTGGCTGG + Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1143089489 17:4440573-4440595 CCTGAGGGGGAGCCTGTGGTCGG + Intronic
1143417051 17:6757936-6757958 CCACACAGGGAGTGTGGGGCAGG + Intronic
1143850689 17:9809471-9809493 CCTGAGAGGGTGGCTGTGGCGGG + Intronic
1145416658 17:22718881-22718903 GAGCAGAGGGAGTGTGTGGCTGG - Intergenic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1146654796 17:34628843-34628865 CCTCAGTGGGATCCTGGGGCTGG + Intronic
1147757843 17:42780406-42780428 CCTCAGAGTGAGACTGCGGCCGG + Intergenic
1149997591 17:61412915-61412937 CCTCCGAAGGGGGCTGTGGCTGG + Exonic
1150774994 17:68074153-68074175 ACTCAGGGGGAGGCTGAGGCAGG + Intergenic
1151554658 17:74840647-74840669 CCTGGGAGGAAGGCTGTGGCAGG - Intergenic
1151966681 17:77435163-77435185 GCTCAGAGGGAGGCTTGGGCAGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152207046 17:78979867-78979889 CTGCAGAGGGATCCTGTGGCTGG - Exonic
1152388205 17:79987681-79987703 CCGCAGAGGGAGGCTGTGGCTGG - Intronic
1152560417 17:81075835-81075857 CCTCATATGGAGCCTGTGGCTGG - Intronic
1152569489 17:81115444-81115466 CCTCACTGGGAGGTTGTGGCTGG + Intronic
1153532042 18:6056628-6056650 CCACAAAGCGAGTTTGTGGCTGG + Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155902702 18:31411017-31411039 ACACAGAGGGAGTCAGTGGTGGG - Intronic
1156296597 18:35797400-35797422 CCTTAGAGGGAGACTGTGTTGGG + Intergenic
1156458683 18:37309029-37309051 CCTCAGAGAGGGTCTGAGGCTGG - Intronic
1157485155 18:48081568-48081590 ACTTAGAGGGAGGCTGAGGCAGG - Intronic
1157501087 18:48191215-48191237 CCTCAGTGAGTGTCTGTGGCTGG + Intronic
1157905206 18:51563525-51563547 CCTCACAGGAAGTGTTTGGCAGG + Intergenic
1160059746 18:75518182-75518204 CCTCAGGGTGAGACTGTGGGTGG + Intergenic
1160144724 18:76354266-76354288 GCTAAGAGGAAGTCTGTGACTGG - Intergenic
1160371267 18:78373611-78373633 CCTCAAAGGGAATCAGTGTCTGG - Intergenic
1160948572 19:1654791-1654813 GGTCTGAGGGTGTCTGTGGCCGG + Intergenic
1161327687 19:3671410-3671432 CCACAGAGGGAAACTGAGGCAGG - Intronic
1161349746 19:3785139-3785161 CCCCAGAGGGAAACTGAGGCAGG + Intronic
1162399366 19:10435624-10435646 CCTAAGAGGGAGTCTTGGGCGGG + Intronic
1162600034 19:11661861-11661883 CCCCAGAGGGAGGCTGAGGCGGG - Intergenic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1163402958 19:17105381-17105403 CCTACGTGGGAGTCTGAGGCAGG + Intronic
1163553683 19:17980792-17980814 CCTCAGGAGGAGACTGAGGCAGG + Intronic
1164006376 19:21153392-21153414 CCTCTGACAGAGTCTGTGTCTGG + Intronic
1164148926 19:22532286-22532308 CATCAGAGGGATTCTGGGGCTGG + Intronic
1164501003 19:28820321-28820343 CCTCACAGGGAGGCTGAGGCTGG + Intergenic
1164648626 19:29876261-29876283 CCACAGATAGAGTCTGTGGAGGG + Intergenic
1164753056 19:30670222-30670244 TCTCAGAGGAAGCCTGAGGCTGG - Intronic
1165073714 19:33269548-33269570 ACTCAGGGGGAGCCTGTGGTGGG + Intergenic
1165796268 19:38521582-38521604 CCTGAGTGGGAGGCTGAGGCAGG + Intronic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1166443753 19:42840038-42840060 CCTCTGAGGGAATGTGGGGCAGG - Intronic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168543771 19:57233401-57233423 CCTCAGACGGAAATTGTGGCAGG + Intronic
