ID: 1002347104

View in Genome Browser
Species Human (GRCh38)
Location 5:178555770-178555792
Sequence CCCAGGGAACTGGTGAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 481
Summary {0: 1, 1: 0, 2: 3, 3: 45, 4: 432}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347104_1002347117 14 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347104_1002347115 8 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347104_1002347118 18 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347104_1002347120 27 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347104_1002347116 11 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347104_1002347119 26 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347104 Original CRISPR CCCAGGGAACTGGTGAGGGC CGG (reversed) Intronic
900074725 1:804145-804167 GCGAGGGAACTGGTGAGCTCAGG - Intergenic
900372394 1:2337758-2337780 CCACGGGATGTGGTGAGGGCTGG + Intronic
900871820 1:5309677-5309699 ACCAGGGGACAGGTGAGGGAAGG + Intergenic
900934211 1:5755219-5755241 CCCAGGGAAGTGGGGATGGCTGG + Intergenic
901205532 1:7493633-7493655 CCCAGGGAACTGGGGGGGGGGGG + Intronic
901612354 1:10508861-10508883 CCCAGGGTACTGGGGAAGGGTGG + Intronic
901850318 1:12010976-12010998 CCCAGTGATCCGGTGAGGGTTGG - Intronic
902251326 1:15155586-15155608 CCCAGGGAACAGGGGAGGAAGGG + Intronic
904344647 1:29859869-29859891 AGCAGGGAAGTGGTGAGGCCAGG - Intergenic
905023136 1:34831688-34831710 GCCAGGGACCTGGTGAGGCCAGG - Intronic
905959585 1:42032649-42032671 CCCAGGGGAATGGTGGGGGAGGG - Intronic
906604938 1:47161935-47161957 ACCAGAGAACTGGTGAAGGTTGG + Intergenic
907326667 1:53642818-53642840 TGCAGGGAACTGGGGAGGCCGGG - Intronic
908401910 1:63779427-63779449 CCCAGGGAATGGGTGAAGCCAGG - Intronic
909085539 1:71166128-71166150 CCCAGAGAACTGGTGGTGCCTGG + Intergenic
910302928 1:85727877-85727899 CCCTGGGAAGAGGGGAGGGCAGG - Intergenic
911058175 1:93724953-93724975 CCAAGGGAACTGATGAGTGAGGG + Intronic
911122692 1:94311893-94311915 CACAGGGCCCAGGTGAGGGCTGG - Intergenic
912504614 1:110147780-110147802 CCCAGGGGACAGGTGGAGGCTGG + Intergenic
913318990 1:117575741-117575763 CCCAGGGACCCGGTCAAGGCAGG + Intergenic
916435375 1:164772955-164772977 GCCAAGGAACAGGTCAGGGCTGG - Intronic
919907179 1:202086019-202086041 CCCAGGGAAACTGTGAGGGCTGG - Intergenic
919935780 1:202249793-202249815 CCCAGGCAAGTGATGATGGCGGG - Intronic
920054908 1:203184641-203184663 CACAGGGAGGTGGGGAGGGCAGG + Intronic
920071485 1:203305889-203305911 CCCAGGAAACTGGGGACTGCGGG - Intronic
920324018 1:205147437-205147459 CCAAGGGAACTGGTGCTTGCTGG - Exonic
920521215 1:206628226-206628248 CCCTAGGAACTGGAGAGAGCTGG - Intergenic
920945451 1:210524418-210524440 ACCAGGGAAAGGGCGAGGGCTGG + Intronic
922237227 1:223731331-223731353 CATTGGGAACTGGAGAGGGCTGG - Intronic
923204924 1:231750003-231750025 CCCAGGAAACTGCTAAGAGCTGG - Exonic
924197095 1:241619623-241619645 TCTAGGGAACTGGTGAGGCCAGG - Intronic
924426313 1:243953228-243953250 CCCGGGGTACTGCTGAGGACTGG - Intergenic
924814409 1:247429420-247429442 CCCAGAGAAATGAAGAGGGCTGG - Intronic
1062811745 10:471624-471646 CCCAGGGCACCGGTGAGGGTAGG - Intronic
1063337631 10:5231712-5231734 CTCAGGGAACAGGGGAGGGTTGG + Intergenic
1063948140 10:11197285-11197307 ACCAGGGAACTGGTGAATCCAGG + Intronic
1065020879 10:21500771-21500793 GCCAGGTAGCAGGTGAGGGCCGG - Intergenic
1065584603 10:27205682-27205704 CCCAGCTAACTGGTGTTGGCTGG + Intronic
1065682358 10:28249684-28249706 CCCAGTGAAATGGTGAGAGTGGG - Intronic
1067038725 10:42937020-42937042 CCCAGGCCCGTGGTGAGGGCAGG + Intergenic
1067199999 10:44160328-44160350 CCCAAGAAACTGGTGAGAGTTGG - Intergenic
1067437983 10:46292283-46292305 CCCATGGAACCAGTGAGTGCTGG - Intronic
1067778090 10:49177300-49177322 CCCTGGGAACTAGAGAGGGAGGG - Intronic
1068127940 10:52864900-52864922 CCCAGGGCTGTGGTGAGAGCCGG + Intergenic
1069160431 10:65084979-65085001 TCCATGGAACTGGTGAAGGCTGG - Intergenic
1069709454 10:70479281-70479303 CCCAGGGAACTCGGGAGAGGGGG - Intronic
1069718927 10:70538000-70538022 CCCAAGGAACCGGGGAGGGAAGG + Intronic
1073036600 10:100568023-100568045 ACCAGGGAGCTGGTGGGGGAGGG - Intergenic
1073081653 10:100864532-100864554 CCCAGGGAGGGGGTGACGGCAGG - Intergenic
1073563302 10:104515390-104515412 ACCTGGGAAGTGGGGAGGGCTGG + Intergenic
