ID: 1002346900

View in Genome Browser
Species Human (GRCh38)
Location 5:178554467-178554489
Sequence CACACCAGGAGGGCTGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 480}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002346900_1002346911 24 Left 1002346900 5:178554467-178554489 CCACGCCCAGCCCTCCTGGTGTG 0: 1
1: 0
2: 4
3: 37
4: 480
Right 1002346911 5:178554514-178554536 TTACACCTTTGCAAACCACCTGG 0: 1
1: 0
2: 2
3: 9
4: 147
1002346900_1002346907 1 Left 1002346900 5:178554467-178554489 CCACGCCCAGCCCTCCTGGTGTG 0: 1
1: 0
2: 4
3: 37
4: 480
Right 1002346907 5:178554491-178554513 TTTAAGTGGAGCCAACCCTTTGG 0: 1
1: 0
2: 2
3: 4
4: 95
1002346900_1002346912 27 Left 1002346900 5:178554467-178554489 CCACGCCCAGCCCTCCTGGTGTG 0: 1
1: 0
2: 4
3: 37
4: 480
Right 1002346912 5:178554517-178554539 CACCTTTGCAAACCACCTGGCGG 0: 1
1: 0
2: 1
3: 21
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002346900 Original CRISPR CACACCAGGAGGGCTGGGCG TGG (reversed) Intronic
900540134 1:3198503-3198525 CCCACCTGGAGTGCTTGGCGTGG + Intronic
900621849 1:3591144-3591166 CATGCGAGGAGGGCGGGGCGCGG - Intronic
900923437 1:5688309-5688331 CTCACCATGGGGGCTGGCCGTGG - Intergenic
901103529 1:6737642-6737664 GACACCAGGTGGGCGGGGAGGGG + Intergenic
902224561 1:14988450-14988472 CCCTCCAGCAGGGCTGGGCCGGG - Intronic
902237395 1:15066331-15066353 CACACCAGGGGGGCGGGAGGGGG - Intronic
902451318 1:16498771-16498793 CACACTAGGAGGGCAGTGCAGGG + Intergenic
902501554 1:16914511-16914533 CACACGAGGAGGGCAGTGCAGGG - Intronic
902685384 1:18073386-18073408 TTCACCAGGAAGGCTGGGGGAGG - Intergenic
903886646 1:26544762-26544784 CCCAACAGGCAGGCTGGGCGTGG - Intronic
905546445 1:38804087-38804109 CACAGCGGGAGGGTGGGGCGTGG - Intergenic
905671039 1:39789908-39789930 CACAGCAGTAGAGCTGGGCTGGG + Intergenic
906310603 1:44751484-44751506 TACAAAAAGAGGGCTGGGCGAGG - Intronic
906717258 1:47979495-47979517 CCCACCAAGGGGGCTGAGCGAGG + Intronic
907323556 1:53620664-53620686 TAAACAAGGAGGGCTGGGGGTGG + Intronic
909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG + Intergenic
910929353 1:92427665-92427687 ACCACCATGAGGGCCGGGCGCGG + Intergenic
911076512 1:93880492-93880514 AAGATCAGGAGGGCTGGGCGAGG - Intergenic
912349404 1:108997464-108997486 GAAAGAAGGAGGGCTGGGCGCGG + Intronic
912917863 1:113835226-113835248 CTCAAAAGTAGGGCTGGGCGCGG + Intronic
914233051 1:145782193-145782215 AAAACAAGGAAGGCTGGGCGTGG - Intronic
915044488 1:153000515-153000537 CACACCAGGAGGCCTGGCACAGG + Intergenic
915359050 1:155274578-155274600 AAGAACAGGAAGGCTGGGCGAGG + Intronic
915428791 1:155849253-155849275 AAAACCAGCAGGGCTGGGCACGG + Intronic
915727144 1:158025899-158025921 CCCAGCAGAAGGGCTGGGGGAGG + Intronic
916148310 1:161761311-161761333 TACTCCAGGAAGGCTGGGCAAGG + Intergenic
916528094 1:165630657-165630679 CCCACCACGAGGGCAGGGCTCGG + Intergenic
917692924 1:177487570-177487592 CACAGCAGTAGGACTGGGCTAGG - Intergenic
917851442 1:179068051-179068073 TACACCAGGATGGTCGGGCGCGG - Intronic
917870564 1:179238261-179238283 AAGACCAGCAAGGCTGGGCGCGG - Intergenic
918042287 1:180920692-180920714 CACAGCAGGCAGGCTGGGGGCGG + Intronic
920020104 1:202949288-202949310 CGCACCCAGAGGGCCGGGCGCGG + Intronic
920190444 1:204190488-204190510 CACGGCAGAAGCGCTGGGCGGGG - Exonic
920546577 1:206823261-206823283 GACACCAAGATGGCTGGGTGTGG + Intronic
922506997 1:226132427-226132449 CCCAGAAAGAGGGCTGGGCGTGG + Intergenic
923585207 1:235263696-235263718 TGCAGAAGGAGGGCTGGGCGCGG + Intronic
924544813 1:245016484-245016506 GACACGAGGAGTGCTGGGCGTGG - Intronic
1063301033 10:4849000-4849022 CACATCTGGAAGGCTGGGCAGGG - Intergenic
1064266240 10:13827803-13827825 CACGCCAGGAGGAGTGGGAGAGG + Intronic
1067755147 10:48999650-48999672 CACACCAGGAAGGCGGTGAGGGG + Intergenic
1068132829 10:52916088-52916110 CACTCCTGGAGGGGTGGGAGTGG + Intergenic
1069158146 10:65054233-65054255 CCCACCAGGAGTCCCGGGCGGGG + Intergenic
1070739996 10:78896623-78896645 CACATCAGCAGGTCTGGGTGGGG - Intergenic
1070825263 10:79386996-79387018 CACACAAGCAGGGCTGCGAGTGG - Intronic
1070889390 10:79930753-79930775 CACATCAGGAGCTCTGGGCAGGG - Intergenic
1071437484 10:85660725-85660747 CACACCAGGAGTCCAGGGCCTGG + Intronic
1072670553 10:97426142-97426164 CACACCTGGAGGGCGGAGAGCGG + Exonic
1073288349 10:102401501-102401523 CTCACCTGCTGGGCTGGGCGGGG - Exonic
1074617231 10:115081425-115081447 CACAGCTGCAGGGCCGGGCGCGG + Intergenic
1076381671 10:130028035-130028057 CTCAGCAGGAGGGCCTGGCGAGG + Intergenic
1076425821 10:130366944-130366966 GCCACCAGGAAGGCTGGGGGAGG + Intergenic
1076731001 10:132438830-132438852 CAGACCAGGGGTGCTGGGCTGGG - Intergenic
