ID: 1002347108

View in Genome Browser
Species Human (GRCh38)
Location 5:178555780-178555802
Sequence TCGGGGGCATCCCAGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 125}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347108_1002347124 30 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347108_1002347115 -2 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347108_1002347119 16 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347108_1002347122 28 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347108_1002347117 4 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347108_1002347116 1 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347108_1002347123 29 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347108_1002347118 8 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347108_1002347120 17 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347108 Original CRISPR TCGGGGGCATCCCAGGGAAC TGG (reversed) Intronic
900079140 1:842587-842609 TGGGATGCATCCCAGGCAACGGG + Intergenic
900913205 1:5616826-5616848 TGTGGGGAATCCCAGGGAACAGG + Intergenic
903214386 1:21835441-21835463 TAGGGGGATTCCTAGGGAACAGG + Intronic
903438057 1:23367566-23367588 TCTGGGGCATCCAAGGGGAGTGG - Intronic
904885968 1:33738700-33738722 TGGGAGACATCCCAGGGAATTGG + Intronic
909075758 1:71048311-71048333 TCAGCGGCACCCCAGGGGACAGG - Intergenic
913546231 1:119871629-119871651 TCGGGGGCATTCCAGAGAAAGGG - Intergenic
916373634 1:164126925-164126947 TTGGGTGCAGCCCACGGAACAGG - Intergenic
922568610 1:226618528-226618550 TCTGAGGCAACCCAGGGCACAGG - Intergenic
923134820 1:231108667-231108689 TAGGGGGAATCCCTAGGAACAGG - Intergenic
923510076 1:234643254-234643276 GCGGGGGCGTCCCAGGGTCCAGG - Intergenic
1064183558 10:13140879-13140901 TAAGGGGCTGCCCAGGGAACTGG - Intergenic
1064987123 10:21221991-21222013 TCGGGGGCACCAAAGAGAACGGG - Intergenic
1069934580 10:71906348-71906370 TCGGGGTCCTCCCAGGAAGCAGG - Intergenic
1075929776 10:126285890-126285912 GCTAGGGCATCCCAGTGAACTGG + Intronic
1077181400 11:1218809-1218831 GCAGGGGCAGCCCAGGGCACCGG + Intergenic
1078152769 11:8773338-8773360 TCGAGGGCATCCAAGCAAACAGG + Intronic
1079655211 11:22978241-22978263 TTGGGGGCATGTCAGGTAACAGG - Intergenic
1081626843 11:44661174-44661196 TGGGGGGCCTCTCAGGGATCTGG - Intergenic
1081731629 11:45375914-45375936 TCGGGGGCATCCTGGGGCGCAGG + Intergenic
1085128335 11:74017226-74017248 TAAGGGCCTTCCCAGGGAACAGG + Intronic
1085300132 11:75453029-75453051 AGGGGGGCATCTCAGGGAAAGGG + Intronic
1089139782 11:116276176-116276198 TCGGGGACAGCCCAGGGTGCTGG + Intergenic
1089685954 11:120147030-120147052 TCGGGGGAGGCCCAGGGAGCAGG + Intronic
1089729593 11:120511920-120511942 GCGGGGGCAGCGCAGGGAGCGGG - Intronic
1092909711 12:13135972-13135994 TCGGAGCCAGCCCAGGGATCCGG + Intronic
1097077925 12:56408894-56408916 AAGGGGCAATCCCAGGGAACTGG - Intergenic
1101029488 12:100645467-100645489 TCGAGAGCTTCCCTGGGAACCGG + Intergenic
1104730223 12:131101250-131101272 TGGGGGGCTTCCCAGGGCAGTGG + Intronic
1104809115 12:131609951-131609973 TGCAGGGCATCCCAGGGAAGCGG + Intergenic
1104812947 12:131629272-131629294 TGGGGGGCTTCCCAGGGAGCAGG - Intergenic
1105529200 13:21202987-21203009 GAGGGGGCATCCCAGGCAGCTGG - Intergenic
1113424000 13:110192848-110192870 TCGGGGGCCTCCCGGGCCACAGG - Exonic
1113942025 13:114023330-114023352 TCGGGGGCATCCCAGGCTCGGGG + Intronic
1120707175 14:87757001-87757023 TAGGTGGCATCCCAGGCCACTGG - Intergenic
1121714030 14:96060012-96060034 AGGGGGGCATCCCAGGGACAAGG - Intronic
1125359176 15:38847941-38847963 TGGGGGGCATCCAGTGGAACTGG + Intergenic
1131558335 15:93418368-93418390 TCCAGGGCATCCCAGGAACCAGG - Intergenic
1132347083 15:101114814-101114836 TGGGGAGAATCCCAGGGATCTGG - Intergenic
1132503594 16:296132-296154 TCTGGGGCTCCCGAGGGAACAGG - Intronic
1133789996 16:9002238-9002260 GCTGTGGCATCCCAGGGACCTGG + Intergenic
1135154134 16:20037807-20037829 TCAGGGGCAACCCAAGGAACAGG - Intronic
1136419439 16:30122886-30122908 TCGGGAGCGTCCCAGGGAGGGGG - Intronic
1138516391 16:57537291-57537313 TCGGGGGCCTTCCAGGGTACAGG - Intergenic
1140068048 16:71626623-71626645 TCCGGGGCTTCCCAGGGCGCGGG - Exonic
1141812754 16:86386701-86386723 TAGGGGGAATCTCAGGGAGCAGG + Intergenic
1143273802 17:5695115-5695137 TCTGGGACATCCCTGGGAGCAGG + Intergenic
1147428494 17:40357399-40357421 TGGGGGGCAGGCCAGGGAAATGG - Intronic
1147558690 17:41496033-41496055 TGAGGGGCGGCCCAGGGAACTGG - Intergenic
1147937378 17:44020284-44020306 TAGAGGGCCCCCCAGGGAACAGG + Intronic
1148860351 17:50601325-50601347 CAGGGGGCATCCCGGGGACCAGG - Intronic
1150239976 17:63623009-63623031 GCGGGCGCATCCCGGGGAAGCGG + Intronic
1151401357 17:73857964-73857986 GCTGGGGCATCCCAGGCACCTGG + Intergenic
1152368142 17:79869334-79869356 GAGGGGGCATCCCAGGGAGGGGG - Intergenic
1156337977 18:36186949-36186971 TCGGGGGCTTCCCCCGGAGCGGG - Intergenic
1157499212 18:48178185-48178207 TCAGGGGCATGGCAGGAAACAGG - Intronic
1157616158 18:48988919-48988941 TGGGGGCCTTCCCAGGGCACAGG + Intergenic
1160768943 19:821837-821859 TGGGGGGCATCCGGGAGAACTGG + Intronic
1161436436 19:4266416-4266438 AAGGGGGCATCCCAGGTAAGGGG - Intronic
1161585851 19:5105072-5105094 TCAGGGGCAGCTCAGGGAGCGGG - Intronic
1161649698 19:5476892-5476914 GGGGGGTCACCCCAGGGAACAGG - Intergenic
1161900372 19:7114242-7114264 TCAGGGGGATTCCATGGAACAGG + Intronic
1164869833 19:31633450-31633472 TCGGGGGCAAGACAGGGACCTGG + Intergenic
1165061478 19:33207186-33207208 TCGGGGGCAGCCCCTGGAGCAGG - Exonic
1166659604 19:44637742-44637764 TCTGGGTCATCACTGGGAACAGG - Intergenic
1167077635 19:47258962-47258984 TCTGGGGCATCCCTGAGGACAGG - Intronic
926715083 2:15918017-15918039 TCAGCGGCTTCCCAGGGACCTGG + Intergenic
926860182 2:17301082-17301104 TGGGGAGCATCCCAGGGTAGGGG - Intergenic
930236631 2:48895010-48895032 GTGGGGGCATCCAAAGGAACAGG + Intergenic
931645457 2:64417766-64417788 TCGTGGGCATCTCAGGGATCTGG + Intergenic
932321892 2:70828553-70828575 TCTGAGGCAGCCCTGGGAACGGG + Intergenic
932704241 2:74010720-74010742 TCTGGGGCAACCCAGGGACATGG - Intronic
939745160 2:145958541-145958563 GAGGTGGCTTCCCAGGGAACTGG + Intergenic
943447059 2:187999846-187999868 TCGGTGTCATCCCAGGGATGTGG + Intergenic
948403720 2:237702394-237702416 TGGGTGGGATCCCAGGGAAAGGG + Intronic
1168851447 20:979805-979827 CTGGGGGCATCACAGGGAAGGGG - Intronic
1168965009 20:1893944-1893966 TCGGGGCCTTCCCAGGGAGGTGG - Intergenic
1169687084 20:8287550-8287572 TCGGCAGCCTCCCAGGGGACTGG - Intronic
1170211136 20:13847221-13847243 TAGGCTGCATCCCTGGGAACTGG + Intergenic
1170712520 20:18805170-18805192 TCAGTGGCATCCCTGGGAGCTGG - Intergenic
1172030884 20:31981256-31981278 TCAGGGGCATCCCAAGTAGCTGG - Intronic
1175714654 20:61247347-61247369 GGGGGGGGGTCCCAGGGAACAGG + Intergenic
1176299274 21:5090949-5090971 TCGGGAGCACCACAGGGCACAGG - Intergenic
1179857752 21:44170998-44171020 TCGGGAGCACCACAGGGCACAGG + Intergenic
1181168128 22:20994125-20994147 CCGGGGGCCTCCCTGGGAACTGG - Exonic
1181285945 22:21752629-21752651 TCGGGGGCCTCACAGGGGTCAGG + Intergenic