1074399404 10:113129368-113129390 CCAAGGTAACGGGTGAGGGAGGG + Intronic
1075548814 10:123376934-123376956 CCCCGGAAACTGGAGAAGGCTGG - Intergenic
1075651618 10:124131238-124131260 CCCAAGGAACTTCTGAGGGGAGG + Intergenic
1075725187 10:124607334-124607356 CCCAGGGAGCTGGGGTAGGCAGG - Intronic
1076816133 10:132915531-132915553 CCCAAGGGACCGGCGAGGGCGGG + Intronic
1076816148 10:132915574-132915596 CCCGAGGGACCGGTGAGGGCGGG + Intronic
1076931290 10:133533549-133533571 CCCAGAAATCTGCTGAGGGCAGG - Intronic
1077521369 11:3037348-3037370 GCCAGGGCAGTGGTGAGGGAAGG + Intronic
1078069151 11:8097039-8097061 CTCTAGGAACTGTTGAGGGCAGG + Intronic
1078089173 11:8253307-8253329 CCTGGGGTACTGGTGAGAGCAGG - Intronic
1080436461 11:32249436-32249458 CTCAGTGACCTGGTAAGGGCTGG + Intergenic
1081517053 11:43843386-43843408 CCCAGGAAACATGTGTGGGCTGG - Intronic
1082754700 11:57062989-57063011 CCAAGGGAAGTGGTGATGGATGG + Intergenic
1083305728 11:61761201-61761223 CCCGGGGAACGGGGGAGGGTGGG - Intronic
1083759018 11:64805828-64805850 CCCAGGGACCTGGCGGGGGATGG + Intronic
1083903294 11:65654345-65654367 CCCAGTGCTCTGGGGAGGGCAGG + Exonic
1084148756 11:67278441-67278463 CACAGGGAACTGGAGAGGCAAGG - Intronic
1084174575 11:67416572-67416594 CCCAGGGGATGGGAGAGGGCAGG + Intronic
1084432941 11:69121757-69121779 CCCAGGGTCATGGTGGGGGCAGG - Intergenic
1084652012 11:70495010-70495032 CTCAGGGAACTGGTCAGGCACGG + Intronic
1085152076 11:74260257-74260279 CCCAGGGAGCTGGATAGGGAGGG + Intronic
1085399145 11:76225200-76225222 CTCAGGGAGCAGCTGAGGGCGGG + Intergenic
1085455837 11:76664912-76664934 CCCAGGGAAGGGCTGCGGGCAGG + Intronic
1085517033 11:77117626-77117648 TCCAGGGAGCTGGTGGGGGCAGG - Intronic
1085560276 11:77466140-77466162 CACAGAGAAAGGGTGAGGGCAGG + Intronic
1085751907 11:79169099-79169121 CCCAGGCAAATGGAGATGGCTGG + Intronic
1086579887 11:88386812-88386834 CCAAGGGAACTGCTTAGAGCTGG + Intergenic
1090157957 11:124461344-124461366 GCCAGGGAACTGGTTATGGCGGG - Intergenic
1090664361 11:128905196-128905218 CCCAGGGAACGGGCGTGGGGAGG - Intronic
1091280555 11:134379460-134379482 CCCAGAGGCCTGGGGAGGGCAGG + Intronic
1092261152 12:6953913-6953935 CCCAGGGACGAGGGGAGGGCGGG - Intronic
1093619109 12:21265724-21265746 GCCAAGGAACTGGAGAGTGCAGG - Exonic
1094216941 12:27952437-27952459 CCCAGGGAAAGGGGGAGGGAGGG + Intergenic
1094352887 12:29546194-29546216 CCTAGACAACTGGTGTGGGCAGG + Intronic
1095945208 12:47749705-47749727 CCCAGGGCACTGGGGTGGGGAGG + Intronic
1096196360 12:49651350-49651372 CCCAGGGCTCTGGGCAGGGCTGG - Intronic
1096455041 12:51777860-51777882 CCCAGGGGACTGTTGAGTCCAGG + Intronic
1097300212 12:58009986-58010008 CCCAAGGAAGTGGTGGGGGAGGG + Intergenic
1097712448 12:62932045-62932067 CCTAGGGAGTAGGTGAGGGCTGG + Intronic
1099055447 12:77834160-77834182 CCCATGGACCTAGTGAGGACAGG - Intronic
1100346993 12:93742321-93742343 CTCTAGGAACTGGTGAGTGCGGG + Intronic
1100607777 12:96165925-96165947 CCCAAGTAACTAGTGAGGGCTGG + Intergenic
1100901665 12:99248271-99248293 GCCTGGGAACTGGTGAAAGCAGG + Intronic
1101674319 12:106903711-106903733 TTCAGGGAACTGGGGAGGGCGGG + Intergenic
1101876128 12:108597959-108597981 GCCAAGGAACTGGTGAGTCCTGG - Exonic
1102520310 12:113473904-113473926 GACAGGGAATTGGTGAGTGCTGG + Intergenic
1102763653 12:115412203-115412225 CCCAGGGAACAAATGAGAGCTGG + Intergenic
1102777959 12:115537203-115537225 CCCAGGGACCTGGTGATGGGTGG + Intergenic
1103138994 12:118532597-118532619 CCCAGGGAGGTGGTGATGGAGGG - Intergenic
1103572566 12:121854809-121854831 ATCGGGGAATTGGTGAGGGCTGG + Intronic
1103595468 12:122022302-122022324 CCCCGGGACTTGGCGAGGGCGGG + Intronic
1103719319 12:122965094-122965116 CCCAGGGAAGTGGGGAGGCCTGG - Intronic
1104270861 12:127281001-127281023 CCCTGGGCACTGGGCAGGGCTGG + Intergenic
1104367677 12:128192697-128192719 ACCAGTGAACCGGTGGGGGCAGG - Intergenic
1104966872 12:132512263-132512285 TCCTGGGGACTGGTGAGGGAGGG + Intronic
1105899740 13:24744444-24744466 ATCAGGCAACTGGTGGGGGCTGG + Intergenic
1106112245 13:26787181-26787203 CCCAAGGAATAGGGGAGGGCTGG + Intergenic
1106581766 13:31024950-31024972 CCTAGGGAACTGGTGACTTCTGG - Intergenic
1106582137 13:31027635-31027657 CCCTGGGCTCTGGGGAGGGCAGG + Intergenic
1107843194 13:44481351-44481373 GACAGGTAACTGGTGAGGGGTGG + Intronic
1108131883 13:47310464-47310486 ACCAGGGAACTGGGGAAAGCTGG - Intergenic