1202648780 1_KI270706v1_random:162524-162546 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925438644 2:3864992-3865014 TCTCCAAGGGAGTGTGTGGCAGG + Intergenic
926637027 2:15191875-15191897 CCTCAAAGGGACCCTGAGGCTGG - Intronic
927327144 2:21818251-21818273 CCTCTGAGGGAGTTGGTGTCAGG - Intergenic
927911323 2:26901948-26901970 CCTCTGAAAGAGGCTGTGGCAGG + Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928335974 2:30398527-30398549 CCTCAGAGGCAGTCTAAGGCAGG + Intergenic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
932396811 2:71454248-71454270 ACTCAGAGGGAAACTGAGGCTGG + Intronic
934650763 2:96090118-96090140 CCTGAGAGAGGGGCTGTGGCAGG + Intergenic
934883830 2:98007377-98007399 CCTGAGAAGGGGGCTGTGGCTGG + Intergenic
934900503 2:98156026-98156048 CCTCAGAATGAGTCTGGGGTGGG + Intronic
935611689 2:105032287-105032309 TGTCAGAGTGATTCTGTGGCAGG + Intergenic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935636653 2:105254318-105254340 CCTCACAGGCAGGCTGTGTCAGG + Intergenic
937040869 2:118819711-118819733 CCTCTGAGGGTGTATCTGGCTGG - Intergenic
937245215 2:120488123-120488145 CCTCAGAGGGAGGGTGGGCCTGG - Intergenic
937944410 2:127319262-127319284 CCTGAGAGAGAGGCTGAGGCTGG + Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942393823 2:175524892-175524914 ACACAAAGTGAGTCTGTGGCTGG - Intergenic
943489273 2:188530240-188530262 CCTCAGAATGAGACTGTGGTTGG - Intronic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
945208774 2:207360428-207360450 CCTCTGATGAAGTTTGTGGCGGG - Intergenic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
946412361 2:219521704-219521726 ACTCAGAGGCAGCCTGAGGCCGG - Intronic
947463650 2:230323519-230323541 GCTCACAGTGTGTCTGTGGCAGG + Intergenic
948212897 2:236208193-236208215 CCACAGAGGGAGTGCCTGGCAGG + Intronic
948742961 2:240060249-240060271 CCTCAGAGGGTGTGTGTGTGGGG + Intergenic
1168912671 20:1462245-1462267 CCTCAGAGGAATTCTGTGTGGGG - Intronic
1168927084 20:1590735-1590757 CCGCACAGTGAGGCTGTGGCAGG + Intronic
1168935284 20:1659818-1659840 CCTCATAGTGAGGCTGGGGCAGG + Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1169858239 20:10126236-10126258 CCCCACAGGGACTCTGTGGTGGG + Intergenic
1170935392 20:20805162-20805184 CCTCGGAGGGAGTGTTTAGCAGG - Intergenic
1171382216 20:24742508-24742530 TCTCAGAGGGAGACTTTGGCAGG + Intergenic
1173226308 20:41164195-41164217 CCTCAGAGTGAGTCGGAGGCTGG + Exonic
1173791799 20:45832893-45832915 CCTCTGAGGGAGGCAGAGGCAGG + Intronic
1173839006 20:46144818-46144840 CCTCAGAAGGTGGGTGTGGCTGG + Intergenic
1174195052 20:48767057-48767079 TCCCACAGCGAGTCTGTGGCAGG - Intronic
1174798117 20:53539580-53539602 TCTCTGGAGGAGTCTGTGGCCGG - Intergenic
1175145561 20:56893466-56893488 GCTCACAGGAAGGCTGTGGCAGG - Intergenic
1175303016 20:57956314-57956336 CCTGGGAAGGAGACTGTGGCAGG - Intergenic
1175408253 20:58749251-58749273 CCTCAAAGGGTGTGGGTGGCTGG + Intergenic
1175564694 20:59963933-59963955 CCTCAGCTTGGGTCTGTGGCAGG - Intronic
