ID: 1002347106

View in Genome Browser
Species Human (GRCh38)
Location 5:178555774-178555796
Sequence GCATCCCAGGGAACTGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347106_1002347115 4 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347106_1002347118 14 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347106_1002347117 10 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347106_1002347120 23 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347106_1002347119 22 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347106_1002347116 7 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347106 Original CRISPR GCATCCCAGGGAACTGGTGA GGG (reversed) Intronic
900143734 1:1149343-1149365 GGGACCCAGGGACCTGGTGAGGG + Intergenic
900476231 1:2877649-2877671 GCATCCCGGGACACGGGTGAAGG + Intergenic
900683271 1:3930866-3930888 GCAGCCCCGGGAGCTGGAGAGGG + Intergenic
900992516 1:6104471-6104493 GCATCCCAGGGCACAGGGCAGGG + Exonic
901612351 1:10508857-10508879 AGATCCCAGGGTACTGGGGAAGG + Intronic
902392123 1:16112913-16112935 GCATCCCAGGAAACCAGAGATGG + Intergenic
902677000 1:18015738-18015760 GCTTCCCAGGGAATTGGTGAGGG - Intergenic
903515982 1:23911373-23911395 GCATGCCAGGGAAGTGGGCAAGG + Intronic
906066745 1:42986255-42986277 CCATCCCAGGCAACAGGGGAGGG - Intergenic
907190273 1:52642218-52642240 CCACCCCAGGGACCTGGAGATGG - Intronic
908498766 1:64722020-64722042 GGATCCCAGGGAAAATGTGATGG - Intergenic
911148210 1:94571744-94571766 GCCTCCCAGGAAAGTGGAGAAGG + Intergenic
912276234 1:108261749-108261771 CCAGCCAAGGGAAGTGGTGAGGG + Intergenic
912291994 1:108432609-108432631 CCAGCCAAGGGAAGTGGTGAGGG - Intronic
915659369 1:157389376-157389398 GCAGCCAAGAGAAGTGGTGAGGG - Intergenic
915700964 1:157796231-157796253 GCATCCAAGCTAACTGGGGAAGG - Intronic
916435923 1:164777791-164777813 GAATCCCAGGGAACTGACGTTGG - Intronic
918253030 1:182721567-182721589 GCATCTCAGGGATCTGCTAAGGG + Intergenic
919835172 1:201568392-201568414 GCAGCCCCGGGAAGCGGTGATGG - Intergenic
919935783 1:202249797-202249819 GCAGCCCAGGCAAGTGATGATGG - Intronic
920202105 1:204265990-204266012 TGATCCCAGGGAATTGGAGAGGG - Intronic
923647404 1:235837815-235837837 GCATGCAAGGGAACGGGTGATGG + Intronic
1062761052 10:19864-19886 ACATCTCAGGGAACTAGAGAAGG + Intergenic
1062913411 10:1229246-1229268 GCATCCCAGGAAAGTGGGGCTGG + Intronic
1065128321 10:22595734-22595756 GCAGCACAGGGTAATGGTGAGGG + Intronic
1067089466 10:43259248-43259270 GCACCCCAGGGACCAGCTGAGGG + Intronic
1068369688 10:56096244-56096266 CCAGCCAAGGGAAGTGGTGAGGG - Intergenic
1068615821 10:59115121-59115143 GCATCGAAGGGGACTGTTGATGG + Intergenic
1069605360 10:69735559-69735581 GCATTCCAGGGAACAGGTGTGGG - Intergenic
1072518730 10:96211623-96211645 GCTTCCCAGGGTGCTGGGGAAGG - Intronic
1072751688 10:97985333-97985355 TCAGCTCATGGAACTGGTGATGG - Intronic
1073105195 10:101028888-101028910 GCGTGCCAGGGCACTGGTGGAGG + Intronic
1074379893 10:112970745-112970767 GAAGGCCAGGGAACTTGTGATGG - Intronic
