ID: 1002347102

View in Genome Browser
Species Human (GRCh38)
Location 5:178555762-178555784
Sequence ACTGGTGAGGGCCGGCACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 166}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347102_1002347116 19 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347102_1002347117 22 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347102_1002347118 26 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347102_1002347115 16 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347102 Original CRISPR ACTGGTGAGGGCCGGCACCT TGG (reversed) Intronic
900651691 1:3732971-3732993 ACTCGTCAGGGCCGCCGCCTGGG - Exonic
900998960 1:6137934-6137956 CCTGGTGGGGGCCTGGACCTGGG + Intronic
902038494 1:13475057-13475079 TCTGGTGAGGGCCTGCTTCTCGG + Exonic
902146805 1:14408545-14408567 CCTGGTGAGGGCCGTCTCCCAGG + Intergenic
902526345 1:17060237-17060259 GCTGGTGACGGCAGGCATCTGGG - Intergenic
904507973 1:30974779-30974801 ACTGGTGAGGGACCACAGCTGGG + Exonic
905629751 1:39511978-39512000 GCTGGTGAGGCCGGGCACCCAGG - Intronic
905668008 1:39774212-39774234 GCTGGTGAGGCCGGGCACCCAGG + Intronic
908568456 1:65383479-65383501 TCTGGTGAGGGCCTGCTTCTGGG + Intronic
909321099 1:74286540-74286562 ACTGGGGAGGGCCTGGACATTGG - Intronic
909621633 1:77674439-77674461 CTTGGTGAGGGGTGGCACCTAGG + Intronic
909858432 1:80572247-80572269 TCTGGTGAGGGCCTGCTCCTTGG + Intergenic
910744988 1:90563871-90563893 AATGGTGATGGCAGGCACCGGGG - Intergenic
911189104 1:94929988-94930010 ACTGGTCACAGCCGGCACCAGGG - Intergenic
912556734 1:110521669-110521691 ACTGGCCAGGGCAGGCTCCTGGG - Intergenic
912641132 1:111346866-111346888 CCACGTGAGGGACGGCACCTGGG - Intronic
915947859 1:160167170-160167192 AATGGGGAGGGCGGGTACCTGGG - Intronic
916191823 1:162186706-162186728 TCTGGTGAGGGCCTGCTTCTTGG - Intronic
920720712 1:208384240-208384262 ACTGGTGAAGTCAGGCACTTAGG - Intergenic
921172644 1:212562918-212562940 TCTGGTGAGGACCGGCTCCCTGG + Intergenic
923394979 1:233552834-233552856 CCTGGTGAGGGCCTGCTCCCTGG - Intergenic
1065304442 10:24355127-24355149 ACTGGTGAGGGCAGGCAGGTTGG + Intronic
1065988935 10:30987768-30987790 TCTGGTGAGGGCCTGCTTCTTGG - Intronic
1067061588 10:43080623-43080645 ACTGGTGAGTCCCCCCACCTCGG + Intronic
1069532046 10:69226863-69226885 ACTGGTGAGGGCCCTGAACTGGG + Intronic
1072242959 10:93514334-93514356 ACAGGTGAGTGACGGCAGCTTGG + Intronic
1072670642 10:97426524-97426546 CTCGGAGAGGGCCGGCACCTTGG + Intronic
1073470470 10:103719021-103719043 TCTGGTGAGGGCCTGCTTCTTGG - Intronic
1075084802 10:119407393-119407415 ACTGGGGATGGCCGGCAGCTGGG + Intronic
1075815553 10:125261969-125261991 CCTGTTGAGGGCCTACACCTGGG - Intergenic
