ID: 1002347108

View in Genome Browser
Species Human (GRCh38)
Location 5:178555780-178555802
Sequence TCGGGGGCATCCCAGGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347108_1002347118 8 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347108_1002347119 16 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347108_1002347123 29 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347108_1002347124 30 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347108_1002347120 17 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347108_1002347115 -2 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347108_1002347117 4 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347108_1002347116 1 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347108_1002347122 28 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347108 Original CRISPR TCGGGGGCATCCCAGGGAAC TGG (reversed) Intronic