1074497537 10:113992949-113992971 GCAGCCCAGGCCACTGGTGGAGG - Intergenic
1075221895 10:120592341-120592363 ACACCCCAGGGAAGTGGTGCTGG + Intergenic
1075483488 10:122801098-122801120 GCATCCCCAGGAACTGGGGCTGG - Intergenic
1076192257 10:128491201-128491223 TCAGCCCAGGGAACTGGAGTGGG - Intergenic
1076292989 10:129361816-129361838 GAATGACAGGGAACTGGGGAAGG + Intergenic
1077863858 11:6207070-6207092 GCATCCCAGGAAAGTGATGGTGG - Intronic
1078564047 11:12398338-12398360 GCATGACAGGGACCAGGTGAGGG + Intronic
1078578834 11:12523427-12523449 TCATCCCAAGGCACTGCTGAAGG - Intronic
1078715679 11:13836901-13836923 GCATCCCTGGGAAGTGGACAGGG + Intergenic
1079305684 11:19319312-19319334 GCCTCCCAAGAAACTGGTGCTGG + Intergenic
1083505944 11:63157357-63157379 GCATCTCTGGGCACTGGGGAGGG - Intronic
1083617164 11:64032026-64032048 CCATCCCAGGGCAGTGGTCAGGG - Intronic
1084179447 11:67439100-67439122 GCTTCCGAGGGAGCTGTTGATGG - Intronic
1084790118 11:71469803-71469825 GCATCCCAGGTAGCTGGTGTTGG - Intronic
1085371428 11:76010206-76010228 GTATCCCAGGAAACTGGTACGGG - Intronic
1085908839 11:80797724-80797746 CCAGCCAAGGGAAGTGGTGAGGG + Intergenic
1088113843 11:106294500-106294522 GCACTCCATGGAACTGGAGAAGG + Intergenic
1089362649 11:117901255-117901277 GCATCCCAGGGCTCTGACGAAGG - Intronic
1090803059 11:130186388-130186410 AAATCCCAGGGCAATGGTGAAGG + Intronic
1091698166 12:2641923-2641945 TCCTCCCAGGGGACTGCTGATGG - Intronic
1094133445 12:27099188-27099210 CCATCTCATGGACCTGGTGAAGG - Intergenic
1095666639 12:44809661-44809683 GCACACCAGGGCACTGCTGATGG + Intronic
1097592205 12:61587995-61588017 GCCTCCCAGGGAAGTGGAAAAGG - Intergenic
1100206569 12:92356366-92356388 GCATCCTAGGGAAGTAGTGAAGG - Intergenic
1100901377 12:99244792-99244814 GCATCCCATCTAACTGGTAAAGG + Intronic
1100980310 12:100157874-100157896 GGCTCCCAGGGAAGGGGTGAGGG + Intergenic
1102777956 12:115537199-115537221 CAGTCCCAGGGACCTGGTGATGG + Intergenic
1102866303 12:116377619-116377641 CCTTCCCAGGGAACTCTTGATGG + Intergenic
1103736090 12:123061733-123061755 GCATCCAAGGGAGCTTCTGAAGG + Intronic
1104346167 12:128001177-128001199 GGATGCCAGGGAGATGGTGAAGG + Intergenic
1104503657 12:129310253-129310275 GGATGCCAGGGAACCGGTCAGGG + Intronic
1106161832 13:27208136-27208158 GTATCCCAGGGAACTGGGCCAGG + Intergenic
1106964198 13:35039185-35039207 GCATCTCTGGGTGCTGGTGAAGG - Intronic
1107243380 13:38264574-38264596 CCAGCCAAGGGAAGTGGTGAGGG + Intergenic
1113400606 13:109989257-109989279 GCACCCCAGGGAGCTGGAGCTGG - Intergenic
1113508522 13:110832867-110832889 GCAGCCCCGGGAGCTGGGGAGGG + Intergenic
1113638662 13:111941247-111941269 GCATCCCAGGGAAATGAGGCTGG + Intergenic
1114072790 14:19127833-19127855 GCATCTCTGGGTGCTGGTGAAGG - Intergenic
1114525290 14:23364328-23364350 GCAGCCCAGCTGACTGGTGAGGG + Intronic
1116079148 14:40151068-40151090 GCTTTCCAGGCAACTGTTGATGG + Intergenic
1118131344 14:62967433-62967455 GCTTCCCTGGGAACTGATGAAGG - Intronic