1108390065 13:49938079-49938101 CCCAGGGAAGTGCTGGGGGCGGG + Intergenic
1108698015 13:52920028-52920050 CCCAGGGAATTGGGGTGAGCTGG + Intergenic
1110549006 13:76790996-76791018 CCCAGAGCACTGGGAAGGGCTGG + Intergenic
1112372170 13:98803532-98803554 CCCAGGGAACTTGTTAGAGATGG - Intronic
1113181733 13:107636114-107636136 CCAAGTGCACTGATGAGGGCAGG - Intronic
1113663641 13:112125621-112125643 TCCAGGGTACATGTGAGGGCTGG - Intergenic
1116951371 14:50881726-50881748 TCCAGGGTACTGGTCAGGGTGGG + Intronic
1117843154 14:59881571-59881593 CCCAGGGAATTGGGGAGAGTTGG + Intergenic
1119756254 14:77121981-77122003 CCCATGCAACTGGTGGGGCCAGG - Intronic
1120528137 14:85601417-85601439 CCCAGGGAACTGGTGATGTTGGG - Intronic
1120822974 14:88930146-88930168 CACAGGGAAATGGTCAGAGCGGG + Intergenic
1121117334 14:91352958-91352980 CCCGGGGAACTTGTGAGGGCTGG - Intronic
1121236059 14:92391991-92392013 CCAAGGGAAGTGGTGGGGGGAGG - Intronic
1121241122 14:92430732-92430754 CCCAGGGCAGGGGTGGGGGCTGG + Intronic
1121710010 14:96030695-96030717 CACACAGAGCTGGTGAGGGCTGG - Intergenic
1121720379 14:96104939-96104961 CCCAGGGAAAGGCTGTGGGCGGG - Intergenic
1121791805 14:96704598-96704620 CACAGGGCAGTGGTGAGGCCCGG + Intergenic
1121976001 14:98404676-98404698 CCTTGGGGACTGGTGGGGGCTGG + Intergenic
1122117182 14:99533677-99533699 CCCAGGGAGCTGGTGGGAGCAGG + Intronic
1122434967 14:101689178-101689200 CCCAGGCAGGTGGTGTGGGCTGG - Intergenic
1122641917 14:103164992-103165014 CCCAGGGCAGTCTTGAGGGCAGG + Intergenic
1122746179 14:103898457-103898479 CCAAGGGGGCTGGTGAGTGCAGG + Intergenic
1123408285 15:20037822-20037844 CCAAGGGAAGTGGTGATGGATGG - Intergenic
1123469729 15:20541207-20541229 CTGTGGCAACTGGTGAGGGCAGG + Intronic
1123517609 15:21044473-21044495 CCAAGGGAAGTGGTGATGGACGG - Intergenic
1123648334 15:22459492-22459514 CTGTGGCAACTGGTGAGGGCAGG - Intronic
1123721351 15:23064439-23064461 GACAGGGAACTTGTGGGGGCAGG - Intergenic
1123730007 15:23136193-23136215 CTGTGGCAACTGGTGAGGGCAGG + Intronic
1123748177 15:23333675-23333697 CTGTGGCAACTGGTGAGGGCAGG + Intergenic
1123986664 15:25652505-25652527 TGCTGGGAGCTGGTGAGGGCAGG + Intergenic
1124280541 15:28357527-28357549 CTGTGGCAACTGGTGAGGGCAGG + Intergenic
1124302157 15:28554085-28554107 CTGTGGCAACTGGTGAGGGCAGG - Intergenic
1126099686 15:45111757-45111779 CCCCGGGACCTGGTGAGGCGGGG - Exonic
1126799004 15:52283304-52283326 CCCAGGGAACTGGTGAAAATAGG - Intronic
1127974605 15:63987895-63987917 CCCTGGGAAGTGGGCAGGGCAGG - Intronic
1128546438 15:68571867-68571889 CCCAAGGAGGTGGTAAGGGCTGG + Intergenic
1128635156 15:69298406-69298428 CCTGGGGAAAGGGTGAGGGCTGG + Intergenic
1128638698 15:69319667-69319689 CCCTGGGAAGAGGTGAGGACTGG - Intronic
1129114593 15:73358173-73358195 CCCAGGGCTCTGGGGCGGGCCGG + Intronic
1129293856 15:74588708-74588730 CCAGGGGATATGGTGAGGGCGGG - Intronic
1129604823 15:77019734-77019756 CCAAGGGAAGGGCTGAGGGCCGG + Intronic
1129888742 15:79057135-79057157 CCCAGGCATCTGCTGAGGGTTGG - Intronic
1130348222 15:83067692-83067714 CCAAGGGAACACGTGAGGGAGGG + Intergenic
1130867713 15:87946627-87946649 GCCAGGGAAGAGGGGAGGGCAGG - Intronic
1130906040 15:88241518-88241540 CCCAGGGAGCTGCTCTGGGCTGG + Intronic
1131379793 15:91954423-91954445 CCCTGGAAACTGCAGAGGGCAGG - Intronic
1132327981 15:100987859-100987881 CCTAGGGGAGGGGTGAGGGCAGG + Intronic
1132566936 16:627863-627885 CCCAGGCAGCTGGGGAGGCCCGG - Exonic
1132615421 16:839121-839143 CCCTGGGAGCTGGAAAGGGCAGG - Intergenic
1132757163 16:1491288-1491310 CCGTGGGCACTGGCGAGGGCTGG + Intergenic
1132949136 16:2550825-2550847 CCCTGGCAACAGGTGAGGGCCGG - Intronic
1132965452 16:2651303-2651325 CCCTGGCAACAGGTGAGGGCCGG + Intergenic
1132975609 16:2709785-2709807 CCCAGGGCCCTGGTGAGGGGTGG + Intergenic
1133097527 16:3457850-3457872 TGCGGGGCACTGGTGAGGGCCGG - Intronic
1133196848 16:4177201-4177223 CGCAGAGAACGGGTGTGGGCTGG - Intergenic
1133204566 16:4225673-4225695 GCCAGGGAGCCGGTGGGGGCAGG - Intronic
1133866215 16:9646046-9646068 GTCAGGGGACTGGTGAGTGCAGG - Intergenic
1134023632 16:10938745-10938767 CCCTGGGAAGTGGGGAGGCCTGG - Intronic
1135976624 16:27112704-27112726 CCCTGTGAAGTGGTGAGGGTAGG + Intergenic
1136020061 16:27434458-27434480 CCCCGGGGACTGGTGAGGCCCGG - Intronic
1136295129 16:29297307-29297329 CCCAGGGAGGGGGTTAGGGCCGG + Intergenic
1137282039 16:46985324-46985346 CTCAGGGAAGAGGTCAGGGCTGG + Intergenic