1176125704 20:63473560-63473582 CCCCAGAAGGGGCCTGTGGCAGG + Intergenic
1176160113 20:63643391-63643413 CCTACTAGGGAGTCTGAGGCAGG - Intronic
1176255049 20:64147300-64147322 CATCTGAGGGAGGCTGCGGCTGG - Intergenic
1176603038 21:8810017-8810039 CTTCAGCGGGAGTCCGTTGCAGG + Intergenic
1178702408 21:34844800-34844822 CCTCAGTTGGCGTCTGTGACAGG - Intronic
1180070261 21:45432293-45432315 TCTCAGTGAGAGTCTGTGGCAGG + Intronic
1180080297 21:45483585-45483607 CCTCCGGGGGCGTCTGTGGTGGG - Intronic
1180345324 22:11701574-11701596 CTTCAGCGGGAGTCCGTTGCAGG + Intergenic
1180345374 22:11701865-11701887 CTTCAGAGGGAGTCCGTTCCAGG + Intergenic
1180352344 22:11815447-11815469 CTTCAGCGGGAGTCAGTGCCAGG - Intergenic
1180352392 22:11815738-11815760 CTTCAGCGGGAGTCAGTGCCAGG - Intergenic
1180385814 22:12176328-12176350 CTTCAGCGGGAGTCCGTTGCAGG + Intergenic
1181426459 22:22845138-22845160 CCTCACTGTGAGTCTGTGTCAGG - Intronic
1181493992 22:23277741-23277763 CCACAGTGGGGGTCTGGGGCTGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181697570 22:24601621-24601643 TCTCAGAGGGACTGTGTGGCTGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182558474 22:31141532-31141554 ACTCAGATGGAGCCTGGGGCAGG - Intergenic
1182619291 22:31609985-31610007 CCTTAGAGGGAGGCGGTGGCAGG + Intronic
1183535648 22:38398988-38399010 CCGGAGGCGGAGTCTGTGGCGGG - Intergenic
1184158605 22:42684938-42684960 TCTCACAGGGAGTTTGTGGCCGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184450728 22:44580993-44581015 CCACACAGGGACTCTGTGTCAGG - Intergenic
949359546 3:3216984-3217006 CCTCACAGGGAGGCAGTTGCGGG - Intergenic
950158804 3:10743635-10743657 CCCTAGAGGGAGACTGAGGCTGG + Intergenic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
951409336 3:22343407-22343429 CCTCAGTAGGGGTCTCTGGCTGG - Intronic
953234650 3:41095603-41095625 CCTCAGAGCAAGTCTGCAGCGGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954685868 3:52369870-52369892 CCACAGCGGGAGACTGTAGCTGG - Exonic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
956027033 3:64993959-64993981 ACTCAGAGGCAGTCTGCAGCTGG + Intergenic
956707440 3:72011509-72011531 CCACCCAGGGAGTCTGTGGCTGG - Intergenic
957417998 3:79930249-79930271 GCTCTGAGTGAGGCTGTGGCTGG - Intergenic
959152051 3:102619434-102619456 ACTCAGAGGAAGTTTGTTGCAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960619550 3:119625381-119625403 CCTCAGCATGTGTCTGTGGCTGG - Intronic
960662736 3:120078796-120078818 TCCCAGAGGGAGGCTGAGGCTGG - Intronic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
962032483 3:131615974-131615996 CCTCAGAAGGGGGCTGTGGCGGG - Intronic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964655577 3:159062976-159062998 CCTAAGAGGGACTCTGTGTATGG - Intronic
964879791 3:161410710-161410732 CCTCAGAGGGAGAGAGTGGGAGG + Intergenic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
968181878 3:196601396-196601418 CCTCAGTGTGAGACTGTGTCTGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG + Intergenic
971996499 4:33972325-33972347 CCTCAGAATGAGTCTGGGGAAGG + Intergenic
972548822 4:40108422-40108444 ACTCAGGGGGAGGCTGAGGCAGG - Intronic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