1077106599 11:844943-844965 GGGACCAGGAGGGCTGGGAGGGG + Intronic
1077539188 11:3138695-3138717 CTCACCAGGAGGGCCAGGCAAGG - Intronic
1078090790 11:8263229-8263251 CACACCTGCTGGGCTGTGCGGGG - Intronic
1078267233 11:9764383-9764405 CAAACCAGGAGGGCTTGCCAGGG - Intergenic
1079688911 11:23398145-23398167 CACACCATGAGGCCTTTGCGGGG - Intergenic
1080494976 11:32808346-32808368 CAGGCCATGTGGGCTGGGCGCGG + Intergenic
1083461466 11:62815294-62815316 CACACCCGGTTGGCTGGGCATGG - Intronic
1084424384 11:69076708-69076730 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084424391 11:69076733-69076755 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084424451 11:69076932-69076954 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084424569 11:69077314-69077336 CACAGCAGGAGGGCAGGTGGAGG - Intronic
1084434140 11:69128548-69128570 ACCACAATGAGGGCTGGGCGTGG + Intergenic
1084518081 11:69647082-69647104 CACCCCTGGAGGACTGGGCCGGG - Intronic
1084649443 11:70480148-70480170 CAGATGAGGAGGGCTGGGCAGGG - Intronic
1084688068 11:70708918-70708940 TACACAAGAAGGGCAGGGCGTGG + Intronic
1085293012 11:75413544-75413566 TATACAAGAAGGGCTGGGCGCGG - Intronic
1085387909 11:76167718-76167740 CACAGCTGGAGGCCTGGCCGGGG + Intergenic
1085584228 11:77686127-77686149 AACAGCAGGATGGCTGGGTGTGG + Intronic
1086119092 11:83286956-83286978 AACACTGGGATGGCTGGGCGTGG + Intergenic
1086773172 11:90794867-90794889 GACAACAGGAGGGCTGAGCCAGG + Intergenic
1087095509 11:94313847-94313869 AACATCTGGAGGGCCGGGCGCGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1088611566 11:111582423-111582445 CACACCAGCAAGGCTGGCCAAGG + Intergenic
1089168034 11:116492841-116492863 CACTCCAGAAGGACTGGGGGAGG + Intergenic
1089365657 11:117919481-117919503 CACCCCAGGAGGGAAGGGCAGGG - Intronic
1089617965 11:119705867-119705889 CTCACCTGGAGGGGTGGGAGAGG - Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1090785701 11:130045392-130045414 ACCACCAGCATGGCTGGGCGTGG - Intergenic
1091737452 12:2934583-2934605 GACACCAGGAGGGCAGGCAGCGG - Intronic
1091740709 12:2959097-2959119 CCCGCCAGGAGGGGAGGGCGCGG + Intergenic
1091849442 12:3683402-3683424 CACACCTGGAAGGGTGGGCCAGG + Intronic
1092219823 12:6705357-6705379 GACAGGAGGAGGGCCGGGCGCGG - Intergenic
1092407838 12:8233400-8233422 CACAGGAGGCTGGCTGGGCGTGG - Intergenic
1093938969 12:25031950-25031972 CACACAAGGACGGCTGGGCGTGG - Intronic
1096262875 12:50103936-50103958 CACCCCTGGAGGGCGGGGCTTGG + Exonic
1097250322 12:57628931-57628953 CAGACAAGGAGGGTTGGGAGAGG + Intronic
1097781317 12:63708314-63708336 CCAGGCAGGAGGGCTGGGCGCGG + Intergenic
1097820254 12:64121296-64121318 GACACAAGGAAGGCGGGGCGTGG - Intronic
1098785040 12:74742983-74743005 AAAACCATGAGGGCCGGGCGCGG + Intergenic
1100390956 12:94146517-94146539 CATTCCAGGAGGGCAGGGAGTGG + Intergenic
1100656307 12:96649458-96649480 CACACCAGGAGGGGAATGCGTGG + Intronic
1100858045 12:98775745-98775767 GAGAACAGGAGGGCTGGGCCAGG - Intronic
1101577641 12:106012795-106012817 AACAACATGAGGGCAGGGCGCGG - Intergenic
1101624335 12:106424142-106424164 GACACCATGAGGGCTGGGCTCGG - Intronic
1102033970 12:109760520-109760542 CACACCAGGTGGGCGGGATGTGG - Intronic
1102258355 12:111428924-111428946 CACACCCGGAGGCATGGGGGTGG - Intronic
1102586546 12:113927018-113927040 CAGCCCAGGAGGGAGGGGCGTGG - Intronic
1102986178 12:117280502-117280524 CCCATCAGGAGGGCTGAGTGAGG + Intronic
1103039571 12:117684177-117684199 CATACCAGGAGGGGTGGGTCAGG - Intronic
1103474725 12:121210084-121210106 CAGGCCAGGCGGACTGGGCGGGG + Exonic
1103917969 12:124385645-124385667 CACCCCAGGAGGCATGGGCCAGG - Intronic
1105024878 12:132841338-132841360 CTCACCAGGAGGGCGGGCTGCGG + Exonic
1105656333 13:22443718-22443740 AACATCATGAGGGCAGGGCGTGG - Intergenic
1106711621 13:32341980-32342002 CCTCCCATGAGGGCTGGGCGTGG + Intronic
1107814634 13:44233247-44233269 CACACCAGGATGACTAGGCCTGG + Intergenic
1108447850 13:50527230-50527252 CAGAACAGGAGGGCGGGGAGGGG - Intronic
1109861166 13:68201138-68201160 CTCAACAGGGAGGCTGGGCGCGG + Intergenic
1110295815 13:73863815-73863837 CCCGCCAGGAGGGCTTGGGGTGG + Intronic
1110981557 13:81906480-81906502 CACATCAGGAGGGCAGGTCTGGG - Intergenic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1112546151 13:100373032-100373054 CTTATCGGGAGGGCTGGGCGTGG - Intronic
1113672361 13:112183705-112183727 CACACAGGGACGGCCGGGCGAGG - Intergenic
1114262947 14:21051908-21051930 TACCCCAGGAGGGCTGAGCGAGG - Intronic
1114476009 14:22995387-22995409 AACACTAGGAAGGCTGGGCATGG + Intronic
1114545536 14:23497677-23497699 CAAACAAACAGGGCTGGGCGCGG + Intronic
1115200136 14:30844152-30844174 AACAAAAGGAGGGCTGGGCATGG - Intergenic
1115509869 14:34128939-34128961 CACACCAGGCAGCTTGGGCGTGG - Intronic