1137715062 16:50593563-50593585 CCATGGGGACTGGTCAGGGCCGG - Intronic
1138390942 16:56669544-56669566 CTCAGGGAACTGGGCAGGCCCGG + Intronic
1140215024 16:73000224-73000246 CCCAGGGCACTGGAGAGAGGAGG + Intronic
1141136474 16:81468829-81468851 CCGAGGGGCCTGGTGAGGCCTGG + Intronic
1141481249 16:84308282-84308304 CCCTGGGAACAGGTCCGGGCCGG - Intronic
1142067875 16:88073081-88073103 CCCCGGGCACTGCTGAGGGCAGG + Intronic
1142101030 16:88271317-88271339 CCCAGGGAGGGGGTTAGGGCCGG + Intergenic
1142190801 16:88716466-88716488 CCCAGGGACCTGGCGAAGGGAGG - Exonic
1142694465 17:1626100-1626122 ACCAGAGAACTGTTGTGGGCAGG - Intronic
1142961329 17:3554089-3554111 CCCTGGGAACTGGGCAGGGCTGG - Intronic
1143041729 17:4043101-4043123 CTCAGGGAGATGGGGAGGGCGGG - Intronic
1143780112 17:9224826-9224848 CCCTGGGAGCTGATGGGGGCTGG + Intronic
1144269450 17:13602097-13602119 CCAATGGCACTGGAGAGGGCGGG + Intergenic
1146061887 17:29612094-29612116 CCTTGGGATCTGGTGGGGGCAGG + Exonic
1146687090 17:34848541-34848563 CCCAGTGAACTGGTAAGTGCAGG + Intergenic
1146693546 17:34892754-34892776 CCCAGGGCCCTGCTGAGGGGAGG + Intergenic
1147169327 17:38608960-38608982 TCCCAGGAACAGGTGAGGGCTGG - Intergenic
1147791308 17:43015787-43015809 CCCGGGGAAAGGGTGGGGGCAGG + Exonic
1149529953 17:57387119-57387141 CCCAGCTAACTGGTCTGGGCTGG - Intronic
1150225033 17:63519878-63519900 ACCAGTGAACTGGTGAGGCTGGG + Intronic
1150315681 17:64166855-64166877 CCCAGGGTAGGGATGAGGGCTGG + Intronic
1150492454 17:65583874-65583896 CCCAGGAGGCTGGTGGGGGCTGG + Intronic
1151365196 17:73612375-73612397 CACAGGGACCCGGTGAGGGTGGG - Intronic
1151476079 17:74344997-74345019 CCCAGGCAACAGCGGAGGGCAGG + Intronic
1152110903 17:78357405-78357427 GCCAGGGAAGTGGGGAGGGGGGG - Exonic
1152155003 17:78627180-78627202 GCCAGGGACCTGATGGGGGCTGG + Intergenic
1152250953 17:79212319-79212341 CCCAGGCAAATGGGGAGGGGAGG - Intronic
1152303783 17:79509737-79509759 CCCAGGGTTAGGGTGAGGGCTGG + Intronic
1152680524 17:81665612-81665634 TCCAGGAAGCTGGTGAGGCCCGG + Intronic
1152873516 17:82772354-82772376 CTCGGGGAGCTGGTGAGGGTGGG + Intronic
1154028354 18:10727312-10727334 CCAAGGGGACAGGTGAGGGAAGG - Intronic
1155126751 18:22885622-22885644 CCAAGGGAAGTGGTGACGGACGG + Intronic
1156757576 18:40547077-40547099 CTCAGGGAACAGGAGGGGGCTGG + Intergenic
1156898355 18:42272333-42272355 CTCAGAGAACTAATGAGGGCAGG + Intergenic
1157130972 18:45006979-45007001 CCCATGGAGCTGTAGAGGGCTGG + Intronic
1157200829 18:45658160-45658182 CCCAGGAAGCTGGGGAGGGATGG + Intronic
1157202302 18:45669307-45669329 CCCAGGGCACTGGAGAGGATGGG - Exonic
1159038180 18:63297477-63297499 GCCACGGCACTGGAGAGGGCAGG + Intronic
1159616856 18:70591248-70591270 CCCAGGGAGCTAGTGAATGCTGG + Intergenic
1159923814 18:74249283-74249305 CCCAGGGCACTCCTGAGGGAGGG + Intergenic
1160364654 18:78313805-78313827 GCCAGGGACATGGTGAGGCCAGG + Intergenic
1160624271 18:80192423-80192445 CCCAGGGGACGGGGGAGAGCAGG + Intronic
1160624285 18:80192460-80192482 CCCAGGGGACGGGGGAGAGCAGG + Intronic
1160624299 18:80192497-80192519 CCCAGGGGACGGGGGAGAGCAGG + Intronic
1161408005 19:4101195-4101217 CCCGGGGCTCTGGGGAGGGCGGG + Intronic
1163255583 19:16153918-16153940 CCCAAGAAACTGCTGTGGGCAGG + Intronic
1163255623 19:16154104-16154126 CCCAAGAAACTGTTGTGGGCGGG + Intronic
1163279571 19:16307258-16307280 CCCAGGGAACTCGGGACGGCGGG - Intergenic
1164443096 19:28294304-28294326 CACAGGGAACTGGCCAGGGAAGG + Intergenic
1164779399 19:30880413-30880435 TCCAGGGAACTGGTAAGGGAGGG + Intergenic
1165236846 19:34428559-34428581 CACATCGACCTGGTGAGGGCCGG + Exonic
1165732129 19:38152604-38152626 GCCAGGGAGCTGGTGGCGGCGGG - Intronic
1166884988 19:45954647-45954669 ACCAAGGAACTGGGGAGGGAGGG + Intronic
1166959963 19:46491465-46491487 TCCAGGGCACAGGTGAGGGGTGG + Exonic
1167049461 19:47069468-47069490 CCCTGAGACCTGGGGAGGGCAGG - Intronic
1167467828 19:49659389-49659411 CCCAGGGACCTGGTGGGTGATGG - Intergenic
1167517222 19:49930283-49930305 CCCTGGGAACTGGTTTGGGATGG + Intronic
1167569548 19:50278285-50278307 CCCAGGTAAGTGGGGTGGGCAGG + Exonic
1167735950 19:51294672-51294694 CCCAGGAAATGGGTGAGAGCCGG - Intergenic
1168183161 19:54677434-54677456 CCCAGGGGATTGGTTAGGCCAGG - Intronic
925168842 2:1738390-1738412 CCCAGAGCACTGATGTGGGCCGG + Intronic