1076032496 10:127171526-127171548 CCTAGTGAGGGCAGGCACCTCGG - Intronic
1076527765 10:131123186-131123208 CCTGGTGAGGGCAGGGGCCTGGG - Intronic
1076809618 10:132879758-132879780 TCTGCTGAGGGCCGGCAGCCAGG + Intronic
1077468258 11:2744021-2744043 GTGGGTGAGGGCAGGCACCTGGG - Intronic
1081657496 11:44867200-44867222 AGTGGTGAGGCCCGGCACCCTGG + Intronic
1083127887 11:60590890-60590912 ACTGGGGTGGGCCTGGACCTTGG - Intergenic
1083186535 11:61021052-61021074 ACTGGGGAGGCCGGGCACCGTGG + Intergenic
1083779028 11:64908776-64908798 ACTGGTGAGGGCAGGCCCCTGGG - Intronic
1083883632 11:65560140-65560162 ACAGGAGAGGGCTGGGACCTGGG + Intergenic
1089221667 11:116877073-116877095 TCTGGTGAGGGGAGGCACCAGGG + Intronic
1090228480 11:125085489-125085511 TCTGTTGTGGGCCGGCCCCTAGG + Intronic
1091310799 11:134573984-134574006 GCTGGTGTGGGCAGGAACCTGGG - Intergenic
1091466885 12:692443-692465 AGTGGTGAGGGCTGGCTGCTGGG - Intergenic
1092246614 12:6867661-6867683 ACCGGTGTCGGCCGGCACCTTGG - Exonic
1093611550 12:21165770-21165792 TCTGGTGAGGGCCCTCTCCTAGG - Intronic
1101882948 12:108638520-108638542 ACGGGGGAGGGCAGGCAGCTGGG - Intergenic
1103947988 12:124537727-124537749 ACTGGAGAGGGCTGGCCTCTCGG - Intronic
1104209847 12:126678237-126678259 ACAGGTTATGGCAGGCACCTGGG - Intergenic
1104307057 12:127619147-127619169 ACTGGTGAAGGCCAGAATCTGGG + Intergenic
1105827412 13:24134691-24134713 ACTGGTGAGGGCTGGAACAGTGG - Intronic
1106007884 13:25788062-25788084 ACAGGTGAGGCCCCGCACCCAGG + Intronic
1106946573 13:34834015-34834037 CCTGGTGACTGCTGGCACCTGGG - Intergenic
1107149106 13:37091337-37091359 ACTGGTGAGAGTTGGCCCCTTGG + Intergenic
1107768459 13:43763286-43763308 TCTGGTGAGGGCCCACACCGTGG + Intronic
1109264081 13:60176711-60176733 TCTGGTGAGAGCCGGCTCCCTGG + Intergenic
1112358393 13:98693976-98693998 ATTGGTGAGGGAGGCCACCTGGG - Intronic
1113721050 13:112556666-112556688 ACAGGTGAGGCCAGGCGCCTGGG - Intronic
1121137052 14:91509378-91509400 GCTGGGGAGGGCGGCCACCTCGG - Intronic
1122295588 14:100703980-100704002 GCTGGGGAGGGCCGGGAGCTGGG - Intergenic
1123726401 15:23106913-23106935 TCTGGTGAAGGCTGTCACCTTGG + Intergenic
1132997196 16:2829556-2829578 CCAGATGAGGGCCGACACCTCGG + Intergenic
1133269198 16:4602367-4602389 CCTGGTGGGGGCCGGCAAGTTGG - Intergenic
1135576546 16:23590333-23590355 ACTAGTGAGAGCCAGCACCATGG - Intronic
1138442406 16:57042890-57042912 CCTGTTCAGGGCCTGCACCTGGG + Intronic
1140345992 16:74213600-74213622 GCTGGTGAGGCCAGGCACCATGG + Intergenic
1142307287 16:89292893-89292915 CCTGGGGAGGGCCGGCCCCCGGG - Intronic
1142894498 17:2965108-2965130 ACTGGTGAGGGCCGCCCCATGGG + Intronic
1143848505 17:9791488-9791510 ACTGGGGAGGGCAGGCCCCCTGG - Intronic