1117788656 14:59314692-59314714 CACAGCATGAGGGCTGCGCCTGG + Intronic
1117916570 14:60684141-60684163 CACAGCAATCGGGCTGGGCGCGG - Intergenic
1118765519 14:68906980-68907002 AACAGAAGGGGGGCTGGGCGCGG + Intronic
1120944661 14:89982748-89982770 CACACCAGGATGGCTGCCAGAGG - Intronic
1121793263 14:96714775-96714797 AACAAAAGGTGGGCTGGGCGTGG - Intergenic
1121846685 14:97178214-97178236 CAGGCCAGGTGGGCTGGGGGTGG - Intergenic
1121951237 14:98172481-98172503 CAAAACAGGAGGCCTGGGCCTGG + Intergenic
1122053110 14:99073616-99073638 CACAGCAGGGAGGCTGGGGGCGG + Intergenic
1122209225 14:100164221-100164243 TAGACAAGGACGGCTGGGCGCGG - Intergenic
1122555173 14:102575051-102575073 CACAGCACGGGGGCGGGGCGGGG - Intergenic
1122695535 14:103550470-103550492 CCCACCAGGCTGGCTGGGTGGGG + Intergenic
1122809980 14:104283076-104283098 CACAGGAGCAGGGCTGGGCTTGG + Intergenic
1122886672 14:104713378-104713400 CCCACCTAGAGGGCTGGGGGTGG - Intronic
1123038672 14:105481605-105481627 CACACAAGGAAGCCTGGGCCTGG - Intergenic
1124259843 15:28178854-28178876 AGCACCAGGAGGCCTGTGCGGGG - Intronic
1124593989 15:31078656-31078678 CAAAACAGAAGGGCAGGGCGGGG - Intronic
1124595938 15:31091543-31091565 CACTCCTGAAGGGCTGGGCTTGG + Intronic
1125482910 15:40092844-40092866 CAGGGCAGGAGGACTGGGCGGGG + Intronic
1125722598 15:41852393-41852415 CTGACCGGGAGGGCTGGGGGAGG - Intronic
1126647388 15:50888725-50888747 CACAACAGAATTGCTGGGCGCGG + Intergenic
1127922464 15:63504414-63504436 CCCACCCCGCGGGCTGGGCGGGG + Intergenic
1127975878 15:63996972-63996994 CAAGCCTGGAGGGCTGGGTGGGG + Intronic
1128030499 15:64475679-64475701 GACAACATGCGGGCTGGGCGCGG - Intronic
1128350275 15:66883858-66883880 CACCTCAGGAGGGCTGGCCTTGG + Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1130012788 15:80165100-80165122 CAGTACAGTAGGGCTGGGCGCGG + Intronic
1130645952 15:85727270-85727292 GACATCAGGAGGGCTGGGAAGGG - Intronic
1131086167 15:89577180-89577202 CACATCTGGGTGGCTGGGCGTGG - Intronic
1132039011 15:98509158-98509180 CACACCATCAGGGCTGGGCATGG + Intronic
1132687643 16:1168941-1168963 CACCCCAGGCGGGCAGGGGGCGG - Intronic
1132845706 16:1999936-1999958 CCCACCAGGAAGGCTGGGAAGGG - Exonic
1132910436 16:2307893-2307915 TACATCAGAAAGGCTGGGCGTGG - Intronic
1132982546 16:2745841-2745863 GGCACCTGGAGGGATGGGCGTGG + Intergenic
1133606934 16:7396647-7396669 CACAGCAGGTGGGCTGAGAGTGG + Intronic
1136219674 16:28820659-28820681 AACACCATTTGGGCTGGGCGTGG + Intergenic
1136462195 16:30418431-30418453 CAGACCCGGAGGCCGGGGCGAGG - Exonic
1136546052 16:30955457-30955479 CACTCAGGGAGGGCTGGGTGTGG - Intronic
1137277710 16:46947491-46947513 ACCACAAGGAGGGCCGGGCGCGG - Intergenic
1137374666 16:47942235-47942257 CACACCATGAGGACTGAGCCTGG + Intergenic
1137412303 16:48239270-48239292 AACTCTAGAAGGGCTGGGCGAGG + Intronic
1138555203 16:57766849-57766871 GACTGCAGGAGGGCTGGGGGTGG - Intronic
1139493887 16:67302169-67302191 CCCACCAGGAGGGCCTGGCTTGG - Intronic
1139719273 16:68839754-68839776 CACAGAAGTACGGCTGGGCGTGG - Intergenic
1141517999 16:84559303-84559325 CACACCAGGAAGTCTGGGGCAGG - Intergenic
1141563714 16:84887197-84887219 CTCAGCAGGAGGGCGGGGCTGGG - Intronic
1141639502 16:85333181-85333203 CATACCAGGAGGGGTGGCAGGGG + Intergenic
1141858442 16:86700787-86700809 CACTCAAGGAGGGCTGGACGGGG - Intergenic
1141973965 16:87501688-87501710 AACACCAGGGTGGCCGGGCGTGG - Intergenic
1142065484 16:88059947-88059969 CACCCCAGGAGGGCTGAGGTTGG + Intronic
1142338631 16:89506844-89506866 GACACCAGGTGGGCCGGGCGCGG - Intronic
1142608602 17:1095953-1095975 CACCCCAGGAGGGCCAGTCGTGG + Intronic
1143255685 17:5556157-5556179 CACACATGAAGGGCTGGGCATGG + Intronic
1143291702 17:5836282-5836304 AACACTAGGATGGCCGGGCGTGG + Intronic
1143332858 17:6150262-6150284 CACAGCAGGTGGGATGGGCTGGG + Intergenic
1143711980 17:8741705-8741727 GGCCCCGGGAGGGCTGGGCGAGG - Intronic
1144496512 17:15749508-15749530 CCCACCAGGAGTCCTGGGCAGGG - Intergenic
1144606100 17:16666912-16666934 CCCACCAGGAGTCCCGGGCGGGG - Intergenic
1144905067 17:18635191-18635213 CCCACCAGGAGTCCCGGGCGGGG + Exonic
1145746755 17:27325585-27325607 CAGAGCAGGAGGTCTGGGCTTGG - Intergenic
1147225463 17:38973410-38973432 AACTCCAGGGAGGCTGGGCGCGG + Intergenic
1147848771 17:43425114-43425136 CACATCTAGAGGGCTGGGGGTGG - Intergenic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1148351897 17:46947173-46947195 GAAACCAGGAGGGCTGGGGAAGG + Intronic
1148359938 17:47003420-47003442 CACAACAGGGGGGCAGGGCTGGG + Intronic
1148966883 17:51443136-51443158 CTCAGCAGGTGGGCTGGGTGAGG + Intergenic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1149669522 17:58393762-58393784 CACAACTGGAGGGCCGGGCGCGG + Intronic