925579137 2:5392478-5392500 CAAAGAGAACTGGTGAGGGGAGG - Intergenic
926060528 2:9801962-9801984 CCCAGGGATGTGGTGGGGGAAGG - Intergenic
926135117 2:10330996-10331018 CACAGAGAACTGGAGAGGCCGGG - Intronic
927452994 2:23224594-23224616 CCCAGGTATGTGGTGAGGGTGGG + Intergenic
927540298 2:23903984-23904006 GCCAGGGAACAGGTGATGACGGG + Intronic
927961761 2:27244785-27244807 CTCAGAGAAGTGGTGGGGGCCGG + Intergenic
928638895 2:33277091-33277113 GCCAGGGGACAGCTGAGGGCTGG - Intronic
929009509 2:37427132-37427154 CCCAACCAACTGCTGAGGGCAGG + Intergenic
929457835 2:42078506-42078528 CCCTGGGTACTGGCGAAGGCCGG - Intergenic
929564634 2:42976693-42976715 CTGAAGGAGCTGGTGAGGGCTGG + Intergenic
929943479 2:46352740-46352762 CCCAGGGACCCTGTGACGGCAGG - Intronic
931834104 2:66081076-66081098 CTCATGGAAATGCTGAGGGCTGG + Intergenic
932422928 2:71612042-71612064 CCCAGGGAGGTGGAGAGGCCTGG - Intronic
932654973 2:73602450-73602472 CCCAGGTAACTGGCCTGGGCTGG - Intronic
932663113 2:73674078-73674100 CCCAGGTAACTGGCCTGGGCTGG - Intergenic
933899502 2:86839577-86839599 CCCAGGGAGCTGGAGCAGGCTGG - Intronic
934845627 2:97659905-97659927 AACAGGGGACTGGTGAGGACCGG - Intronic
935708290 2:105875361-105875383 CCCAGGGGACTGGGCGGGGCAGG - Intronic
935781060 2:106509649-106509671 CCCAGGGAGCTGGAGCAGGCTGG + Intergenic
935782125 2:106517587-106517609 CCCAGAGAACTGGGGAAGGGAGG - Intergenic
936080235 2:109428020-109428042 GCCAGGGGGCTGGGGAGGGCTGG - Intronic
937358021 2:121210720-121210742 CACAGGGATGTGGTGTGGGCCGG - Intergenic
940876702 2:158904861-158904883 CCCAGGGCAGAGGTGAGGACTGG + Intergenic
943247287 2:185472749-185472771 TCAAGGGAGCAGGTGAGGGCTGG + Intergenic
943700079 2:190980066-190980088 CCCAGGGAAGTGGAGAGCTCTGG - Intronic
944336640 2:198542174-198542196 CCCTGGGCACTGGAGAGGGTGGG + Intronic
945947005 2:216004063-216004085 TTCAGGGAACTGAAGAGGGCAGG - Intronic
946192735 2:218016045-218016067 GCCAGGGAAAGGGGGAGGGCAGG + Intergenic
947617734 2:231569135-231569157 ACCAGGGCCCTGGTGAGGGCAGG + Intergenic
947774673 2:232697864-232697886 CCCAGGGACCAGGTGTGGACAGG - Intronic
948499695 2:238382829-238382851 TCCAGGGAACTGATGAAGGCAGG - Intronic
948609170 2:239155884-239155906 CCCAGAGAATTGGTGAGGGCAGG - Intronic
1169007024 20:2216092-2216114 CCCAGGGGACTGGTGAAGGATGG + Intergenic
1170587427 20:17745366-17745388 CCCAGGGCAGAGGTGAGGGTGGG + Intergenic
1172042033 20:32052552-32052574 CCCAGGAGCCTGGGGAGGGCTGG + Intronic
1172138339 20:32703327-32703349 CCCAGGGAAGGGAGGAGGGCAGG + Exonic
1172993109 20:39050313-39050335 CCCAGGGAGGGGGTGAGTGCGGG + Intergenic
1173148648 20:40547028-40547050 CCCAGGAGACTGCTGAGGGCAGG - Intergenic
1173153217 20:40585502-40585524 GCTATGGAGCTGGTGAGGGCTGG - Intergenic
1173229548 20:41183536-41183558 CCCAGGGAACTGGACCTGGCAGG - Exonic
1173346527 20:42205595-42205617 TCCAGCCAACTGGTGGGGGCAGG + Intronic
1173885404 20:46453280-46453302 CACAGGAAACTGGAAAGGGCAGG - Intergenic
1174059575 20:47823182-47823204 CCCAGGGAATTGGTCAGCGGAGG + Intergenic
1175503578 20:59466941-59466963 CTTGGGGACCTGGTGAGGGCTGG - Intergenic
1176045978 20:63092778-63092800 CCCAGGGAGCTGCTCAGGGCGGG - Intergenic
1176086282 20:63296964-63296986 CCCAGGGCTCTGGAGAGGGTTGG - Intronic
1176728547 21:10465816-10465838 CCCAGGTCCCTGGTGTGGGCAGG + Intergenic
1178256170 21:31054339-31054361 TCCAGGGAAATGCTGTGGGCGGG + Intergenic
1178885347 21:36480472-36480494 CTGAGGGAACTGGTCAGGGCTGG + Intronic
1179480182 21:41671980-41672002 CCCAGGGAGCTGCTGGGGGCCGG + Intergenic
1179643618 21:42762332-42762354 CCCAGGGCACTGCTGTGGCCAGG - Intronic
1179888861 21:44325940-44325962 CCCTGGAAACAGGTGAGGCCCGG - Exonic
1180126325 21:45792777-45792799 CTCAGGGAGTTGGAGAGGGCTGG + Intronic
1180730840 22:17980919-17980941 TGCAGGGCACTGGTGGGGGCCGG - Intronic
1180948076 22:19707797-19707819 CGGAGGGCACTGGTGAGGGCAGG - Intergenic
1181465135 22:23106862-23106884 CCCAGGGGAATGGGCAGGGCTGG + Intronic
1181499071 22:23305601-23305623 CCCAGGGAAGTGGTGGGGTGGGG - Intronic
1182020865 22:27080513-27080535 CCAATGGGACTGTTGAGGGCTGG - Intergenic
1182424874 22:30266660-30266682 CTCCGGGAACTGGGGAGGCCAGG - Intronic
1182810373 22:33111164-33111186 CCAAGTGAATGGGTGAGGGCTGG + Intergenic
1183314083 22:37127718-37127740 CCCAGGGAAGAGGTCAGGGCAGG + Exonic
1183319605 22:37157004-37157026 ACCAGGTCACTGGTGAGGCCTGG - Intronic