1146284965 17:31568259-31568281 ACTGCAGAGGGCAGGCACCAGGG - Intergenic
1147427413 17:40352504-40352526 CCTGGTGAGGGTCTGCACCCTGG + Exonic
1148154128 17:45412864-45412886 AGTGGTTTGGGCCGGGACCTGGG + Intronic
1151265179 17:72949536-72949558 ACTGGTGAGAGCCTGCTTCTTGG + Intronic
1152148215 17:78582107-78582129 TCTGGTGAGGACCCTCACCTGGG - Intergenic
1152208989 17:78993014-78993036 ACGAGTGAGGGCAGGCCCCTGGG - Exonic
1152224397 17:79085967-79085989 GATGGTGACGGCCTGCACCTGGG - Exonic
1152709363 17:81862920-81862942 AATGGAGAGGGCAGGCACCTGGG - Intergenic
1154325778 18:13389469-13389491 GCTGGGGAGGAGCGGCACCTAGG + Intronic
1157638214 18:49183964-49183986 TCTGGTGAGGGCCCTCCCCTTGG - Intronic
1158388942 18:57027294-57027316 ACTGGGGTGGGCAGGCCCCTGGG - Exonic
1160488733 18:79319043-79319065 TCTGGTGAGTGCCAGCATCTCGG + Intronic
1163300367 19:16441708-16441730 AGTGGTGGGGGCTGCCACCTGGG + Intronic
1163809583 19:19422337-19422359 GCTGGTGGGGGCTGGCACCTGGG - Intronic
1165052079 19:33148124-33148146 ACTGGTAAGGGCCAGAACCCTGG - Intronic
1165958116 19:39514843-39514865 CCTGGTGAGGGCAGGGACCAGGG + Intergenic
1166387030 19:42388161-42388183 ACTGGTGTGTGCCACCACCTCGG + Intronic
1167734953 19:51288506-51288528 TCTGGTGAGGGCCTGCTTCTTGG + Intergenic
1167736638 19:51298416-51298438 TCTGGTGAGGGCCGGCATCCTGG - Intergenic
925398988 2:3558381-3558403 CCTGATGAGGGCCGGGGCCTAGG + Exonic
926305404 2:11634346-11634368 ACCGGTGAGCTCCTGCACCTGGG + Exonic
927908707 2:26881133-26881155 ACAGGTGAGGGCAGTGACCTTGG - Intronic
928421221 2:31138752-31138774 CCTGGCGAGGGCCGGCCCTTGGG - Intronic
932736094 2:74255774-74255796 CCTGGTGGGGACAGGCACCTCGG + Exonic
933773221 2:85756486-85756508 GCAGGTCAGGGCTGGCACCTAGG + Intronic
938215839 2:129513709-129513731 AGTGGTGAGAGAGGGCACCTTGG + Intergenic
942747506 2:179251817-179251839 TCTGGTGAGGGCCAGCTTCTTGG - Intronic
944306703 2:198187653-198187675 ACAGGTGAGGGCTGGCAGCCTGG - Intronic
944373267 2:199011330-199011352 ACTGGAGTGGGCCTGCACCCTGG + Intergenic
948357158 2:237387832-237387854 ACTTATGAGGACCAGCACCTGGG + Exonic
1171056972 20:21916617-21916639 AGGGGTGACGGACGGCACCTGGG - Intergenic
1172267897 20:33632732-33632754 ACTGGTGAGGCCGGGCACGGTGG - Intronic
1175315577 20:58044459-58044481 ACTGGGGAACACCGGCACCTGGG - Intergenic
1175465426 20:59187414-59187436 CCTGGTGAGGGCCTGCATCCTGG - Intergenic
1176059244 20:63165099-63165121 ACGGGTTAGAGCCGCCACCTGGG + Intergenic
1179561712 21:42219655-42219677 ACTGGGGAGGGGCCGCAGCTTGG + Intronic
1179790242 21:43752256-43752278 ACTGGCGAGGGCCTCCCCCTTGG - Intronic
1181273628 22:21675160-21675182 ACTGGTGAGAGCTGGGCCCTTGG - Intronic
1183319603 22:37156996-37157018 ACTGGTGAGGCCTGGCACTGTGG - Intronic