1149874268 17:60215260-60215282 AACACCTGGAAGGCTGGGCTTGG - Intronic
1150088054 17:62292511-62292533 AACACCTGGAAGGCTGGGCTTGG - Intergenic
1150130777 17:62667516-62667538 CTCACCTGGAGGGGTGGGCTCGG - Exonic
1150692067 17:67375470-67375492 TACAACAGGAGGGGTGGGCTGGG + Intergenic
1150841825 17:68614882-68614904 CACACCAAACAGGCTGGGCGTGG - Intergenic
1151473591 17:74332651-74332673 TAGGCCAGGAGGGCTGGGTGAGG + Intronic
1152381674 17:79945429-79945451 CTCACCAGGAGGAGTGGACGTGG - Intronic
1152513059 17:80803370-80803392 CACAGCAGGACGGGTGGGGGCGG - Intronic
1152642012 17:81453151-81453173 CACTCCAGGGGGGCCGGGCGGGG - Intronic
1152664914 17:81562246-81562268 CAACCCATGAGGGCCGGGCGCGG + Intronic
1153354032 18:4115752-4115774 GACACCAGATGGGCTGGGCGCGG - Intronic
1153591242 18:6675863-6675885 CACACCAGGAGGCTTGGGGCAGG - Intergenic
1154198022 18:12280265-12280287 CACACCAGGACGCATGCGCGTGG - Intergenic
1155877989 18:31110943-31110965 GACACAATGAGGGCTGGGCTGGG - Intergenic
1156042797 18:32842774-32842796 CACACCAGCAAGGCTGAGTGGGG - Intergenic
1157496550 18:48161270-48161292 TTCTCCAGGAGGGCTGGGAGTGG + Intronic
1158465026 18:57682292-57682314 CCTTCCAGCAGGGCTGGGCGCGG - Intronic
1159433618 18:68386745-68386767 TGAACCTGGAGGGCTGGGCGCGG - Intergenic
1160660168 19:294437-294459 CACAGCAGTAGTGCTGGACGTGG + Intergenic
1161118534 19:2512663-2512685 CACACCAGTGGGGCCGGGCTTGG + Exonic
1161119365 19:2516939-2516961 CACCCCAGCAGGGCTGGGGCTGG + Intronic
1161201815 19:3019393-3019415 CCCACCAGCCCGGCTGGGCGGGG + Exonic
1161277396 19:3426367-3426389 CGCCCCATGAGGGCTGGGTGTGG - Intronic
1161510019 19:4665068-4665090 GCCACCAGGAGGGCGGGGCAGGG - Intronic
1161648588 19:5470040-5470062 CACATCTGGAGGGCTGGGGTGGG - Intergenic
1161705970 19:5821889-5821911 CACACCATATGGGCTGGGCTGGG - Intergenic
1161722919 19:5913700-5913722 TGCCCCAGGTGGGCTGGGCGCGG - Intronic
1161835241 19:6641545-6641567 GACACAGGGAGGGCAGGGCGTGG - Intergenic
1161960552 19:7520693-7520715 CACAGGAGTAGGGCTGGGGGTGG - Exonic
1162394633 19:10409820-10409842 AACACAAGCAGGGCTGGGAGCGG + Intronic
1162742783 19:12782947-12782969 AAAAGCAGGATGGCTGGGCGGGG - Intronic
1163118128 19:15200346-15200368 CACCCCGGGCGGGCTGGGCCAGG - Intronic
1163231116 19:16002996-16003018 CAACCCAGAAGGGCTGGGGGTGG - Intergenic
1163598758 19:18235459-18235481 CACAACACCAGGGCTGGGCATGG - Intronic
1163618063 19:18341190-18341212 CCCCCCAGGAGCGCAGGGCGCGG - Intronic
1163656128 19:18546117-18546139 ATCACCTGGAGGGCTGGGTGCGG + Intergenic
1164587610 19:29485693-29485715 CAGACCAGGTGGGCTGAGTGGGG - Intergenic
1165156739 19:33793268-33793290 CACCCCAGGAAGCCTGGGGGTGG + Intergenic
1165407599 19:35640303-35640325 TACAGCAGGATGGCTGGGCACGG + Intergenic
1165496308 19:36153956-36153978 GCCACAAGTAGGGCTGGGCGTGG + Intergenic
1165961423 19:39537873-39537895 CACATCATTAGGGCTGGGCGCGG + Intergenic
1166311195 19:41963575-41963597 CACAACTAGAGGGCTGGGCGCGG + Intergenic
1166382959 19:42364563-42364585 GAGACCAGGAGGGCAGGGTGTGG + Intronic
1166408742 19:42542302-42542324 AACACCAGAGAGGCTGGGCGCGG - Intronic
1167148803 19:47697272-47697294 CACTCATGGTGGGCTGGGCGTGG - Intronic
1167213514 19:48148875-48148897 CACATCACGAGGGCTGGGGCAGG + Intronic
1167385358 19:49159771-49159793 AACAACTAGAGGGCTGGGCGCGG - Intronic
1167511357 19:49896929-49896951 CCCAAAAGGAGGGGTGGGCGGGG - Intronic
1167530135 19:50010620-50010642 CTCTCCAAGAAGGCTGGGCGTGG + Intronic
1168292598 19:55363836-55363858 GACTCCAGGCTGGCTGGGCGCGG - Intergenic
1168710531 19:58497582-58497604 CACACGAGAAGGGATGGGCAGGG + Intronic
925426947 2:3757733-3757755 CTGAGCAGGAGGGCTGGGTGAGG - Intronic
925989937 2:9246573-9246595 CACACAGGTGGGGCTGGGCGTGG - Intronic
926890772 2:17637321-17637343 TACACCAGGAGGGGTGGAGGAGG + Intronic
927114320 2:19886216-19886238 GACACCAGGGAGGCTGGGCTGGG + Intergenic
927435301 2:23061285-23061307 GAAACAAGGGGGGCTGGGCGCGG - Intergenic
927445449 2:23156968-23156990 CAAAACAGGAGGGCAGGGGGAGG + Intergenic
927465212 2:23331659-23331681 CTCACCAGGAGGGGAGGGTGGGG - Intergenic
927656390 2:24950554-24950576 CACACACAGAGGGCTGGGTGTGG + Intronic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
927799782 2:26087690-26087712 AACAGCAGAAAGGCTGGGCGTGG - Intronic
927904812 2:26848617-26848639 GACCGCTGGAGGGCTGGGCGGGG + Intronic
928150942 2:28828275-28828297 CACAAGATGAGGGCCGGGCGTGG - Intronic
928389101 2:30895426-30895448 CCCAGCAGGAGGGCTGTGGGAGG - Intergenic
928576980 2:32665135-32665157 CACAGAATGTGGGCTGGGCGTGG - Intronic
930032860 2:47069096-47069118 CTGACCTGGAGGGCTGGGCCAGG + Intronic
931291968 2:60881475-60881497 CTCACCCGGAGGCGTGGGCGGGG - Intergenic