972792642 4:42387635-42387657 CCTCTGAAGAAGTCTGTGGTTGG - Intergenic
973283653 4:48390184-48390206 ACTAAGAGGGAGGCTGAGGCAGG - Intronic
973328168 4:48885095-48885117 ACTGAGAGGGAGGCTGAGGCAGG - Exonic
973374986 4:49280343-49280365 CTTCAGTGGGAGTCCGTTGCAGG - Intergenic
973375885 4:49286365-49286387 CTTCAGTGGGAGTCCGTTGCAGG - Intergenic
973381338 4:49322853-49322875 CTTCAGCGGGAGTCCGTTGCAGG + Intergenic
973381527 4:49323876-49323898 CTTCAGTGGGAGTCCGTTGCAGG + Intergenic
973382425 4:49329898-49329920 CTTCAGTGGGAGTCCGTTGCAGG + Intergenic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
976753288 4:88472105-88472127 CCACAGAGGGAGGCTGAGACAGG - Intronic
977048746 4:92099932-92099954 CCTCAGAGGGAATCAGTGTCAGG + Intergenic
977780816 4:100978643-100978665 TCTTAGAGGGAGCCTATGGCTGG - Intergenic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
981021283 4:140031442-140031464 ACTCAGAGGAAGTTTGTGACTGG + Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982596300 4:157389121-157389143 CTTCAGAGGAACTCTGCGGCTGG - Intergenic
983026500 4:162743869-162743891 ACTCAGTGGGAGGCTGAGGCAGG + Intergenic
983661907 4:170137224-170137246 CCTCAGGGGGAATCTCAGGCTGG - Intergenic
983713958 4:170754587-170754609 CCTCAGCAGAAGTCTGTTGCAGG + Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
985666106 5:1182258-1182280 CCTCTTAGGGAGGCTGAGGCAGG - Intergenic
985776541 5:1847173-1847195 CCTCACAGGGAGTGCGGGGCAGG - Intergenic
986017287 5:3768408-3768430 CCTCAGATGGAGCATGTGTCTGG - Intergenic
988687036 5:33535419-33535441 CCTTAGATGGAATCTCTGGCTGG - Intronic
988785779 5:34564454-34564476 TCTCTTAGGGAGTCTGTGGAGGG - Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
993186675 5:84630633-84630655 GCACAGGGGGAGCCTGTGGCAGG + Intergenic
995807612 5:116070922-116070944 CCTCAAAGGGAGGCTTTGGGTGG + Intergenic
996770460 5:127080292-127080314 CCTCAGAGACAGGCTGGGGCAGG + Intergenic
997234359 5:132264149-132264171 CCTCAGAGGGGGCCTGAGTCAGG + Intronic
997383398 5:133453653-133453675 CCTCCTAGTGGGTCTGTGGCTGG + Intronic
997531265 5:134582694-134582716 CCTCTGAGGGAGAAAGTGGCAGG - Exonic
998137340 5:139681094-139681116 CCTGACATGGAGGCTGTGGCAGG + Exonic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998882191 5:146655610-146655632 GCTCACAGTGAGTCTGAGGCAGG + Intronic
999426183 5:151489513-151489535 CCACAGAGGCAGTGTGGGGCCGG - Exonic
1002344432 5:178537517-178537539 CCTCAGAGGGAGTCTGTGGCAGG + Intronic
1002611444 5:180421134-180421156 ACTCAGCGGGAGGCTGAGGCAGG + Intergenic
1004027275 6:11831495-11831517 CCCCAGTGGGAGTATGTTGCAGG + Intergenic
1004314983 6:14578892-14578914 CCTCACAGGGCATCTGGGGCAGG - Intergenic
1006055000 6:31377691-31377713 CCTCAGCGGGAGGCTGCAGCAGG - Intergenic
1006294597 6:33164522-33164544 CCTCAGAGGGAGACAGAGACGGG + Intronic
1006439979 6:34047897-34047919 CTTCAAAAGGAGCCTGTGGCTGG - Intronic
1006841093 6:37028214-37028236 CCACAGGGTCAGTCTGTGGCAGG - Exonic
1007252094 6:40502704-40502726 CCTCAGAGAGTTTCTGTGGGTGG + Intronic