1184248255 22:43246362-43246384 GCTGGTGAGGGCAGGCAGCTGGG + Intronic
1184410188 22:44321851-44321873 AGTGGAGAGGGCCGGCCCTTCGG + Intergenic
1184767181 22:46577838-46577860 GCTGGGGCGGGCTGGCACCTTGG + Intronic
1184833670 22:47007599-47007621 TCTGGTGAGGGCTGTCCCCTAGG + Intronic
1185333537 22:50261840-50261862 CCTGGGGAGGGCCGGAGCCTGGG + Intergenic
949656577 3:6227466-6227488 ACTGGTGAGGGCCCTCATTTTGG - Intergenic
951627867 3:24686364-24686386 ACTGGTGAGGGCCCACTTCTTGG + Intergenic
952523291 3:34184048-34184070 ACTGGTGGGGGCAGGGAGCTGGG - Intergenic
953299354 3:41756588-41756610 TCTGGTGAAGGCTGTCACCTTGG - Intronic
954618256 3:51981323-51981345 AGTGGTGAGGCCAGGCACTTAGG - Intronic
955105417 3:55893089-55893111 TCTGGTGAGGGCCCTCTCCTGGG - Intronic
957452983 3:80403446-80403468 ACTGGTGAGGGTCGTCTTCTGGG - Intergenic
957888082 3:86316704-86316726 TCTGGTGAGGGCTGACATCTGGG - Intergenic
957898803 3:86461144-86461166 TCTGGTGAGGGCCTTCTCCTTGG + Intergenic
958185765 3:90117521-90117543 ACTGAAGAGGGCAAGCACCTCGG + Intergenic
961647308 3:128399579-128399601 GCTGGGGGGGGCCGGCTCCTTGG - Intronic
962280578 3:134048903-134048925 CCTGGTGGGGGCGGGCCCCTGGG - Intronic
962917496 3:139917799-139917821 ACTGAAGAGGGCTGGCATCTTGG - Intergenic
967289346 3:187903945-187903967 GCTGGTGAGGGCCGTCATCTAGG + Intergenic
970158316 4:13163843-13163865 TCTGGTGAGGGCCAGCTTCTTGG - Intergenic
973931046 4:55793592-55793614 GCTGCTGCAGGCCGGCACCTGGG + Intergenic
983709567 4:170696590-170696612 TCTGGTGAGGGCCTGCTTCTTGG + Intergenic
984777327 4:183493136-183493158 ACTGATGAGGGCCTGCCCCCAGG + Intergenic
985299153 4:188469345-188469367 ACTGGTGAGGGCCAGCTCGGTGG + Intergenic
985630764 5:1012804-1012826 ACAGGTGAGCGCTGGCTCCTGGG - Intronic
986350090 5:6869064-6869086 AGTGGTGAAGGCCGGCAGCCTGG - Intergenic
986605374 5:9517788-9517810 ACTGGAGAGGGTCGGCTCATTGG - Intronic
986794202 5:11192896-11192918 CCTGGTGAGGGCTGGCTTCTGGG + Intronic
994158277 5:96527275-96527297 ACTTGTGAGGGAGGCCACCTGGG + Intronic
994750737 5:103734078-103734100 TCTGGTGAGGGCCTGCTCCTGGG + Intergenic
999829657 5:155306534-155306556 ACTGCTTAGGGCCGGTGCCTAGG + Intergenic
1000040586 5:157481820-157481842 ACTGCTGAGGGCCAGCACCAGGG + Exonic
1001287577 5:170435128-170435150 ACTGGCCAGGGCCGGCTCCCTGG - Intronic
1002334155 5:178466579-178466601 ACTGGTGAGACCCAGAACCTGGG - Intronic
1002347102 5:178555762-178555784 ACTGGTGAGGGCCGGCACCTTGG - Intronic
1002454907 5:179340324-179340346 ACTGGTGGGGGACTGCAGCTGGG - Intronic
1003135003 6:3428216-3428238 TCTGGTGAGGGCCGCGACTTGGG - Intronic
1003687605 6:8320129-8320151 TCTGGTGAGGGCCGGCTTCCTGG + Intergenic
1003965224 6:11246435-11246457 ACTGGTGGGGCCCGGGGCCTGGG - Intronic