932189662 2:69730209-69730231 AAACCCAGGAGGGCTGGGCATGG + Intronic
932282686 2:70508152-70508174 AAGACTAGGAGGGCTGGGCATGG + Intronic
933599564 2:84315860-84315882 CAGACCAGGAAGGCTGAGCTGGG + Intergenic
933988998 2:87620032-87620054 CCCACCAGGAGAGGTGGGAGGGG + Intergenic
934073792 2:88409999-88410021 GGCTCCAGGAAGGCTGGGCGCGG + Intergenic
935227206 2:101062928-101062950 CAAATTAGCAGGGCTGGGCGCGG - Intronic
935252489 2:101275729-101275751 AATACTAGGAGGGCCGGGCGCGG - Intronic
935850172 2:107210612-107210634 GACAGCATGAGGGCCGGGCGCGG + Intergenic
936007139 2:108899693-108899715 AACACCAGTAAGGCTGGGCACGG + Intronic
936248321 2:110847737-110847759 CACCCCTCGAGGGCTGGACGGGG + Intronic
936304845 2:111330794-111330816 CCCACCAGGAGAGGTGGGAGGGG - Intergenic
936403842 2:112185365-112185387 CACACTTGGAGGCCTGGGTGAGG - Intronic
937086251 2:119173842-119173864 CACATCTGGTGGGCCGGGCGCGG + Intergenic
937258146 2:120569056-120569078 CCCAGCAGGAGGGCTGAGTGGGG - Intergenic
937928354 2:127185108-127185130 AACTCCATGGGGGCTGGGCGTGG - Exonic
938064794 2:128275863-128275885 CACACCAGGAGGTGTTGGGGAGG + Intronic
938128741 2:128693160-128693182 CACACCAGCAAGACTGTGCGGGG + Intergenic
938862209 2:135381283-135381305 CACAGCAGCAAGGCTGGGGGAGG + Intronic
941700752 2:168601838-168601860 AAGGCCAAGAGGGCTGGGCGAGG - Intronic
942545038 2:177055100-177055122 CAGACCGGGCGGGCCGGGCGCGG + Intergenic
943407701 2:187510431-187510453 CACACCAAGAGGGGTGGGCAGGG - Intronic
943479781 2:188404403-188404425 CACACCAAGAGGGCTGGGGTTGG - Intronic
944001237 2:194841036-194841058 CACACTAGGGCTGCTGGGCGTGG + Intergenic
945067180 2:205957229-205957251 CACACCTGCAGGGCTGGGCTGGG - Intergenic
945968925 2:216217607-216217629 AGGATCAGGAGGGCTGGGCGGGG - Intergenic
947679526 2:232017387-232017409 AACACCAATAGGGCTGGGTGTGG - Intronic
947724282 2:232387686-232387708 GGGACCAGGAGGGCTCGGCGGGG + Intergenic
947868534 2:233418835-233418857 CAGAGCTGGTGGGCTGGGCGGGG + Intronic
948018390 2:234709418-234709440 AAGAACAGCAGGGCTGGGCGCGG + Intergenic
948107106 2:235423144-235423166 CACACCACGAGAGCTGGGTTTGG - Intergenic
948616093 2:239200026-239200048 TACAGGAAGAGGGCTGGGCGCGG - Intronic
948858159 2:240740239-240740261 CACACCTGGTGGGGTGGGGGAGG + Intronic
948874440 2:240819511-240819533 CAAAACAGGCGGGCGGGGCGGGG - Intronic
948968785 2:241407096-241407118 AAAACAAGTAGGGCTGGGCGCGG - Intronic
1169190117 20:3653386-3653408 ATCACCTGGAGGTCTGGGCGGGG + Intergenic
1170687543 20:18583108-18583130 TGCACAAGGAGGGCTGGGCATGG + Intronic
1170700414 20:18698630-18698652 CACAGCTGGAGGGCTGGACATGG - Intronic
1171267719 20:23785863-23785885 CACACAGAGAGGGCTGGGGGAGG - Intergenic
1171336270 20:24388520-24388542 CTCACCATGAGGGCTGTGTGAGG + Intergenic
1172189642 20:33054163-33054185 CACAGCCGGAGGGGTGGGCAGGG + Intergenic
1172654821 20:36530199-36530221 TGTGCCAGGAGGGCTGGGCGTGG - Intergenic
1173229151 20:41180691-41180713 CACACCAGGAGGGGTGGGGCAGG - Exonic
1173638327 20:44580636-44580658 CACACCAGCCTGGCCGGGCGCGG - Intronic
1173788588 20:45812923-45812945 CACACCAGGAGCTCGGGGCCTGG + Intronic
1174283290 20:49454633-49454655 GAAGGCAGGAGGGCTGGGCGCGG + Intronic
1175167308 20:57054122-57054144 CAGACAAGGAGGGCTGAGTGGGG - Intergenic
1175317478 20:58059086-58059108 TACACCATGAGGGCTGGACCTGG - Intergenic
1175466246 20:59192628-59192650 CAGCCCAGGCGGGCTGGGCCGGG - Exonic
1175579214 20:60086297-60086319 CACAAAAGGAGGGCTGGTTGTGG + Intergenic
1177734392 21:25070797-25070819 CACACCAGGAAGGCTGAGGCAGG - Intergenic
1178407679 21:32337811-32337833 AACACGTGGGGGGCTGGGCGCGG - Intronic
1178505906 21:33162835-33162857 GACAAGAGGAGGGCTGGGAGTGG - Intergenic
1178687479 21:34722994-34723016 GACACCCAGAGGGCTGGGCTAGG - Intergenic
1178968521 21:37148013-37148035 AAGTCCAGGAAGGCTGGGCGTGG - Intronic
1179183780 21:39067621-39067643 GACACCAAGAGGACTTGGCGAGG + Intergenic
1180058825 21:45374453-45374475 CACACCAGGAGCTCTGGTGGAGG + Intergenic
1181017956 22:20081939-20081961 CTCACCAGGTAGGCTGGGCCAGG - Intronic
1182317756 22:29459219-29459241 AACAACAACAGGGCTGGGCGTGG + Intergenic
1182486259 22:30640865-30640887 CACACCAAGAGTGCTGGGCTGGG + Intronic
1183560641 22:38570186-38570208 CAAACGAGGAGGGCGGGGCGAGG + Exonic
1183687110 22:39367471-39367493 GACCCCAGGAGCGGTGGGCGGGG + Intronic
1183748663 22:39706597-39706619 CACCCCAGGAGTCCAGGGCGGGG - Intergenic
1183766616 22:39882712-39882734 TACACAAAGAGGGCTGGGCACGG + Intronic
1184279481 22:43428847-43428869 CAGAGCAGAAGGGCTGGGCCTGG - Intronic
1184550666 22:45202747-45202769 CAGACCTGGAGGGCTGTGCCTGG - Intronic
1184710220 22:46245316-46245338 CACACTTGGGGGGCTGGGCTGGG + Intronic