1007321796 6:41033147-41033169 CTGCAGAGGGAGCCAGTGGCAGG + Intronic
1007353706 6:41294603-41294625 CCACAGAGGGAGGGTGTGGTGGG - Intergenic
1007724550 6:43907178-43907200 GCTCTGAGGGAGGCTGTGGGAGG - Intergenic
1007741452 6:44012342-44012364 CCTCAGAGGTGGTTTGTGGTGGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1010530982 6:76966947-76966969 CCTCATAGGGACTCTGTGTGGGG - Intergenic
1011029459 6:82905947-82905969 CTTCAGAAGAGGTCTGTGGCAGG - Intronic
1011498418 6:87961664-87961686 CATCATAGGGAGACTGTGCCTGG - Intergenic
1011950587 6:92959322-92959344 CCCAAGAGGGAGTCTGTGTAGGG + Intergenic
1012446483 6:99312182-99312204 CCTCAGCTGGACTCTGTGCCAGG - Intronic
1018255399 6:161913060-161913082 CCTCCCAGGGAGGCTGAGGCAGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018540161 6:164870963-164870985 CATCAGGGTGAATCTGTGGCTGG - Intergenic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019499556 7:1358193-1358215 CCTGTGAGGGAGTGTGGGGCCGG - Intergenic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1020224432 7:6269018-6269040 CCTCAGGGAGTGTCTCTGGCAGG - Intronic
1021501386 7:21335779-21335801 CCCCAGTGGGAGTCAGTGCCGGG - Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1023752352 7:43384762-43384784 CGTGAGAGGGAGTGGGTGGCTGG + Intronic
1023876760 7:44290400-44290422 CCTGAGAGTGCTTCTGTGGCCGG - Intronic
1023918572 7:44608607-44608629 CCTCAGCAGGAGGCTGAGGCAGG + Intronic
1024233416 7:47379997-47380019 CCAGAGAGGCAGTGTGTGGCTGG - Intronic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026262909 7:68771193-68771215 CCTTAAAGGGAGGCTGAGGCAGG + Intergenic
1026316269 7:69230413-69230435 CCTCAGTGGGAGACTGAGGTGGG - Intergenic
1026405994 7:70065952-70065974 CCTGAGAAGGAGGCTGAGGCAGG - Intronic
1026921446 7:74158573-74158595 ACTAGGAGGGAGTCTGAGGCAGG - Intergenic
1028129456 7:87152738-87152760 CCTAAGAGGGAGGCCCTGGCCGG - Exonic
1028968238 7:96827162-96827184 CCTCAGAATGTGACTGTGGCTGG - Intergenic
1029519324 7:101050217-101050239 CCACAAAGGGAGTCTCTGGTAGG - Intronic
1029941157 7:104482059-104482081 CCTCAGAGGTGGCCTGTGACTGG + Intronic
1030090085 7:105850749-105850771 CCTGAGAGGGACTCTCTTGCAGG - Intronic
1032239937 7:130152928-130152950 CCTGCGTGGGAGTCTGTGACGGG + Intergenic
1033135763 7:138782745-138782767 ACTCAGAGAAAGTCAGTGGCTGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033641743 7:143268361-143268383 CCTCAGTGGGAGGCTGAGGCAGG + Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035313395 7:157983603-157983625 CCTGGGAGTGAGTCTGAGGCAGG + Intronic
1036079554 8:5540252-5540274 CCTCAGAGAGGATCTGTGGTCGG + Intergenic
1036382764 8:8248614-8248636 ACTCACAGGGAGGCTGAGGCAGG + Intergenic
1037756554 8:21713790-21713812 CCTCCCAGGGATTCTGAGGCAGG + Intronic
1037765518 8:21770091-21770113 GCTCAGAGGGAGTCTTGGGTGGG - Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039386192 8:37137831-37137853 GCTCAGGGGGAGTCTCTGGATGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040311845 8:46240854-46240876 ACTCAGAGGGACACTGAGGCAGG + Intergenic
1040319829 8:46286911-46286933 CCTCAGAGGGACATTGAGGCAGG - Intergenic