1118150490 14:63184032-63184054 GCATCGCAGGCAACGGGAGAAGG - Intergenic
1121103785 14:91267667-91267689 GGATCCCATGGTACTGCTGAAGG + Intergenic
1121328759 14:93036627-93036649 GCACCCCAGGGGCCGGGTGAGGG + Intronic
1122227187 14:100286656-100286678 ACTTCCCAGGGAACTGGGAAAGG - Intergenic
1122325368 14:100878410-100878432 GCACCCCTGGGGACTTGTGAGGG + Intergenic
1123000682 14:105292633-105292655 GCATCCCTGAGAGCTGGGGACGG + Intronic
1123882647 15:24690090-24690112 GCCCCCCAGGAAACTGGAGAAGG + Intergenic
1127772705 15:62243976-62243998 GGCTCCCAGGGAAGGGGTGAGGG + Intergenic
1128338033 15:66800908-66800930 GCACCCCAGGGTCCTTGTGAGGG + Intergenic
1128608331 15:69054889-69054911 GCATCCCAGGGAAGTGAGCATGG - Intronic
1129407463 15:75328801-75328823 CCATCCCTGGGATCTGGTGTTGG + Intergenic
1129848829 15:78780396-78780418 CCACCCCAGGGATCTGGTCATGG + Intronic
1130964301 15:88685803-88685825 GCATCCCAGGGGAGGGGTCATGG + Intergenic
1131074391 15:89486213-89486235 CCACCCCAGGGAACAGGTGCTGG - Intronic
1131212549 15:90510378-90510400 GCTTCCCAGGGCACAGGGGAGGG - Intergenic
1132904255 16:2274058-2274080 GCATCCCAGGGAAATCCTCAAGG - Intergenic
1134149021 16:11791159-11791181 GCGTCCCAAGCAACTGCTGAAGG - Intronic
1135727132 16:24863910-24863932 GCTTTCCAGGGAACAGGTGACGG - Intronic
1136477390 16:30521998-30522020 ACATCCCAGGGCAGGGGTGAGGG - Exonic
1137728033 16:50670161-50670183 TCATCCCAGGGGACTGCAGATGG - Intronic
1137789478 16:51162954-51162976 ACATCCCAGGGTTCTGCTGAGGG - Intergenic
1138347992 16:56331629-56331651 CCCACCCAGGCAACTGGTGATGG + Intronic
1141589365 16:85057622-85057644 GACTCCCAGGGAACTTGTGTTGG + Intronic
1142069195 16:88081059-88081081 CCATCTCAGGGAACGGGAGAGGG - Intronic
1142196448 16:88741471-88741493 ACATCCACGGGAGCTGGTGAGGG - Exonic
1143016083 17:3892052-3892074 GGATCCCAGGGAAGTGGCGCTGG - Intronic
1143020967 17:3917030-3917052 GCCCCCCATGGCACTGGTGACGG - Intergenic
1143531601 17:7508253-7508275 GCATCCCGGGGAAATGGTGGGGG + Exonic
1143632286 17:8146196-8146218 GGATCCCAGGGAAAAGGGGAAGG + Intronic
1145899573 17:28481518-28481540 GCACCCCAGGTGACTGGTTAGGG + Intronic
1150874407 17:68953173-68953195 GCTTCCCAGAAAACTGATGATGG - Intronic
1151340443 17:73467537-73467559 GAATCCCAGGGAAGTGGGGCTGG + Intronic
1151450674 17:74196611-74196633 GCAGCCCAGGGAGCGGGTCAGGG + Intergenic
1151470345 17:74314051-74314073 ACATCCCAGGGGAGTGGGGAAGG + Intronic
1152280621 17:79383097-79383119 GGACCCCAGGGCTCTGGTGAAGG - Intronic
1152408998 17:80112569-80112591 CCACCCCAGGGCGCTGGTGAAGG + Intergenic
1152542934 17:80985878-80985900 TCAGGCCGGGGAACTGGTGAGGG - Intergenic
1152953959 18:20218-20240 ACATCTCAGGGAACTAGAGAAGG + Intergenic
1153992673 18:10414229-10414251 GAAACCCAGGTATCTGGTGATGG - Intergenic
1155841976 18:30658094-30658116 CCAGCCAAGGGAAGTGGTGAGGG + Intergenic
1156237195 18:35216923-35216945 GCCCCCCAGGAAAGTGGTGAAGG - Intergenic
1156328923 18:36101260-36101282 CCAGCCAAGGGAAGTGGTGAGGG - Intergenic
1160012597 18:75117132-75117154 GCATCCCTGTGGACTGTTGAAGG - Intergenic
1162427122 19:10603272-10603294 GCACCACAGGGCGCTGGTGATGG - Intronic
1162782459 19:13013366-13013388 GCTTCCGAGGGGACTGGGGACGG - Intronic
1163282063 19:16324463-16324485 GCATCCCGGGGACCTGGAGCGGG - Intergenic
1163493061 19:17628126-17628148 GCATCTCTGGGGACTGGTGGGGG + Intronic
1165152890 19:33771343-33771365 GGCTCCCAGGGAACTGCTTATGG - Intronic
1165732132 19:38152608-38152630 GCCTGCCAGGGAGCTGGTGGCGG - Intronic
1166807326 19:45495034-45495056 GCAGCTCAGGGACCTGCTGAGGG - Intronic
1167163206 19:47780774-47780796 GCATTCCTGGGAGCTGGGGAGGG + Intronic
1168591119 19:57634858-57634880 TCTACCCAGGGAACTGGGGAAGG - Intronic
926886915 2:17606443-17606465 GCTTCCCAGAGCAGTGGTGAGGG + Intronic
927591740 2:24362571-24362593 GCATATCAGTTAACTGGTGAAGG - Intergenic
928407043 2:31022654-31022676 GCTTCCTAAGGAACTGGGGAGGG + Intronic
931447798 2:62341432-62341454 GCATTCCACAGACCTGGTGATGG + Intergenic
931645458 2:64417772-64417794 GCATCTCAGGGATCTGGTTAAGG + Intergenic
932865325 2:75335480-75335502 GCATCCCATGCAATTGGTTAGGG + Intergenic
933868169 2:86543972-86543994 GGTTGCCAGGGAACTGGGGAGGG - Intronic
935648699 2:105363702-105363724 GCATCCCTGGGAAGGGCTGAGGG - Intronic
937899538 2:127007698-127007720 GCATCCCAGGTAACTATTTATGG + Intergenic
938224338 2:129602807-129602829 ACAGCCAAGGGAAGTGGTGAGGG - Intergenic
939238196 2:139524575-139524597 GCATAACAGGAAAGTGGTGAAGG - Intergenic
939643774 2:144671565-144671587 ACATGCCAGGGAACTGAGGAAGG - Intergenic
943447062 2:187999852-187999874 TCATCCCAGGGATGTGGGGATGG + Intergenic
945361457 2:208900267-208900289 GCCTCCCAGAAAAGTGGTGAAGG - Intergenic
946352643 2:219165334-219165356 GCAGCCCAGGGAACTGGTGGAGG + Exonic
1168748257 20:263539-263561 GCCTCCCAAGTAGCTGGTGATGG + Intergenic
1169007021 20:2216088-2216110 GAGCCCCAGGGGACTGGTGAAGG + Intergenic
1171464295 20:25317009-25317031 ACAGCCCAGGGAACAGGTGTGGG + Intronic
1172893969 20:38286636-38286658 GGAGCCCAGGGAGCTGGAGAGGG + Intronic
1174075217 20:47930351-47930373 GAAACACAGGGGACTGGTGATGG + Intergenic
1176917445 21:14643846-14643868 GCATCTCTGGGATCTGGGGAAGG + Intronic
1180142965 21:45903498-45903520 GCATCCCTGGGGCCTGGTGGTGG + Intronic
1180731097 22:17983252-17983274 GGGTCCCAGGGAAATGGGGAGGG - Intronic
1184778958 22:46636691-46636713 TCCTGCCAGGGACCTGGTGAGGG - Intronic
949936570 3:9120674-9120696 ACAACCCAGGGAAGTGGAGAGGG - Intronic
951702683 3:25511911-25511933 GCATCCGGGGGAACTGATGGAGG + Intronic
952907000 3:38146361-38146383 ACATCCCAGGGTAGAGGTGAGGG - Intergenic
955359304 3:58259224-58259246 ACAGCCCAGGGAACTGTTGGGGG - Intronic
960383191 3:116989480-116989502 GCATCCCAGAGACCTGATGCTGG + Intronic
960585374 3:119316419-119316441 GCTTCCTAGGGAAATGGTGGGGG - Intronic
961528831 3:127526957-127526979 GCCTCCCAGGCAACTGCTCAGGG - Intergenic
961858097 3:129893175-129893197 GCATCCCAGGGCCGAGGTGAGGG - Intronic
962151817 3:132901901-132901923 GCATCTCTGGGCACTGGGGAAGG + Intergenic
964620831 3:158718649-158718671 GCATCCCAGAGAAATAGTGATGG + Intronic
967279978 3:187812883-187812905 GCATCCCAGGGAAGCCGTGGTGG - Intergenic
967434621 3:189430352-189430374 GCAACCCAGGCCACTGGGGATGG + Intergenic
967988885 3:195116629-195116651 GCGTCCCAGGGTAAGGGTGAGGG - Intronic
968768298 4:2486592-2486614 GCTTCCCAGGGAAGTAGTAATGG + Intronic
969862523 4:10048722-10048744 GCATCCCAGGAAAATGGCAAGGG + Intronic
970561342 4:17284805-17284827 GAATCTCAGGCAAGTGGTGAGGG + Intergenic
976023522 4:80660844-80660866 ACATCCCTGGGTACTGCTGAAGG - Intronic
977555104 4:98480482-98480504 GCATCCCAGGGAAGTGAGGAAGG - Intronic
979640854 4:123011919-123011941 GCTTCCCAGGAAAGTGGAGAAGG + Intronic
980855171 4:138431356-138431378 CCACCCAAGGGAAGTGGTGAGGG + Intergenic
983169646 4:164521233-164521255 CCAGCCAAGGGAAGTGGTGAGGG - Intergenic
985112641 4:186561913-186561935 GCTTCCCAGGGAGTTGGTAATGG + Intergenic
986813491 5:11384329-11384351 GCATCCCATAGACCTGTTGATGG - Intronic
989107950 5:37880898-37880920 CCATGCCAGGGAACTGGACAAGG + Intergenic
990551706 5:56887449-56887471 GCATCAAAAGGAACTGGTGCAGG + Exonic
993020516 5:82585251-82585273 CCACCCCAGGGAGGTGGTGAGGG - Intergenic
994304910 5:98191478-98191500 GCATCCCAGGGACCTCTTCAAGG - Intergenic
995128457 5:108604081-108604103 GAATCCCAGGACAGTGGTGAAGG + Intergenic
997217905 5:132129647-132129669 ACAGCCAAGGGAAGTGGTGAGGG - Intergenic
997834553 5:137181759-137181781 TCAGCTCAGAGAACTGGTGATGG - Intronic
998518716 5:142780849-142780871 GAATTCCTGGGAGCTGGTGAGGG + Intronic
1002160042 5:177309680-177309702 GCAAGCCAGGGAACTGGGCATGG + Intronic
1002347106 5:178555774-178555796 GCATCCCAGGGAACTGGTGAGGG - Intronic
1002807404 6:590522-590544 TCCTCCCAGGGACCTGATGAGGG + Intronic
1005841856 6:29748899-29748921 GCACCCCAGGGAGCTGCTGCTGG - Intergenic
1006288140 6:33113704-33113726 TCAGCCCTGGGAACTGGAGAGGG + Intergenic
1006339734 6:33440306-33440328 GGATTCCAGGGAAATGGGGATGG - Intronic
1006800155 6:36754536-36754558 GAATCCCAGGGAACTGGCCTGGG + Intronic
1006906580 6:37537182-37537204 CAATCCCAGGGAGCTGGAGAAGG - Intergenic
1007342316 6:41199159-41199181 GCATCCCAGGGAATTCTTGTGGG + Intronic
1008177725 6:48288932-48288954 GCATCCCTGGGCACTGGGAAAGG - Intergenic
1008653648 6:53588939-53588961 GGATCCCAAGGAACAGATGAGGG - Intronic
1009740307 6:67734776-67734798 CCAGCCAAGGGAAATGGTGAGGG - Intergenic
1013232815 6:108172031-108172053 GCATCCCAGGCAAGTGATCAGGG - Intronic
1013697230 6:112718019-112718041 GCATCCCAAGGTAATGGTGATGG + Intergenic
1015083193 6:129253375-129253397 GCAGCACAGGGAAATGATGAGGG - Intronic
1016255516 6:142100530-142100552 GCTTCCCAGGGGACTGGAGGAGG + Intergenic
1019187676 6:170230354-170230376 GCATTCCAGGGCACTGGAGGTGG + Intergenic
1019518304 7:1449161-1449183 GGCTCCCAGGCAACAGGTGAGGG + Intronic
1020935773 7:14461914-14461936 GCATCCCAGGGATGAGGTCAAGG - Intronic
1022088814 7:27094709-27094731 GCAGCTCACGGAACTGGAGAAGG - Exonic
1023488804 7:40715367-40715389 GGATGCCAGGGAACAGGAGATGG - Intronic