1184831937 22:46994340-46994362 CACAGCAGGTGGGCAGGGCCCGG - Intronic
1184864690 22:47195652-47195674 CACACCAGGAGGACGGTGGGGGG - Intergenic
1185011866 22:48319047-48319069 CAGTGCAGGAGAGCTGGGCGTGG - Intergenic
1185075595 22:48680453-48680475 CACAGCAGGAGAGAAGGGCGAGG + Intronic
1185220500 22:49627120-49627142 CCCACCAGGAGGGCAGGGGTGGG + Intronic
949118254 3:355365-355387 CACTCCAAATGGGCTGGGCGGGG + Intronic
949477559 3:4463199-4463221 CACTACATTAGGGCTGGGCGCGG + Intronic
950485464 3:13271085-13271107 CACAATAATAGGGCTGGGCGTGG + Intergenic
952377709 3:32781082-32781104 CACCCCAGCACGGCTGGCCGGGG + Intergenic
953320537 3:41967271-41967293 CAAACCAGAGAGGCTGGGCGCGG + Intergenic
953341941 3:42141843-42141865 TACACCAGCAGGGCCGGGCACGG + Intronic
953563633 3:44013364-44013386 CACTCCAGGCTGGCTGGGCCGGG + Intergenic
953944829 3:47137479-47137501 AATACTAGGAAGGCTGGGCGCGG - Intronic
953950881 3:47189205-47189227 CAGATAAGGAGGGCTGGGCATGG + Intergenic
954153892 3:48674194-48674216 CAGACCAGGAGGGGTGGGGATGG + Exonic
954159367 3:48709546-48709568 TACACCAGTCAGGCTGGGCGCGG + Intronic
954495796 3:50959868-50959890 TACACATAGAGGGCTGGGCGTGG - Intronic
954737968 3:52722352-52722374 CACACCAGCATGGCTGAGCGAGG + Intronic
954761965 3:52881411-52881433 GAACTCAGGAGGGCTGGGCGCGG + Intronic
955177569 3:56631871-56631893 CACACACAGATGGCTGGGCGTGG - Intronic
958839189 3:99182953-99182975 AACATCAGGAGGGCTGGGGGCGG - Intergenic
960141140 3:114152834-114152856 AGCACCCGGAGGGCTGGGCTGGG + Intronic
960997121 3:123347625-123347647 CACACCTGGAGGGGTGGGGCTGG + Intronic
961427410 3:126858863-126858885 CACAGAATGAGGGCTGGGTGTGG + Intronic
961522044 3:127472635-127472657 CACAGGAGGAGGGCAGGGCAGGG - Intergenic
961539586 3:127590524-127590546 CAGACCAGGCGGCCTGGGCCGGG + Exonic
964000989 3:151771727-151771749 ACCACAAAGAGGGCTGGGCGTGG - Intergenic
964832106 3:160895506-160895528 AACAGCAGGTGGGCTGGGCATGG - Intronic
966046087 3:175551607-175551629 CACACAAGAGGGGCCGGGCGCGG + Intronic
968147976 3:196315580-196315602 CACATGAGGTCGGCTGGGCGCGG + Intronic
968344025 3:197984966-197984988 GGCAGCAGAAGGGCTGGGCGCGG - Intronic
968519649 4:1029700-1029722 GAAGCCAGGAGGGCCGGGCGGGG - Intergenic
968632470 4:1659167-1659189 CACACCATGAGGACAGGGCCTGG + Intronic
968698113 4:2042447-2042469 CACTCCCGGCGGGCTCGGCGCGG - Exonic
968799391 4:2732274-2732296 CACCCTAGGCGGGCTGGGCGGGG + Exonic
968953985 4:3708916-3708938 CCCAGCAGGAGGGTTGGGCATGG - Intergenic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
969818036 4:9700349-9700371 CACAGGAGGCTGGCTGGGCGCGG + Intergenic
969927336 4:10597250-10597272 CACCCCAGGAAGGCTTGGCCAGG + Intronic
971344380 4:25798535-25798557 AAGACCAGGACGGCTGGGCGAGG + Intronic
972338459 4:38129368-38129390 CATACCAGGAGGGTGGGGCGTGG + Intronic
972535413 4:39996023-39996045 TCAACCAGCAGGGCTGGGCGTGG + Intergenic
975746458 4:77480196-77480218 TACACCATCAGGGCTGGGAGCGG + Intergenic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
978691553 4:111518828-111518850 CAGAGCAGATGGGCTGGGCGTGG + Intergenic
980045080 4:127979263-127979285 AACACCAAAAAGGCTGGGCGCGG + Intronic
980094464 4:128475009-128475031 AGAACTAGGAGGGCTGGGCGCGG + Intergenic
981475318 4:145180952-145180974 AACACCAGGAGAGCAGGCCGGGG - Intergenic
982012424 4:151119097-151119119 TAAACCTAGAGGGCTGGGCGCGG - Intronic
982117270 4:152108001-152108023 CATAGGAGGAGGGCTGGGCTGGG + Intergenic
982131047 4:152228904-152228926 CACACCAGGATAGGTGGACGAGG + Intergenic
985744604 5:1638953-1638975 CACACCAGCTGGGCGGGGAGGGG - Intergenic
986177844 5:5366953-5366975 CACACTGGGAGGGCTGCGCACGG - Intergenic
986988115 5:13522094-13522116 CGCTGCAGGAGGGCTGGGCTGGG - Intergenic
990311297 5:54541316-54541338 AAGACCAGGAGGGCCGGGCGCGG - Intronic
990455549 5:55983274-55983296 CATAGCACTAGGGCTGGGCGCGG - Intronic
992431578 5:76715937-76715959 CCCCCCAGTAGGGCAGGGCGGGG + Intergenic
992555622 5:77900093-77900115 CACAACTAGAGGGCTGGGTGTGG - Intergenic
995120566 5:108531812-108531834 CGCACTAGGAGGGCAGGGTGGGG + Intergenic
997379062 5:133422188-133422210 CAGAGCAGCAGGGCTGGGTGGGG + Intronic
997383726 5:133456243-133456265 CCCACCAGGAGGTTTGGGCTAGG - Intronic
997619013 5:135272769-135272791 CACACCACAAGGGCTTGGGGAGG - Intronic
997979555 5:138460266-138460288 CACACCACAGGGGCTGGGCAGGG + Intergenic
998167529 5:139852753-139852775 CTCACCAGGATGGCTGGCCTTGG - Intronic
998850744 5:146348495-146348517 CACACCTAGGTGGCTGGGCGAGG + Intergenic
999224364 5:150008551-150008573 CACACCAGGCAGTCTGGGAGAGG - Intronic
999286633 5:150398210-150398232 CAGGCCAGCAGGGCGGGGCGTGG - Intronic
999322556 5:150624600-150624622 CGCACCCCCAGGGCTGGGCGGGG + Intronic
