ID: 1002344532

View in Genome Browser
Species Human (GRCh38)
Location 5:178538190-178538212
Sequence GAGGGCTCGTTTACCGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002344521_1002344532 5 Left 1002344521 5:178538162-178538184 CCTCCCTCCTCCTCACACAAGAG 0: 1
1: 0
2: 3
3: 37
4: 474
Right 1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1002344526_1002344532 -5 Left 1002344526 5:178538172-178538194 CCTCACACAAGAGCCCCAGAGGG 0: 1
1: 0
2: 3
3: 26
4: 278
Right 1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1002344522_1002344532 2 Left 1002344522 5:178538165-178538187 CCCTCCTCCTCACACAAGAGCCC 0: 1
1: 0
2: 4
3: 50
4: 346
Right 1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1002344523_1002344532 1 Left 1002344523 5:178538166-178538188 CCTCCTCCTCACACAAGAGCCCC 0: 1
1: 0
2: 4
3: 62
4: 416
Right 1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 32
1002344524_1002344532 -2 Left 1002344524 5:178538169-178538191 CCTCCTCACACAAGAGCCCCAGA 0: 1
1: 0
2: 0
3: 20
4: 213
Right 1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002344532 Original CRISPR GAGGGCTCGTTTACCGCTCA GGG Intronic
907494841 1:54836767-54836789 CCAGGCTCGTTTACCCCTCACGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1065251187 10:23816135-23816157 GAGGGGACCTTTACAGCTCAAGG - Intronic
1068731416 10:60362783-60362805 GAGGGCTCCATCACCGCCCATGG - Intronic
1069474651 10:68721662-68721684 CTGGGCTCGTTTACCACGCACGG - Intronic
1075978439 10:126717016-126717038 GAGGGCTAGTTCACTGCTAATGG - Intergenic
1089587520 11:119519861-119519883 GAGGGCTGGGATACAGCTCAGGG + Intergenic
1090358410 11:126156052-126156074 GCGGGCTCGTGTCCAGCTCATGG + Intergenic
1091611610 12:2015134-2015156 AAGGGCTAGTTTACCAGTCAGGG + Intronic
1105319878 13:19308859-19308881 GAGCTCTCGTTTACTGCTGATGG + Intergenic
1121051643 14:90822752-90822774 GAAGGCTAGTTGGCCGCTCAGGG + Intergenic
1123165298 14:106320054-106320076 GAGGGCTCATGTATCGCTGATGG + Intergenic
1135200143 16:20430284-20430306 GAGGGCTGGTTTGCTGGTCATGG - Intronic
1135218542 16:20593311-20593333 GAGGGCTGGTTTGCTGGTCATGG + Intergenic
1143324171 17:6087662-6087684 GAAGGCTGGATTACCTCTCATGG - Intronic
1153973239 18:10245448-10245470 GTTGGCTTGTTTACCCCTCAGGG + Intergenic
1156822092 18:41385290-41385312 GTGGGCTACTTTAACGCTCAGGG + Intergenic
1167846096 19:52165721-52165743 GAGGGCTGCTTTGCAGCTCAGGG - Intronic
942845924 2:180425206-180425228 GAGGGCTCTTGTACCTCCCATGG - Intergenic
1175986124 20:62764928-62764950 GAGGGCCCGGGTACCGCTCTGGG - Intergenic
1184346785 22:43918462-43918484 AAGGGCTTATTTACCGGTCATGG - Intergenic
952979452 3:38723154-38723176 GAGGGCTGGTTTAGAACTCACGG + Intronic
988798116 5:34671225-34671247 AAGGGCTAGTTTACCACTCAGGG - Intronic
994026998 5:95095933-95095955 GAGGTCTCGTTTCCCCCTCAGGG - Intronic
996772354 5:127098612-127098634 GAGGGCCTGTTTACCCCTCCGGG + Intergenic
1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG + Intronic
1017153893 6:151305844-151305866 TAGGGCTCCTTGACCGTTCAGGG - Exonic
1020027752 7:4911131-4911153 CAGGCCTGGCTTACCGCTCATGG + Exonic
1022132760 7:27419083-27419105 GAGGGCTTGCTTACGGCTCCTGG - Intergenic
1033453505 7:141482234-141482256 GAGGGCTTGGTTACGGCTCTTGG - Intergenic
1035776986 8:2195955-2195977 GAGGAGATGTTTACCGCTCATGG + Intergenic
1059655068 9:116350189-116350211 GAGGGCTATTATACTGCTCATGG - Intronic
1061572789 9:131488002-131488024 CAGGGCTTGGTTCCCGCTCATGG - Exonic
1186507716 X:10107029-10107051 GATGGCTCGTTTCCGGCCCACGG + Intronic
1186685308 X:11919264-11919286 GAGGGCAAGTTTGCCTCTCAGGG - Intergenic