1004509052 6:16269884-16269906 TCTGGTGAGGGCCGGCTTCCTGG + Intronic
1006507067 6:34496164-34496186 GCTGGAGAGGCCCAGCACCTGGG + Intronic
1007503312 6:42315338-42315360 ACTTGTGAGGCCCTGCACCAGGG - Intronic
1009310290 6:62142127-62142149 ACTGATGAGGGCAAGCAACTGGG + Intronic
1018368815 6:163149269-163149291 CCTGGGGAGGGCCGGGGCCTGGG - Intronic
1019743912 7:2688912-2688934 ACAGGGGAGGGCAGGGACCTGGG + Intronic
1023019822 7:36001377-36001399 TCTGGTGAGGGCCTGCTTCTTGG - Intergenic
1025858671 7:65306339-65306361 ACTGATGAGGCCGGGCACCTTGG - Intergenic
1027659266 7:80969674-80969696 ACTGGGGAGGCCCAGCATCTGGG - Intergenic
1033237889 7:139652853-139652875 ACTGTTCAGGGCCGGCACGGTGG + Intronic
1034276672 7:149826818-149826840 GCTGGTGAGGGCCTGGCCCTGGG + Intergenic
1035701544 8:1642276-1642298 ACAGGTGAGGGCCGGCGGGTTGG - Intronic
1035701804 8:1643114-1643136 ACAGGTGAGGGCCGGCGGGTTGG - Intronic
1037287729 8:17318845-17318867 ACTGGTGAAGGCCTGCAGCAGGG - Intronic
1039565871 8:38552363-38552385 GCTGGTGAGGGCTGGAGCCTGGG + Intergenic
1047498826 8:125427326-125427348 GCTGGTGAGGGCCAGCCCCAGGG + Intergenic
1048970702 8:139643586-139643608 CCTGCTGAGGGCCGGCATCATGG - Intronic
1049639450 8:143708133-143708155 ACTGGTGAGGGCAGCGACCCCGG + Intronic
1051358374 9:16260545-16260567 TCTGGTGAGGGCCTGCTTCTTGG - Intronic
1052234018 9:26188710-26188732 ACTGGAAAGGGCCTGGACCTTGG - Intergenic
1053381169 9:37650773-37650795 ACTGCGGCGGGCCGGGACCTCGG + Intronic
1053642856 9:40105430-40105452 ACTGGTGTGGGCCGCAATCTTGG + Intergenic
1053763297 9:41360060-41360082 ACTGGTGTGGGCCGCAATCTTGG - Intergenic
1054541906 9:66271227-66271249 ACTGGTGTGGGCCGCAATCTTGG - Intergenic
1055024454 9:71704627-71704649 ACTGGAATGGGCCGGCACCACGG - Exonic
1056808462 9:89746168-89746190 CCTGGGGAGGGCTGGCAGCTGGG - Intergenic
1057387001 9:94613475-94613497 ACTGGTGGGGCCAGGCACCGTGG + Intronic
1057503759 9:95616176-95616198 ACTGGAGAGGGCAGGCACCATGG + Intergenic
1057562340 9:96138431-96138453 CCTGGTGAGGGCCTGCCCCCTGG - Intergenic
1058737544 9:107907623-107907645 ACTGGTGAGGTCCTTCACCCTGG - Intergenic
1059406032 9:114098689-114098711 TCTGGGGGGGGCGGGCACCTTGG + Intronic
1060750714 9:126166571-126166593 ACTGGAGAGGGCTGGGAACTGGG + Intergenic
1061444207 9:130628592-130628614 AGTGGGGAGGGCCGGGGCCTCGG + Intronic
1062290820 9:135793615-135793637 ACCGGGGAGGGGCTGCACCTCGG - Intergenic
1186174500 X:6910857-6910879 ACTGGTGAGGCCCTGCTCCCTGG + Intergenic
1196580456 X:117373273-117373295 TCTGGTGAGGGCCTGCTTCTTGG - Intergenic
1197756896 X:130001970-130001992 GCTGATGAGGGCCTGCACCAGGG + Intronic
1198115160 X:133537539-133537561 ACTGGTTAGGGCAGGCAGCAAGG + Intronic