999328099 5:150655939-150655961 AATACCAGAAGGGCTTGGCGCGG - Intronic
1001401909 5:171450998-171451020 GACCCCAGGAGGGCTGCGCGGGG + Intronic
1002059920 5:176620178-176620200 CGCACCGGCAGGGCTGGGCTGGG - Exonic
1002075962 5:176708693-176708715 CACATTTGGAGGGCTGGGAGGGG - Intergenic
1002129269 5:177069955-177069977 CTCAACAGGATGGCTGGGCCAGG - Intronic
1002344737 5:178540629-178540651 CTCAGCAGGGTGGCTGGGCGTGG + Intronic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002888628 6:1316470-1316492 CACACTGGGCGGGCGGGGCGGGG + Intergenic
1003533654 6:6957531-6957553 CACATCATGAGGGCTGGGCGCGG + Intergenic
1004072334 6:12311925-12311947 TAAAACAGGAGGGCTGGGCATGG - Intergenic
1006154222 6:32005619-32005641 CACAGCAGGAGGGATGGCTGGGG + Intergenic
1006160526 6:32038353-32038375 CACAGCAGGAGGGATGGCTGGGG + Exonic
1006525972 6:34605335-34605357 AAAAAAAGGAGGGCTGGGCGTGG + Intronic
1006742567 6:36320019-36320041 AACCCCAGGATTGCTGGGCGGGG + Intronic
1006745471 6:36338873-36338895 GACTCCATGAGGGCTGGGCCAGG - Intergenic
1006906939 6:37539055-37539077 CACACCAGGATGGATGGGGATGG - Intergenic
1006924882 6:37648752-37648774 CGCACCTGGAGGGCGGGGCTGGG + Intronic
1007769593 6:44182436-44182458 CACACAAAGAGCGCTGGGCAGGG + Intronic
1007912918 6:45534183-45534205 CTCAACGGGAGGTCTGGGCGTGG - Intronic
1008899161 6:56591680-56591702 AACATCAGGAAGGCTGGGCGCGG + Intronic
1010211695 6:73367307-73367329 CTCACCAGGAAAGCTGGGCACGG + Intergenic
1010759864 6:79710324-79710346 CACATCAAGAGGGCTGTGTGAGG + Intergenic
1011037667 6:82995777-82995799 AACATCAGTAGGGCTGGGCATGG + Intronic
1011293743 6:85805476-85805498 GACACAAAGACGGCTGGGCGCGG - Intergenic
1012602702 6:101117497-101117519 GACAGCAGCAGAGCTGGGCGGGG - Intergenic
1013557397 6:111270549-111270571 AAAAACAGGAAGGCTGGGCGCGG + Exonic
1013836589 6:114342362-114342384 CAAACCAACAGGGCTGTGCGTGG + Exonic
1014740199 6:125140455-125140477 AAAACCATCAGGGCTGGGCGTGG - Intronic
1016507511 6:144799105-144799127 CAAATCAGGAGGGCTGGGATTGG + Intronic
1017311581 6:152982801-152982823 CACGCCAGGAGGGGTGCACGGGG - Intronic
1017434564 6:154404084-154404106 CACACTAGGAGGGTGGGGTGTGG - Exonic
1017724724 6:157268922-157268944 CACAACAGAAGGCCTGGGCCAGG + Intergenic
1017919030 6:158855594-158855616 GTCAACAGGAGGGCCGGGCGCGG - Intergenic
1018123723 6:160661512-160661534 CAGACCATGAGGGCAGGGCAAGG + Intronic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1018726719 6:166618406-166618428 CAAAGCAGGAGGCCTGGGTGTGG + Intronic
1018852694 6:167652805-167652827 ACCACCAGGAGGGCTGGACGGGG + Intergenic
1019120665 6:169801325-169801347 CCCACCAGTAGGGCTAGGCTGGG - Intergenic
1019164502 6:170088935-170088957 GACACCAGCTGGGCTGGGTGCGG + Intergenic
1019480386 7:1264078-1264100 CACACCTGGCGGGCAGGGTGGGG + Intergenic
1019521749 7:1463791-1463813 CACACCCGGAGGGGTGGGGCAGG + Intergenic
1019711706 7:2520974-2520996 CACAGCAGGACGGTTGGGCTGGG + Intronic
1019751724 7:2734960-2734982 CACATCACGGGGGCTTGGCGAGG - Intronic
1019793889 7:3035589-3035611 AATCCAAGGAGGGCTGGGCGCGG - Intronic
1019930349 7:4218676-4218698 GACAGCAGGAGGGCAGGGCTGGG + Intronic
1020116298 7:5478287-5478309 CAGCCCAGGGGGGCTGGGTGAGG - Intronic
1020271689 7:6600368-6600390 CGCACCAGGAGGCCTGGGCCAGG - Intronic
1020813648 7:12876776-12876798 CACACATGGAGGGCTGAGGGAGG - Intergenic
1021263881 7:18495231-18495253 AACACCAGGATTGCTGTGCGTGG + Intronic
1022507787 7:30917307-30917329 GACCCAAGGAGGGTTGGGCGGGG + Intronic
1023798336 7:43811940-43811962 CCCACAAGGAGGGGTGGGGGAGG + Intergenic
1025143400 7:56484076-56484098 CAGCCCAGGAGGGTTGGGCAGGG + Intergenic
1025899021 7:65728978-65729000 TATACCAATAGGGCTGGGCGCGG + Intergenic
1025982602 7:66418950-66418972 CAAGCCAGGACAGCTGGGCGTGG + Intronic
1026299962 7:69089330-69089352 CACTCCATGAGGCCTGGGCAGGG + Intergenic
1026860464 7:73783998-73784020 CAGAAAAAGAGGGCTGGGCGCGG - Intergenic
1027053269 7:75032779-75032801 TACCACAGGAGGGCTGGGTGCGG + Intronic
1027162322 7:75811772-75811794 CAGGGCTGGAGGGCTGGGCGGGG + Exonic
1027365260 7:77450901-77450923 AAGACAAGAAGGGCTGGGCGCGG + Intergenic
1027520250 7:79197954-79197976 CATAGCAAGAGGGCTGGGGGTGG + Intronic
1027978336 7:85186300-85186322 CAGACCAGGAGGGGTGGTGGGGG + Intronic
1029134620 7:98360331-98360353 AACACAAGGCAGGCTGGGCGTGG - Intronic
1029209368 7:98893238-98893260 AAGATTAGGAGGGCTGGGCGAGG - Intronic
1029496274 7:100896817-100896839 AACTCCTGGAGGGCGGGGCGGGG - Intronic
1029655110 7:101919067-101919089 TCCAGCAGGAGGGCTGGGCGCGG - Intronic
1031075388 7:117207430-117207452 TAAACTAGCAGGGCTGGGCGCGG - Intronic
1032277829 7:130475261-130475283 AAACCAAGGAGGGCTGGGCGCGG - Intergenic