1183432661 22:37774995-37775017 CCCTGGGCAGGGGTGAGGGCAGG + Exonic
1183836597 22:40459193-40459215 CACAGGGTAGTGGTGAGGGAGGG + Intronic
1184158347 22:42683629-42683651 CCCTGGGAGCTGCTGTGGGCTGG + Intergenic
1184293913 22:43512112-43512134 ACCAGGGAACTGGAGAAGCCTGG - Intergenic
1184643998 22:45886332-45886354 CCCAGGGCACTGATGAGCACTGG + Intergenic
1184795803 22:46731722-46731744 CCCCGGGAGCAGGTGGGGGCAGG + Intronic
1184860309 22:47169702-47169724 CCCAGGGACCGGGGGAGGGACGG + Intronic
1185277598 22:49956589-49956611 CCCAGGGCAGTGGCGGGGGCAGG - Intergenic
1185394298 22:50578820-50578842 GCCAGGGGACTGGGGAGGGATGG + Intronic
949906998 3:8866056-8866078 CCCTCAGGACTGGTGAGGGCAGG + Intronic
950676130 3:14555372-14555394 CCCTGGGAAGGGGTGGGGGCGGG + Intergenic
950909046 3:16568605-16568627 GCCAGGGATCTGGTGAGGAATGG + Intergenic
951617479 3:24564100-24564122 ACCAGGGATGTGGGGAGGGCAGG - Intergenic
951997126 3:28743663-28743685 CCCAGGCAAATGAAGAGGGCTGG - Intergenic
952210711 3:31226602-31226624 CCCAGTGAAGTGGTGGGGGTGGG + Intergenic
952301329 3:32106747-32106769 CTCGGGGAACTGGTGAGCGGCGG + Exonic
952882990 3:37997199-37997221 CCCAAGGAACTGGGGAGTACGGG + Intronic
953883363 3:46702624-46702646 CCCAGGGAAGTCCTGAGGGGTGG + Intronic
953901212 3:46845292-46845314 CCCAGGGCCCTGGGCAGGGCTGG + Intergenic
954316278 3:49803432-49803454 CGCTGGGAACTGGTGAGGCTCGG + Exonic
954442631 3:50530165-50530187 CCCAGGGAAAGGGTGAGGAAAGG - Intergenic
954697356 3:52434929-52434951 CCCAGGGATCTGGGGTGGTCAGG - Exonic
954861671 3:53695577-53695599 CCCAGGGGACTGGTGTGGAAAGG + Intronic
955074526 3:55601102-55601124 ACCAGTAAACTGGAGAGGGCTGG + Intronic
956054915 3:65288615-65288637 CCCAGTGATCTAGTGAGGCCCGG + Intergenic
956054926 3:65288682-65288704 CCCAGTGATCTAGTGAGGCCTGG + Intergenic
959497874 3:107072441-107072463 CTCAGGGAACAGGAGAGGGAAGG + Intergenic
959598629 3:108154291-108154313 CAGAGGGATCTGGTGAGGGGAGG - Intergenic
960612606 3:119569066-119569088 CCAAGGGAAGTGGTGACGGACGG - Intergenic
961424277 3:126832766-126832788 CCCAGAGAAAGGGGGAGGGCTGG + Intronic
962269672 3:133968405-133968427 CTGAGTGAACTGGTGAGGACAGG - Intronic
962464879 3:135648971-135648993 GGCAGGGCACTGGTGTGGGCAGG + Intergenic
962812549 3:138972045-138972067 CCATGGGAACAGGGGAGGGCAGG + Intergenic
963533141 3:146496777-146496799 CCCAGGGTGGTGGTGGGGGCGGG + Intergenic
963676118 3:148314527-148314549 TGCAGGAAACTGGTGAGGGATGG - Intergenic
965537359 3:169837026-169837048 TCCAGGGAACAAGTGAGGGCTGG + Intronic
966866875 3:184262977-184262999 CCCAGGGAACTGGATGGGGGGGG + Intronic
966915142 3:184580597-184580619 ACCAGGGAACTGGTGTAGGTAGG - Exonic
966989182 3:185211278-185211300 CCCAGGGAAATGGGGAGGAAAGG + Intronic
967104550 3:186244821-186244843 CCCAGGGAAGCGGTGCAGGCTGG - Intronic
968067074 3:195764632-195764654 CCAAGGGAGCTGGAGAGCGCAGG - Intronic
968620274 4:1600805-1600827 GACAGGGAAGTGGTCAGGGCTGG - Intergenic
968725976 4:2247978-2248000 CCGAGAGCACTGGTGTGGGCTGG + Exonic
970859060 4:20681426-20681448 GCCAGGGGAGGGGTGAGGGCAGG - Intergenic
975515075 4:75238009-75238031 CCAAGGGAAGTGGTGATGGATGG + Intergenic
977796150 4:101167646-101167668 ACCTGGGAAGTGGTGAGGGTTGG + Intronic
977821858 4:101481090-101481112 CTCAGGGAATTGCTGAGAGCAGG + Intronic
980034297 4:127865880-127865902 CACAGGGAACTGTTGTGGGGTGG + Intergenic
981778420 4:148397165-148397187 CACGGGGAAATGGTGGGGGCTGG - Intronic
983711830 4:170726733-170726755 ACCAGGGACTTGGTGAGGACAGG + Intergenic
985013439 4:185607260-185607282 TCCAGGGAACTGGCCAGGGCTGG - Intronic
985896509 5:2752242-2752264 CGCAGGGAAGTGGGGAGGTCAGG + Exonic
989127847 5:38074298-38074320 CCCAGGGGACTGGTAAGGACAGG - Intergenic
991633635 5:68681369-68681391 ACCAGAGAACAGGTAAGGGCTGG - Intergenic
992168278 5:74076553-74076575 CCCAGGGGACAGGTGAAGCCAGG - Intergenic
992254003 5:74903528-74903550 CCCCAGGAACAGGTGAGGCCAGG - Intergenic
996677030 5:126188120-126188142 CCCCAGGAACTGGAGAGGCCAGG - Intergenic
997367805 5:133336920-133336942 CCCATGGATCTGGAGAGGCCTGG - Intronic
997756032 5:136400317-136400339 CCCAGGGGACAGGTCGGGGCAGG - Intergenic
998430256 5:142064224-142064246 CCCAGGGGACTGGCTGGGGCTGG + Intergenic
999391999 5:151199951-151199973 CCCAGCGAACACCTGAGGGCAGG + Intronic
999429288 5:151512154-151512176 CCCATGGGGCAGGTGAGGGCTGG - Exonic
