ID: 1002347107

View in Genome Browser
Species Human (GRCh38)
Location 5:178555775-178555797
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347107_1002347117 9 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347107_1002347119 21 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347107_1002347116 6 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347107_1002347115 3 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347107_1002347118 13 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347107_1002347120 22 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347107 Original CRISPR GGCATCCCAGGGAACTGGTG AGG (reversed) Intronic