1033172931 7:139100239-139100261 ACCACAATGAGGGCTGGGCGCGG + Intronic
1033306689 7:140230652-140230674 CACACCACGCCGGCCGGGCGGGG + Intergenic
1034252222 7:149701664-149701686 CACACCACGGGGACTGGGGGCGG - Intergenic
1034266369 7:149783005-149783027 CACACCTGGTGGGCATGGCGGGG - Intergenic
1034267470 7:149788241-149788263 CACACCAGGCTGGCTGGCCAAGG - Intergenic
1035287037 7:157813271-157813293 CACAGCAGGAGGACCGGGCAGGG - Intronic
1035307562 7:157943021-157943043 CACAGCAGGAGGGCCGGGCCTGG + Intronic
1035447578 7:158953119-158953141 CACTTCAGGAGAGGTGGGCGAGG - Intronic
1035563938 8:628849-628871 CACAGCAGGGGAGCTGGGAGAGG - Intronic
1036060032 8:5306707-5306729 AACTCCAAGAGGGCCGGGCGCGG + Intergenic
1036203123 8:6785634-6785656 CACACAGGGAGGGCTTGGTGTGG - Intergenic
1036868746 8:12421407-12421429 TCCTCCAGGAGGGCTGGGCCTGG + Intergenic
1037309266 8:17537340-17537362 CACACAGGGTGGGCTGGGCACGG - Intronic
1037755008 8:21704929-21704951 GACTCCAGGAGGGGTGGGAGGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038620147 8:29134905-29134927 CGGACCAGGAGGGCAGGGTGCGG + Intronic
1038749488 8:30282446-30282468 CAGACCAGGAGTGCTGGACGTGG - Intergenic
1039065584 8:33604790-33604812 CAGCCCAGGAGGGATGGGCATGG - Intergenic
1040593847 8:48819367-48819389 CACTCGGGGAGGGCTGGGCTCGG + Intergenic
1041512720 8:58669535-58669557 ACCAACAGTAGGGCTGGGCGCGG + Intergenic
1042201616 8:66284294-66284316 GAAACAAAGAGGGCTGGGCGTGG + Intergenic
1043455613 8:80409115-80409137 CACAGAAAGAAGGCTGGGCGTGG + Intergenic
1043584369 8:81750307-81750329 AAGACAAGGAGGGCTGGGTGTGG + Intronic
1045346021 8:101294492-101294514 CAGACAAGGATGGCTGGGCTGGG - Intergenic
1047486270 8:125333801-125333823 ACCACCAGGAAGGCCGGGCGCGG - Intronic
1048165555 8:132058769-132058791 CACACCAGGTGCCGTGGGCGGGG + Intronic
1048557463 8:135494566-135494588 AAAAGGAGGAGGGCTGGGCGCGG - Intronic
1049220930 8:141428466-141428488 CACACATGGTGGGCTGGGCAGGG - Intronic
1049283224 8:141761111-141761133 CACAGCAGGTGGCCTGGGCTGGG + Intergenic
1049497851 8:142945076-142945098 CTCAGCAGGAGGGCAGGGGGTGG - Intergenic
1049540605 8:143207168-143207190 CATTCCTGGAGGGCTGGGTGAGG + Intergenic
1049583116 8:143421649-143421671 CACACCAGGAGTGCTGAGGCCGG + Intronic
1049730269 8:144173776-144173798 CACGCCAGCATGGCTGGGCAAGG - Intronic
1049742820 8:144249178-144249200 CACCCGAGGAGGGCTGGGCAGGG - Intronic
1051403292 9:16706910-16706932 TACAGCAAGAAGGCTGGGCGCGG + Intronic
1051468484 9:17407833-17407855 CTGACCAGGGAGGCTGGGCGTGG + Intronic
1056565556 9:87769850-87769872 CACTGCTGCAGGGCTGGGCGTGG - Intergenic
1056847024 9:90047496-90047518 CACACCTAGAAGTCTGGGCGTGG - Intergenic
1057270041 9:93645485-93645507 CACAGGAGGAGGCCTGGCCGTGG - Intronic
1059305314 9:113349493-113349515 CGCACCGGGAGGGCCGGGGGCGG + Intergenic
1059508184 9:114818987-114819009 ACCACCAGGAGGACTGGGCCAGG + Intergenic
1060595627 9:124846623-124846645 GAAAACAGGAGGGCTGGGCGCGG - Intergenic
1060743367 9:126113976-126113998 CACTCCAAGAGGGCTGTGTGCGG - Intergenic
1061132902 9:128718264-128718286 CACACCAGGGAGGCAGGGCAGGG - Intronic
1061164010 9:128911949-128911971 GTGACCAGGAGGGGTGGGCGTGG + Intronic
1061320104 9:129823435-129823457 CATCCCAGGAGGGCCGGGCCTGG - Intronic
1061621442 9:131813748-131813770 AACAACAGCAGGGCTGGGTGCGG - Intergenic
1061698630 9:132397694-132397716 AATACCATCAGGGCTGGGCGCGG + Intronic
1061980927 9:134103160-134103182 CACACCAGAGGGGCTGGACTTGG + Intergenic
1062350384 9:136135835-136135857 CACAGCAGGCGGGCTGGGCAGGG - Intergenic
1062431275 9:136527823-136527845 GACTCCAGGAGGGCTGCGGGGGG + Intronic
1062581405 9:137230704-137230726 CACTCCAGGAGGGTTGGGCTGGG + Intergenic
1062726005 9:138073935-138073957 CGTAGCAGGAGGCCTGGGCGTGG + Intronic
1185561535 X:1063832-1063854 CACACAAGCAGGGCTGGGTTTGG + Intergenic
1186016283 X:5198659-5198681 GAAATCAGCAGGGCTGGGCGCGG + Intergenic
1186473028 X:9836070-9836092 CACACCTGGAGAGCGGGGAGGGG + Intronic
1186826112 X:13341450-13341472 CATTCCAAGGGGGCTGGGCGCGG - Intergenic
1187144129 X:16622112-16622134 CGCATCAGGAAGGCCGGGCGCGG + Intronic
1187150433 X:16676769-16676791 AACAAGAGCAGGGCTGGGCGTGG + Intronic
1187238785 X:17493883-17493905 CCAACCAGGAGGGCAGGGCAGGG + Intronic
1189311254 X:40019464-40019486 AACACTTTGAGGGCTGGGCGAGG - Intergenic
1189318810 X:40074841-40074863 CACAGCAGAAGCGCTGGGCTTGG - Exonic
1194685208 X:96905837-96905859 CACATGAGGTTGGCTGGGCGCGG + Intronic
1195279960 X:103322510-103322532 CCAAGCAGGAGGGCCGGGCGTGG - Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200114983 X:153765993-153766015 CAGACCAGGAGAGCTGGCTGGGG - Intronic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic