ID: 1002347100

View in Genome Browser
Species Human (GRCh38)
Location 5:178555754-178555776
Sequence GGGCCGGCACCTTGGAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347100_1002347103 -8 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1002347103 5:178555769-178555791 GCCGGCCCTCACCAGTTCCCTGG No data
1002347100_1002347115 24 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347100_1002347117 30 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347100_1002347116 27 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347100_1002347105 -7 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1002347105 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347100 Original CRISPR GGGCCGGCACCTTGGAGCCT GGG (reversed) Intronic
900177220 1:1296246-1296268 GGGACCGCACCTTGGAGCAGTGG + Exonic
900178372 1:1300590-1300612 GGGCCGGTGCCTCGGGGCCTGGG + Exonic
900768989 1:4525726-4525748 AGGCCATCACCTTGAAGCCTTGG + Intergenic
900787145 1:4655979-4656001 GGGTCGGCAGCTGGGAGCCTGGG - Intronic
900954230 1:5876826-5876848 GGGCAGGACCCCTGGAGCCTGGG - Intronic
901023207 1:6265459-6265481 GAGGCGGCACCTTGGACCCCAGG + Intronic
901626972 1:10630070-10630092 GGGAGGGCAGCTTGGAGCCCAGG + Exonic
906960890 1:50419013-50419035 TGGCCGGCGCCATGGCGCCTGGG - Exonic
914928326 1:151907947-151907969 ATGCCGGCGCCTTGGAGCCTGGG - Intronic
922567246 1:226608789-226608811 TGGCCGGAACCCTGCAGCCTGGG + Exonic
922725732 1:227922222-227922244 GGGCCGGCACCTCAGCCCCTGGG + Intronic
923273753 1:232379449-232379471 GGGCTGGGACCTTGGAGAGTTGG + Intergenic
1066220562 10:33334252-33334274 GGGCGGGCAGCTGGGAGCCGGGG + Intronic
1066658138 10:37713335-37713357 GGGGCAGCACCTTGGAAGCTGGG + Intergenic
1067042624 10:42962994-42963016 GGGGCAGCACCTTGGAAGCTGGG + Intergenic
1070596014 10:77833863-77833885 GGGCATGCATCTGGGAGCCTGGG - Intronic
1072335647 10:94395711-94395733 GAGCAGGCACTTTGGAGTCTGGG + Intergenic
1075776984 10:124995505-124995527 CTGCCTGCACCTTGGAGCCATGG - Intronic
1076514216 10:131033992-131034014 GGGCCTGCACTGTGGGGCCTGGG + Intergenic
1077143579 11:1035307-1035329 GGGCCACCACCCTGGAGCCAGGG - Intronic
1079591888 11:22192506-22192528 CTGCTGGCACCTTGGAGTCTCGG + Intergenic
1083417245 11:62533695-62533717 TGGCCAGCACCTTGGAGCTCTGG + Exonic
1084475014 11:69383966-69383988 GGGCCGGCACCATGGATCACTGG + Intergenic
1085423801 11:76385370-76385392 TGGCCTGCACCTTGCTGCCTAGG + Intronic
1089321038 11:117626867-117626889 TGGCAGGCACCGTGGAGCATAGG - Intronic
1089681734 11:120122405-120122427 AGGCCGGCACCTTGCAGGCTGGG + Intronic
1090164515 11:124533525-124533547 GGGCAGGCACTTGGGAGCCAGGG - Intergenic
1090902625 11:131046266-131046288 GGGCGGGCACCTCTCAGCCTGGG + Intergenic
1091473764 12:752907-752929 GGGCCGGAGCCTCGGAGCCTCGG - Exonic
1094856577 12:34405572-34405594 GGGGCGGCACTTTGGCCCCTGGG - Intergenic
1095966241 12:47869029-47869051 AGGCAGGCTCCCTGGAGCCTGGG - Intronic
1100994505 12:100288922-100288944 TGTCCAGCACTTTGGAGCCTGGG - Intronic
1102019321 12:109670735-109670757 GGGCCTCCACCTTGGAGGGTGGG + Intergenic
1102046523 12:109833234-109833256 TGGCCCGCATTTTGGAGCCTCGG + Intronic
1105896753 13:24723206-24723228 GGGCTGACTGCTTGGAGCCTTGG - Intergenic
1112021861 13:95378839-95378861 GGGCAGGACACTTGGAGCCTGGG - Intergenic
1113288376 13:108878742-108878764 GGGCCAGCACCTTTGGGCTTTGG - Intronic
1113893086 13:113746855-113746877 GGGCCACCAGCTTGGGGCCTGGG + Intergenic
1114458461 14:22872202-22872224 GAGGCGGCACCAGGGAGCCTGGG + Exonic
1121735880 14:96217772-96217794 GGGCCGCCTCCTTAGAGCCTGGG - Intronic
1122924532 14:104893488-104893510 GGGCCGGCACCGTGGGCCCCAGG - Intronic
1123020479 14:105395677-105395699 GGGCCGGCACTTTGGAGCCGTGG + Exonic
1123696069 15:22880084-22880106 GGGCCGGGCCCTAGCAGCCTGGG + Intronic
1123706236 15:22953165-22953187 GGGCTGAGACCTTGGAGACTTGG - Intronic
1124625874 15:31307254-31307276 GGGCCGGGACCTTCAAACCTCGG - Intergenic
1128079469 15:64847675-64847697 GGGTAGACACCCTGGAGCCTTGG - Intronic
1130171353 15:81518149-81518171 GAGCTGGAGCCTTGGAGCCTTGG - Intergenic
1130895428 15:88166569-88166591 GGGACGGAACCATGGAGGCTGGG + Intronic
1131258291 15:90875661-90875683 GAGCAGGCACCTGGGAGCCGAGG + Exonic
1132728236 16:1348045-1348067 GCTCCGGCAGCCTGGAGCCTGGG - Intronic
1132889074 16:2195560-2195582 GGGCTGGGAGCTTGGAGCCCTGG - Intronic
1133036553 16:3036849-3036871 GGGCCGGGCCCCTCGAGCCTGGG - Intronic
1134007988 16:10831098-10831120 GGGCAGGCACTTTGCAACCTTGG - Intergenic
1142093186 16:88226031-88226053 GTGACGGCACCCTGCAGCCTGGG - Intergenic
1143628435 17:8123787-8123809 GTGTCGGCACCTTGTGGCCTGGG - Intronic
1144770218 17:17755497-17755519 GGGCCTGGACATTGGAGCCCAGG + Intronic
1144991557 17:19237320-19237342 GGGGCGGGACCTCGGGGCCTCGG + Exonic
1147919160 17:43905979-43906001 GGGCCAGCACAGTGGATCCTGGG - Intronic
1148219245 17:45850358-45850380 CCCCCGGCACCTTGAAGCCTTGG - Intergenic
1148863815 17:50618362-50618384 GGGCTGCCTCCCTGGAGCCTAGG - Intronic
1150639811 17:66942049-66942071 GGGCCGGCTGCTTCCAGCCTGGG - Intergenic
1151334012 17:73429625-73429647 GCGCCGGCCCCTTCTAGCCTCGG + Intronic
1152078857 17:78174360-78174382 GTGCCAGCACCTTTGAGCCTTGG - Exonic
1152717943 17:81908843-81908865 GGGCTGGGACCTGGGGGCCTGGG - Intronic
1152794791 17:82301619-82301641 GGGCAGGGGCCTTGGAGCCCTGG + Intergenic
1152896374 17:82913749-82913771 GGGCGGTCACTCTGGAGCCTGGG - Intronic
1157204783 18:45688820-45688842 GTCCCTGCACCATGGAGCCTGGG - Intergenic
1160297445 18:77650916-77650938 TGGCCGGCAGCTGGGAGCCTCGG - Intergenic
1160548694 18:79679618-79679640 GCGCCGGCACCGTGGAGCAGCGG - Intergenic
1161238438 19:3209092-3209114 GGGCCGGCCCATGGGAGCCTGGG + Exonic
1161622900 19:5308672-5308694 GGGCAGGGACCTGGCAGCCTTGG + Intronic
1163127750 19:15253452-15253474 GGGTCTGCACGTTGGACCCTGGG - Intronic
1163296449 19:16415871-16415893 GGGCCAGCATCCTAGAGCCTGGG - Intronic
1163643194 19:18473457-18473479 GTGGGGCCACCTTGGAGCCTGGG + Intronic
1163845805 19:19637590-19637612 GGGGCGGAGCCTGGGAGCCTGGG + Intronic
1164788447 19:30956397-30956419 GGGCAGGGACTTTAGAGCCTGGG - Intergenic
1165109498 19:33493612-33493634 GGGCTGGCTGCTTGGAGCCAGGG - Intronic
1165347645 19:35258902-35258924 GTGAGGGCACCTTGGAGGCTGGG - Intronic
1165840572 19:38787193-38787215 GGTCCCCCACCTTGGTGCCTTGG + Intergenic
1166298777 19:41902708-41902730 GCGCAGGCACCTAGGAGTCTGGG - Intronic
1166566791 19:43770365-43770387 GGGCAGGCAGCATGGAGCCAGGG - Intronic
926121319 2:10242689-10242711 GGGAGGTCCCCTTGGAGCCTGGG + Intergenic
928670543 2:33599122-33599144 GGGCCGGCAGCGTGGGGCTTGGG + Intronic
929868072 2:45735121-45735143 GGGCAGGTCCCTTGGAGCCCTGG + Intronic
932480429 2:72035946-72035968 GCCCCGGCACCATGGACCCTAGG - Intergenic
932773138 2:74512941-74512963 GGGCTGGCAGCCTGGCGCCTGGG - Intergenic
933741926 2:85539988-85540010 AGGCCGTCACCTTGGAGGCAAGG - Intronic
934783227 2:96986285-96986307 AGGCCCGCACCTGGAAGCCTTGG + Exonic
934857820 2:97739785-97739807 GGGCCCTGACATTGGAGCCTGGG + Exonic
934978433 2:98822250-98822272 GGGCCGGCTCCTGGGCGGCTGGG + Exonic
936288169 2:111197756-111197778 GGGCTGTCACCACGGAGCCTAGG - Intergenic
937083953 2:119158488-119158510 GCGCCGGGACCTCTGAGCCTGGG + Exonic
942517399 2:176768356-176768378 GGGGAGGCTCCTTGGAACCTTGG - Intergenic
945833213 2:214809990-214810012 GGGGCGGGGCCTAGGAGCCTCGG + Intergenic
947518818 2:230828699-230828721 GGGCTGGGGCCTTGGAGCCTGGG + Intergenic
948268647 2:236657042-236657064 GGGGCTGCACCTTGGGCCCTGGG + Intergenic
948453745 2:238094510-238094532 GGGCCATCACCTTGAAGCCGGGG - Exonic
948933893 2:241150068-241150090 TGGCCCGCACCTTGCAGCCACGG + Exonic
1169044490 20:2524914-2524936 GAGCCGGGACCTTGGCGTCTGGG - Intergenic
1169217818 20:3803588-3803610 GTGCCAGCACCTGTGAGCCTGGG - Intronic
1172838149 20:37886278-37886300 GGGCCGGCGACTTGGCGCTTCGG + Intergenic
1172841587 20:37905364-37905386 GGGGAGCCACCTTGGGGCCTTGG - Intronic
1175463640 20:59174093-59174115 GGGCATGCATCTGGGAGCCTGGG + Intergenic
1175539661 20:59740693-59740715 CACCCGGCCCCTTGGAGCCTCGG - Intronic
1175933915 20:62506377-62506399 GAGCAGCCACCTGGGAGCCTTGG + Intergenic
1176093782 20:63330331-63330353 GGGCCGGCACCTTTGAGCTAGGG + Intronic
1176117846 20:63440778-63440800 GCGCCAGCACCTGGGGGCCTTGG + Intronic
1176255387 20:64149396-64149418 GAGCCGGGACCTTAGAGTCTGGG + Intergenic
1179569021 21:42267170-42267192 GGGCCGGCCTCTGTGAGCCTGGG - Intronic
1179656952 21:42851597-42851619 GTGCCAGCACCTTGCAGTCTTGG - Intronic
1179710496 21:43210506-43210528 GGGCTGACACCTTGGGGACTGGG - Intergenic
1183284448 22:36953374-36953396 GAGCAGCCACCCTGGAGCCTGGG + Intergenic
1183660317 22:39216220-39216242 GGGCCGGTACTTTGGGTCCTTGG - Intergenic
1184712880 22:46263311-46263333 GGGCCGGCGCCATGAGGCCTGGG - Exonic
1185408806 22:50672383-50672405 GGGCCGGCACCTGGGAGCAAAGG + Intergenic
950034711 3:9877141-9877163 GGGCCGGGCCCTGGGGGCCTTGG + Exonic
952007413 3:28857874-28857896 TGGAGGGCACCTTAGAGCCTGGG + Intergenic
962751064 3:138435104-138435126 GGGCCAGCACCTGCCAGCCTGGG + Exonic
966231477 3:177657264-177657286 ACGCCAGCAGCTTGGAGCCTGGG - Intergenic
967596263 3:191329466-191329488 GGGCCGCCAGCTTGGTGCCTCGG + Exonic
968760950 4:2442618-2442640 GGGCCGTCACCATGGAGCCCCGG + Intronic
968809936 4:2795241-2795263 GGGCAGGAACCTGGGAGCCTTGG - Intronic
969370289 4:6727536-6727558 GGCCCGGCACCCTGTGGCCTTGG - Intergenic
969487567 4:7480789-7480811 AGGCCGGTGCCTTGGAGGCTTGG + Intronic
976729099 4:88244533-88244555 GGGCGGGTCCCCTGGAGCCTGGG + Intergenic
985492330 5:187075-187097 AGGCCGGCACCCTGGGGCCGTGG - Exonic