1183852443 22:40602043-40602065 TTTGGGACATTCCAGGGAACAGG - Intronic
949877929 3:8638817-8638839 GGGGGGCCATCCCAGGGGACAGG - Intronic
950795774 3:15509795-15509817 TTGGGGACATCCCAGTGCACAGG - Intronic
953142399 3:40241012-40241034 TGGTCGGCCTCCCAGGGAACAGG + Intronic
953406973 3:42664487-42664509 TCTGGGGCAGCCCCGGGAGCAGG - Exonic
953830542 3:46294113-46294135 AAGGGGGAGTCCCAGGGAACTGG + Intergenic
954258378 3:49421761-49421783 TGGGGGGACTGCCAGGGAACTGG + Intronic
954912273 3:54120867-54120889 TGGGGGGCAACGCAAGGAACAGG - Intergenic
961826999 3:129604282-129604304 TTGGGGGCGTCCCAGGCAGCTGG - Intronic
961944319 3:130670568-130670590 GTGGGGGAACCCCAGGGAACTGG - Intronic
965406071 3:168270749-168270771 CCCTTGGCATCCCAGGGAACTGG - Intergenic
968551680 4:1226593-1226615 TCTGGGGCACCCCTGGGATCTGG - Intronic
975825984 4:78320107-78320129 TCTGGAGCCTCCCAGGGAGCAGG - Intronic
975911609 4:79273681-79273703 TCAGTAGCATCCCAGGGACCTGG - Intronic
981660331 4:147158577-147158599 TCGTGGACATTCCAGGGAAGGGG - Intergenic
984598291 4:181696903-181696925 TCCTGGGCATGCCAGTGAACAGG + Intergenic
986206664 5:5630807-5630829 TCGGGTGCATGAGAGGGAACTGG + Intergenic
986602808 5:9490699-9490721 CAGGGGGCATCCCCGGGAAGAGG - Intronic
987286917 5:16466076-16466098 TCGGGGGCTTCCCAGGGCCCAGG - Intergenic
989107948 5:37880892-37880914 TGAGGGCCATGCCAGGGAACTGG + Intergenic
993080457 5:83291156-83291178 TCGGAGGCACCCCAGTGAACTGG + Intronic
994656542 5:102601053-102601075 CCTGGGGCTTCCCATGGAACAGG + Intergenic
996937370 5:128965064-128965086 TGGGGGGAAACCCAGGGATCTGG - Intronic
997691346 5:135829528-135829550 TAGAGGGCAGCCCAGGGCACTGG + Intergenic
999454364 5:151702638-151702660 TCCCGGGCATCCCACGGCACCGG - Intergenic
999800301 5:155027232-155027254 TGGGGGGCTTCCCAAGGAATTGG + Intergenic
1002347108 5:178555780-178555802 TCGGGGGCATCCCAGGGAACTGG - Intronic
1002596960 5:180329937-180329959 TTGGGGACATCCCAGAGGACAGG - Intronic
1005954885 6:30656858-30656880 GTGGGGGCTTCCTAGGGAACCGG - Intronic
1007431381 6:41779443-41779465 TTGGGGGCATCCAAGAGAAATGG + Intronic
1015631871 6:135239297-135239319 TCGGGGGAAGTACAGGGAACAGG + Intergenic
1017666234 6:156722514-156722536 GTGGGGGCATCCCAGGGGTCTGG - Intergenic
1018247944 6:161840254-161840276 TCTGGGGCATCACAGGTGACAGG + Intronic
1021912801 7:25403190-25403212 TCTGTGGCATCCCATGAAACTGG + Intergenic
1025202881 7:56972947-56972969 TTGGGGGGTTCCCAGGGTACTGG + Intergenic
1025669063 7:63603979-63604001 TCGGGGGGTTCCCAGGGTACTGG - Intergenic
1035526491 8:317096-317118 TGGGATGCATCCCAGGCAACGGG - Intergenic
1036780515 8:11643806-11643828 TCGGGGGGAACCCAGGGCTCCGG + Intergenic
1038239217 8:25792743-25792765 TCGGGGACATACCAGGGAGGTGG - Intergenic
1038793489 8:30689505-30689527 TTTGGGTCAACCCAGGGAACAGG - Intronic
1039903489 8:41769054-41769076 CAGGGGGCATCCCAAGGAAGTGG + Intronic
1046890560 8:119416782-119416804 TCGGCGGCGTCGCAGGGCACCGG - Exonic
1049410000 8:142468917-142468939 TGGGGGGCACGTCAGGGAACTGG - Intronic
1049613699 8:143567362-143567384 GCGGGGGCAGCCCCGGGCACGGG + Exonic
1049747323 8:144268588-144268610 GTGGGGGCTTCCCAGGGAGCCGG - Intronic
1057283591 9:93729710-93729732 TTGGGGGCGTCCCATGGCACTGG + Intergenic
1057755808 9:97834082-97834104 TCCTGGGCATCCCAGGGGAAGGG - Intergenic
1060051988 9:120384282-120384304 CCGGCGGCTTCCCAGGGAATGGG + Intergenic
1060743947 9:126117716-126117738 CCGGGTGCATCCCTCGGAACAGG - Intergenic
1061907113 9:133704431-133704453 TCTGGGGACTCCCAGGGACCTGG - Intronic