1000144905 5:158444690-158444712 CCAAGGGAAGTGGTGACGGACGG - Intergenic
1000332058 5:160213381-160213403 CCCAGGGAAATGGTGGCTGCAGG + Intronic
1001289112 5:170443891-170443913 CCCAGGGCAGGGGTGGGGGCTGG + Intronic
1001405576 5:171474744-171474766 CCCAGGGAACTGGCCAGGGAGGG - Intergenic
1001581504 5:172801664-172801686 ACCAGGGAATTGGTGAGCCCAGG + Intergenic
1001753016 5:174145888-174145910 CTCTGGGAACTGGTGGGAGCAGG - Intronic
1001937481 5:175715588-175715610 CCAGGGGAACTGGAGAGAGCAGG + Intergenic
1002347104 5:178555770-178555792 CCCAGGGAACTGGTGAGGGCCGG - Intronic
1002918986 6:1552589-1552611 CCCAGTGATCTGGTGAGCGATGG + Intergenic
1003169902 6:3712966-3712988 CCCTGGGGACTGTGGAGGGCAGG - Intergenic
1003330375 6:5124045-5124067 CCCAGGGCCGTGGAGAGGGCGGG + Intronic
1003711014 6:8590178-8590200 GCCTGGGATCGGGTGAGGGCTGG + Intergenic
1003965229 6:11246443-11246465 GCCAGGTAACTGGTGGGGCCCGG - Intronic
1004398285 6:15265724-15265746 CCCAGGGACCTGATGAGCCCGGG + Intronic
1004878685 6:19983784-19983806 CAAAGAGAAATGGTGAGGGCGGG - Intergenic
1005492843 6:26362323-26362345 TCCAGGCAACGGGTCAGGGCTGG + Intergenic
1005497009 6:26396443-26396465 TCCAGGCAACGGGTCAGGGCTGG + Intergenic
1005501813 6:26435256-26435278 TCCAGGCAACAGGTCAGGGCTGG + Intergenic
1007701528 6:43769108-43769130 GCCAGGGGGCTGGTGGGGGCGGG - Intergenic
1007964965 6:45995951-45995973 CACTGGGGACTGTTGAGGGCTGG + Intronic
1008798750 6:55340774-55340796 CCAAGGGAAGTGGTGACGGATGG + Intronic
1010820159 6:80405981-80406003 CCCTGGGGCCTGGTGGGGGCGGG - Intergenic
1011256505 6:85427169-85427191 CCCAGGGAACTAGGGAGCACAGG + Intergenic
1013459610 6:110362597-110362619 TTCAGGGGAGTGGTGAGGGCTGG + Intergenic
1013477302 6:110520949-110520971 CTCAGGTATCTGGTGAGAGCAGG - Intergenic
1016903736 6:149128820-149128842 CCCAGAGCACTGGGGAGGGAGGG + Intergenic
1017449149 6:154537552-154537574 GACAGGGAACTGATGAGCGCGGG - Intergenic
1018654233 6:166018674-166018696 GACAGGGTACTGGTGGGGGCTGG - Intergenic
1018664935 6:166126719-166126741 CAGAGGGAACGGGTGAGGCCTGG + Intergenic
1018848325 6:167570578-167570600 TCCATGGAACTGGGAAGGGCTGG - Intergenic
1018904101 6:168065131-168065153 CCCTGGGAGCTGGTGTGGGGAGG - Intronic
1019482034 7:1271298-1271320 CCCCAGGAACTGGGGAGGCCGGG + Intergenic
1019631437 7:2051811-2051833 CCCAGGCAGCTGGTGGGGGATGG - Intronic
1019705231 7:2494368-2494390 CCCAAGGAAGCGGTGGGGGCAGG + Intergenic
1020076202 7:5260614-5260636 CCCAGGGTACTGCAGAAGGCAGG - Intergenic
1020257006 7:6508101-6508123 CACAGGGCACGGGTGGGGGCAGG + Exonic
1021187020 7:17576241-17576263 TCCATGAAACTGGTGAGGGGTGG - Intergenic
1022969373 7:35503539-35503561 CCCAGGAAATGGGTGAGGACTGG + Intergenic
1023830218 7:44034840-44034862 CCCAGGAGGCTGGTGTGGGCTGG + Intergenic
1023879385 7:44309596-44309618 CCCAGGGTGCGGGTGTGGGCTGG + Intronic
1024640041 7:51320998-51321020 CCCAGGGAAGTGGAGACTGCTGG + Intergenic
1025202884 7:56972957-56972979 CCCAGGGTACTGGAAAAGGCAGG + Intergenic
1025669060 7:63603969-63603991 CCCAGGGTACTGGAAAAGGCAGG - Intergenic
1026209705 7:68293124-68293146 CCCAGGGACTTGGTGAGTGCAGG - Intergenic
1026232052 7:68493522-68493544 CCCAGGGATATGGTTAGGGGAGG - Intergenic
1026846711 7:73702793-73702815 CCCTGGGTGCTGGTGTGGGCTGG + Intronic
1026922874 7:74169438-74169460 TCAAGGGAACTGGTGAAGCCTGG + Intergenic
1029688675 7:102165971-102165993 CCCAGGTGACTGCTGAGGGGAGG + Intronic
1029740536 7:102489127-102489149 CCCAGGAGGCTGGTGTGGGCTGG + Intronic
1029758533 7:102588299-102588321 CCCAGGAGGCTGGTGTGGGCTGG + Intronic
1029776471 7:102687378-102687400 CCCAGGAGGCTGGTGTGGGCTGG + Intergenic
1029962876 7:104707202-104707224 CCCTGGGAATTGGTGAGCTCTGG - Intronic
1030133145 7:106220118-106220140 CCATGGCAACTGGTGGGGGCAGG - Intergenic
1030846498 7:114420086-114420108 CCCAGGGAGTTGCTGTGGGCGGG + Intronic
1031086053 7:117302987-117303009 TCCTGGCAACTGGAGAGGGCAGG + Intronic
1031286357 7:119873962-119873984 CACAGGGAAAAGGTGAGGGATGG + Intergenic
1032091498 7:128913835-128913857 CCAAGGTCACTGGTGAGTGCCGG - Intergenic
1033226072 7:139563378-139563400 CCCAGGGCAGTGGTGACAGCAGG + Exonic
1033367571 7:140683460-140683482 CCCAGGCATGTGGTGAGAGCTGG - Intronic
1033367781 7:140684576-140684598 CCCAGGCATGTGGTGAGAGCCGG + Intronic
1033582579 7:142750778-142750800 CCCAGGGAACTACTGAGGTTGGG + Intronic
1033584136 7:142761698-142761720 CCCAGGGAACTACTGAGGTTGGG + Intronic
1033855739 7:145559323-145559345 CTCAGGGGACTGTTGTGGGCTGG - Intergenic
1034830819 7:154305889-154305911 CCCAGGGAACTCGTTAGATCTGG - Intronic
1035540916 8:437334-437356 GCGAGGGAACTGGTGAGCTCAGG + Intronic
1036645424 8:10609167-10609189 CCCAGGGCTGTGCTGAGGGCTGG + Exonic
1037821720 8:22138381-22138403 CCCAGGCAGCTGGTGCAGGCAGG + Exonic
1038397789 8:27259873-27259895 GCCAGTGAGCTGGAGAGGGCAGG + Intergenic
1038427562 8:27474094-27474116 CCCGGGGAACTGCAGAGGGCTGG + Intronic
1039041462 8:33412470-33412492 CACAGGGAAATGCTGAGGCCTGG + Intronic
1040518136 8:48150995-48151017 GCCAATGAACTGGTCAGGGCTGG + Intergenic
1040581737 8:48704132-48704154 CCCAGGGTGCTGGTGTGGGCTGG - Intergenic
1040582519 8:48708943-48708965 CCCAGGGTGCTGGTGTGGGCTGG - Intergenic
1041792656 8:61714380-61714402 CCGCGGGGGCTGGTGAGGGCTGG + Exonic
1043388093 8:79767830-79767852 CCCAGGGCCCTGGGGAGGGCGGG + Exonic
1043849290 8:85197840-85197862 CCCAGGCAACTGTCCAGGGCTGG + Intronic
1044205298 8:89486292-89486314 CCCAGGGATCAGGTGAGAGTGGG + Intergenic
1044839507 8:96325922-96325944 CCCAGGGAAGGAGTGAGGGGTGG + Intronic
1046721049 8:117619560-117619582 CCCAGGGGAGTGGTAAGAGCTGG - Intergenic
1048338264 8:133519096-133519118 CAGAGGGGCCTGGTGAGGGCAGG + Intronic
1049012170 8:139894426-139894448 CCCAGGCCACTGGTGAGGTGGGG - Intronic
1049269593 8:141687231-141687253 CCCTGAGAATTGGGGAGGGCAGG - Intergenic
1049351328 8:142166346-142166368 GCCAGGGCACTGGAGAGGGCAGG - Intergenic
1049363817 8:142226849-142226871 CCCAGGGAGCAGGTGAGGTGGGG - Intronic
1049370188 8:142260699-142260721 CCCCAGGAACTGGTGAGGCTGGG - Intronic
1049478698 8:142809895-142809917 CCGAGGGAAGAGCTGAGGGCAGG + Intergenic
1049592242 8:143467928-143467950 CCTGGGGATCTGGTGAGGCCTGG + Intronic
1049665609 8:143841291-143841313 CCCTGGGAACGGGCGGGGGCGGG - Intergenic
1051774476 9:20620384-20620406 CCCAGAGGACTGGTGAGGGCTGG + Intronic
1052235950 9:26213697-26213719 CCCAGGGAATTCTTGGGGGCTGG + Intergenic
1052745834 9:32440383-32440405 CCCTGAGCCCTGGTGAGGGCGGG - Intronic
1053381537 9:37653011-37653033 AGCAAGGAACTGGTGAGAGCTGG + Intronic
1054872245 9:70058524-70058546 CCCAAGGGCCTGGTGAGGGTGGG + Intronic
1055826897 9:80338444-80338466 GCCAGGGAACTGGGGAGGGATGG - Intergenic
1056120902 9:83487604-83487626 CCCCAGGAACTGGCTAGGGCTGG - Intronic
1056994548 9:91443771-91443793 CTCATGGAGCTGGTGGGGGCTGG - Intergenic
1057216249 9:93230429-93230451 CCCAGGGCACAGCTCAGGGCAGG + Intronic
1059284636 9:113161997-113162019 CCCATGGAACTGGTGAGATTTGG - Intronic
1060590184 9:124811491-124811513 CCCAGTGACCAGGTCAGGGCTGG - Exonic
1060666518 9:125435318-125435340 CAGAGGGACATGGTGAGGGCGGG - Intergenic
1060856237 9:126916058-126916080 CCCAGGGGCCTGGTGAGGATAGG + Intronic
1060968418 9:127724375-127724397 ACCAGGGCACTGGGGAGGGGGGG + Intronic
1061060141 9:128246153-128246175 GCCAGGGGGCTGGTGAGGGGTGG - Intronic
1061147415 9:128808090-128808112 CCCAGGATACTGAGGAGGGCTGG + Exonic
1061152610 9:128837492-128837514 CCCAGGGAAGGCCTGAGGGCTGG - Intronic
1061271368 9:129545391-129545413 CCCAGGGGACTGGGGAGGATGGG - Intergenic
1061408866 9:130407512-130407534 ACCAGGGAAGTGTTTAGGGCAGG + Intronic
1061828198 9:133274885-133274907 CCCCGGGTCCTGGTGAGAGCGGG - Intronic
1062034779 9:134378132-134378154 CCCAGGGTTCTGGGCAGGGCCGG + Intronic
1062430571 9:136525287-136525309 CGCAGGGAACAGGTGAGACCAGG - Intronic
1187286678 X:17911824-17911846 CACAGAGAAAGGGTGAGGGCGGG - Intergenic
1188611169 X:32099727-32099749 CCCTGGGAACTGTTGTGGGGTGG + Intronic
1190882308 X:54500470-54500492 CCAAGGGATCTGGTGATGGTAGG + Intergenic
1191175948 X:57501984-57502006 CCAAGGGAAGTGGTGACGGATGG + Intergenic
1195164402 X:102204514-102204536 CCCAGGGAACTAGTGTCTGCTGG + Intergenic
1195194457 X:102482580-102482602 CCCAGGGAACTAGTGTCTGCTGG - Intergenic
1197770141 X:130084379-130084401 GCCAGGGAGCTGGTGGGGGAGGG + Intronic
1198137377 X:133767625-133767647 GCCAGGGGACTGTTGAAGGCTGG + Intronic
1198334726 X:135655281-135655303 CCCAGGGAACTTGTGAGTCTTGG + Intergenic
1199860099 X:151793708-151793730 CCCCGTGCACTGGTGAGAGCTGG + Intergenic
1200136922 X:153879738-153879760 GCCAGGGAACAGGTGGGGGTCGG + Intronic
1200246806 X:154530856-154530878 CCCCAGGAGCTGGAGAGGGCAGG + Intergenic
1201464063 Y:14260542-14260564 CTCTTGGAACTGGAGAGGGCTGG + Intergenic