1024961532 7:54981682-54981704 GCATCCCATGGGACTGGCTAGGG - Intergenic
1024976177 7:55115939-55115961 GCTTCCCATGTAACTGGAGAGGG + Intronic
1026015394 7:66667466-66667488 TCAGCCCAGGGACCAGGTGAGGG - Intronic
1027157699 7:75780211-75780233 GCCTCCCAGGAAAGTGGAGAAGG - Intronic
1029599050 7:101553248-101553270 GGCCCCCAGGGAACTGGAGAGGG + Intronic
1031259825 7:119504308-119504330 GCATCCCAGGGAGGTATTGATGG - Intergenic
1032901981 7:136320629-136320651 TCATCCCAGGGACCTGAGGATGG - Intergenic
1034449983 7:151132125-151132147 GCAGCCCAGGGTGCTGGAGAAGG + Intronic
1035238919 7:157517524-157517546 GCCTCCCTGGGAAAAGGTGATGG + Intergenic
1035727468 8:1833797-1833819 GCAGCACAGGGAGCTGGGGATGG - Intronic
1036935980 8:13003292-13003314 GTATCCCAGGGAAGTGGCCAGGG - Intronic
1037514391 8:19616374-19616396 CCATCCCAAGGTACTGATGAGGG + Intronic
1037839918 8:22237390-22237412 GCATTCCAGGTAACAGGTGCAGG + Intergenic
1039620728 8:38995328-38995350 GCATCCCAGGAACTTGGTTATGG - Exonic
1039919367 8:41882499-41882521 GCATCCCAGGGTGTTGGAGATGG + Intronic
1040579881 8:48689167-48689189 GCATCCCTGGGAACAGGTGGGGG - Intergenic
1041462595 8:58128427-58128449 GCCTCACAGGGTGCTGGTGAGGG - Intronic
1041463950 8:58140516-58140538 GCTTCCCAGGGAAGGGGTCATGG - Intronic
1042498976 8:69488674-69488696 CCATCCTAGGGATCTGGGGATGG + Intronic
1044950142 8:97427913-97427935 GCATGGCAGGGTTCTGGTGAGGG + Intergenic
1046815398 8:118577695-118577717 GCATCCCAGAGTTCAGGTGAAGG + Intronic
1049351330 8:142166350-142166372 GCCTGCCAGGGCACTGGAGAGGG - Intergenic
1049432205 8:142570363-142570385 TCATCCCAGCCAGCTGGTGAGGG - Intergenic
1049476024 8:142797387-142797409 CCACCCCAGGGAATTGCTGATGG - Intergenic
1050233109 9:3549548-3549570 TCAGCCTAGGGAATTGGTGAAGG - Intergenic
1050325798 9:4496043-4496065 GCATGTCAGGGACCTGGTTAAGG + Intronic
1050575508 9:6990988-6991010 GCATCACAGCGATCTAGTGAAGG - Intronic
1055650174 9:78399139-78399161 CTATGACAGGGAACTGGTGATGG - Intergenic
1056120904 9:83487608-83487630 GCATCCCCAGGAACTGGCTAGGG - Intronic
1057442841 9:95094491-95094513 GCTTCCCAGGGACCTGGGGGAGG - Intergenic
1058634498 9:107023357-107023379 ACCTCTCAGGGAGCTGGTGAGGG + Intergenic
1059399873 9:114062131-114062153 GCATCCAAGGGAGTAGGTGATGG - Intronic
1059423099 9:114205131-114205153 GCACCCCGGAGAACAGGTGAGGG + Exonic
1061718387 9:132536113-132536135 GCATCCTATGGGACTGGTTAGGG + Intronic
1185523429 X:758962-758984 GCATCCCAGGGAGAAGGGGAGGG - Intergenic
1186669695 X:11757113-11757135 GTATACCAGGAACCTGGTGAAGG + Intergenic
1187614872 X:20981857-20981879 GCATGCCAGTAAAGTGGTGAGGG - Intergenic
1191977527 X:66890024-66890046 GCTTCACAGGGAACTGGTAGAGG + Intergenic
1192916108 X:75652671-75652693 CCAGCCAAGGGAAGTGGTGAGGG - Intergenic
1193488429 X:82116205-82116227 GCATCTCTGGGTACTGGGGAAGG - Intergenic
1196399680 X:115300740-115300762 GCATCTCTGGGCACTGGGGAAGG - Intronic
1197991332 X:132320819-132320841 GAATCCCAGTGAACTCATGAAGG - Intergenic
1200136921 X:153879734-153879756 CCATGCCAGGGAACAGGTGGGGG + Intronic