990909756 5:60842276-60842298 GGCACGGCACCTTGGAGACCAGG + Intronic
992089286 5:73303379-73303401 GGGCGGTCTCCTGGGAGCCTGGG - Intergenic
992492116 5:77255502-77255524 GTGCCAGGACCTTGAAGCCTTGG + Intronic
999289209 5:150412629-150412651 GGGCCGGCGCCCTGGGGCCCCGG - Exonic
1001406495 5:171480840-171480862 GGGTGGGTCCCTTGGAGCCTTGG + Intergenic
1002106826 5:176883605-176883627 GGGCTGGCAGTTTGGAGCTTGGG - Intronic
1002281273 5:178131265-178131287 GGGCCGGGACCTATGAGTCTGGG - Exonic
1002347100 5:178555754-178555776 GGGCCGGCACCTTGGAGCCTGGG - Intronic
1002419581 5:179138656-179138678 GGGAGGGCAGCCTGGAGCCTGGG + Intronic
1005449987 6:25963098-25963120 GGACAGGAACCCTGGAGCCTTGG + Exonic
1006092151 6:31634493-31634515 GGCCCAGCTCCATGGAGCCTTGG + Exonic
1006419879 6:33926134-33926156 GGGTTGGCACCTTGGCGCCCAGG - Intergenic
1006950887 6:37820101-37820123 AGGCCGGAACCTTGGAGGCTGGG + Intronic
1008671062 6:53769342-53769364 GGGCACTCACCTTGGAACCTTGG - Intergenic
1009808930 6:68636040-68636062 GGGTCGCCACCGTGGAGCTTTGG + Intronic
1012791079 6:103696607-103696629 GGGCAGTCACCTTGAAGACTAGG + Intergenic
1019151715 6:170010876-170010898 CTGCTGGGACCTTGGAGCCTGGG + Intergenic
1020445359 7:8262084-8262106 GGGCAGGTACCTCGGAGCCCCGG + Exonic
1022048024 7:26638811-26638833 GGGCTACCACCTTGGAGCATAGG + Exonic
1024000461 7:45185964-45185986 GGCCTGGCACCTTAGACCCTTGG - Intronic
1024875673 7:54020149-54020171 GGGCCAGGTCCTTGGAGCCAAGG + Intergenic
1025222963 7:57132094-57132116 GGGCCAGCACCTGGCACCCTGGG - Intronic
1025633759 7:63303758-63303780 GGGCCAGCGCCTGGGACCCTGGG - Intergenic
1025648937 7:63444410-63444432 GGGCCAGCGCCTGGGACCCTGGG + Intergenic
1026019951 7:66698686-66698708 GGGACAGCACCTTGGAGCCCTGG - Intronic
1026844345 7:73689559-73689581 GGGGCTGCACCTTGAAGGCTGGG + Intronic
1028987981 7:97022747-97022769 GGGCCACCTCCTTGAAGCCTGGG - Intronic
1030348454 7:108457478-108457500 GCCCCAGCACCTTGGAGGCTGGG - Intergenic
1036796252 8:11758542-11758564 AGGCCGGCCCCTGGGAGCCCAGG - Exonic
1037884373 8:22588700-22588722 GGGCCTGCCCCGTGGAGCTTTGG - Intronic
1039847738 8:41337607-41337629 GGGAGGGAACCTTGGAGGCTGGG - Intergenic
1039981962 8:42415540-42415562 GGGCTGCCACCTGGGAGCCCCGG - Intergenic
1040593890 8:48819634-48819656 AGGCCGGCAGCTGGGAGGCTGGG + Intergenic
1042641784 8:70943709-70943731 GGGCTGGGAGCTTGGAGACTTGG + Intergenic
1042857121 8:73278483-73278505 GGGCCTGCCCCTGGGACCCTTGG - Intergenic
1045663972 8:104466647-104466669 GGGCGGGTACCTTGGTGCCCTGG + Exonic
1047591312 8:126330182-126330204 GAGCTGGCACCTGGAAGCCTTGG + Intergenic
1049786190 8:144451967-144451989 GGGCCTGCCCCTCGGACCCTGGG - Intronic
1057503762 9:95616184-95616206 GGGCAGGCACCATGGGCCCTGGG + Intergenic
1061166758 9:128927285-128927307 GGCCTGACACCCTGGAGCCTTGG - Intronic
1061219697 9:129243002-129243024 GGGCCTGTTCCTTGGGGCCTCGG + Intergenic
1062340859 9:136093503-136093525 GGGCCAGCACCATCGAGCCCTGG + Intronic
1062352888 9:136147874-136147896 GGGCTGGCATTTTGGAGCCCTGG - Intergenic
1062362771 9:136195485-136195507 GAGGAGGCCCCTTGGAGCCTGGG - Intergenic
1190141093 X:47845574-47845596 GGGCGTGAACTTTGGAGCCTTGG + Intronic
1199942141 X:152637653-152637675 GGGCTGGCTCCTTGGGGGCTGGG - Intergenic