1040325355 8:46338816-46338838 CCTCAGTGGGACACTGAGGCAGG + Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042071040 8:64934115-64934137 CATCAGTGGTTGTCTGTGGCTGG - Intergenic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1048359879 8:133688597-133688619 CCTCAGAGGGGGGCCATGGCAGG + Intergenic
1049330556 8:142048295-142048317 CCACAGTGGGAGTCTGAGGATGG + Intergenic
1049498203 8:142946610-142946632 CCTCCGAGTGAGACTGTGTCTGG - Intergenic
1049679791 8:143913052-143913074 CCTCAGAGGGTCCCTGTGACTGG + Intergenic
1050550989 9:6748052-6748074 CCTATGAGGGAGGCTGAGGCAGG + Intronic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1052017521 9:23486506-23486528 CCTCAAAGGAAATCTGTGTCAGG + Intergenic
1052760699 9:32588120-32588142 AGTCAGAGGCAGGCTGTGGCTGG - Intergenic
1053462766 9:38283160-38283182 CCACAGAGAGAGTCAGCGGCAGG - Intergenic
1059154435 9:111977283-111977305 CCTAAGTGGGAGGCTGAGGCAGG + Intergenic
1059978187 9:119740512-119740534 GCTGAGATGAAGTCTGTGGCTGG + Intergenic
1061284751 9:129615708-129615730 TCTCACAGCGAGTCTGGGGCTGG - Intronic
1062002835 9:134225425-134225447 AGTCAGAAGGAGTCTGAGGCAGG + Intergenic
1062017435 9:134297831-134297853 CCTCATGGGGAGGCTGAGGCTGG + Intergenic
1062379459 9:136280317-136280339 GCTCAGAGGGTGTGTGTGGAAGG + Intergenic
1203698710 Un_GL000214v1:118592-118614 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1203699660 Un_GL000214v1:124890-124912 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1203480359 Un_GL000224v1:5776-5798 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1203481326 Un_GL000224v1:12104-12126 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1203482290 Un_GL000224v1:18413-18435 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1203548876 Un_KI270743v1:152277-152299 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1203549569 Un_KI270743v1:156272-156294 CTTCAGCGGGAGTCCGTTGCAGG + Intergenic
1203569950 Un_KI270744v1:121127-121149 CTTCAGCGGGAGTCCGTTGCAGG - Intergenic
1186372271 X:8959422-8959444 CCTGCTAGGGTGTCTGTGGCTGG - Intergenic
1186917037 X:14234052-14234074 CCACAGAGGGTCTCTGTGGAAGG - Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1188543009 X:31270314-31270336 CCCCAGAGGGTGGCTTTGGCTGG - Intronic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190215703 X:48478265-48478287 ACTCAGAGGGTCTCTGGGGCAGG + Intronic
1190297699 X:49038280-49038302 CCTCAGGGGCAGGCAGTGGCTGG + Exonic
1192170364 X:68851063-68851085 GATCAGAGGGACTCTGGGGCGGG + Intergenic
1193233256 X:79074230-79074252 GCTCTGAGGGAGGCTGAGGCAGG + Intergenic
1194800973 X:98272219-98272241 CTTTAGTGGGTGTCTGTGGCTGG - Intergenic
1197858337 X:130942992-130943014 GCTCATACTGAGTCTGTGGCAGG - Intergenic
1201374753 Y:13306810-13306832 CATCGGAGGGAGACTGAGGCAGG - Intronic
1202366303 Y:24168300-24168322 CATCGGAGGGGATCTGTGGCTGG - Intergenic
1202374202 Y:24218344-24218366 CATCAGAGGGGATCTGTGGCTGG + Intergenic
1202496579 Y:25451776-25451798 CATCAGAGGGGATCTGTGGCTGG - Intergenic
1202504478 Y:25501823-25501845 CATCGGAGGGGATCTGTGGCTGG + Intergenic