ID: 1002347109

View in Genome Browser
Species Human (GRCh38)
Location 5:178555786-178555808
Sequence AGTGACTCGGGGGCATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 68}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347109_1002347127 28 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347109_1002347119 10 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347109_1002347118 2 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347109_1002347122 22 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347109_1002347116 -5 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347109_1002347125 25 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347109_1002347120 11 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347109_1002347124 24 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347109_1002347123 23 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347109_1002347115 -8 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347109_1002347117 -2 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347109 Original CRISPR AGTGACTCGGGGGCATCCCA GGG (reversed) Intronic
902237415 1:15066376-15066398 AGTGACTTGGGCGCACCCCCAGG - Intronic
903158396 1:21466091-21466113 AGTGATTCGGGCTCCTCCCAAGG - Intronic
906476415 1:46172203-46172225 AGTGCCTGGGGAGCAGCCCAGGG - Intronic
913543815 1:119847076-119847098 AGTGATTCGGGGTCCTCCCAAGG + Intergenic
913585203 1:120268022-120268044 AGTGATGCTGGGGCCTCCCAAGG - Intergenic
913622982 1:120630340-120630362 AGTGATGCTGGGGCCTCCCAAGG + Intergenic
913639953 1:120802969-120802991 AGTGATTCGGGGTCCTCCCAAGG - Intergenic
914212541 1:145593546-145593568 AGTGATTCGGGGTCCTCCCAAGG + Intergenic
914278524 1:146147369-146147391 AGTGATTCGGGGTCCTCCCAAGG + Intronic
914539572 1:148598317-148598339 AGTGATTCGGGGTCCTCCCAAGG + Intronic
914567205 1:148879883-148879905 AGTGATGCTGGGGCCTCCCAAGG - Intronic
914605618 1:149250359-149250381 AGTGATGCTGGGGCCTCCCAAGG + Intergenic
914627108 1:149473311-149473333 AGTGATTCGGGGTCCTCCCAAGG - Intergenic
914991009 1:152499737-152499759 AGTGTCTCGCAGGCTTCCCAAGG - Intergenic
915980576 1:160417388-160417410 AGTGGCTGGAGGCCATCCCACGG - Intronic
1063225840 10:4013901-4013923 AGCCACTTTGGGGCATCCCAGGG + Intergenic
1072535701 10:96360943-96360965 AGTGAGGCAGGGGCATCCCCAGG + Intergenic
1074534730 10:114320638-114320660 CGGGACTAGGGGTCATCCCAAGG - Intronic
1076667019 10:132099045-132099067 TGTGATTCGGGGGCATCCTGGGG - Intergenic
1076779068 10:132714026-132714048 AGCGTCTCGGGGACCTCCCACGG + Intronic
1081802651 11:45870379-45870401 ATTGACTCTGGGGCATTCCAGGG - Exonic
1085197418 11:74680957-74680979 ACTGACTCGGAGGCAACCCGGGG + Intergenic
1086431645 11:86742247-86742269 AGGGACTTGGGAGCAACCCATGG - Intergenic
1088902415 11:114128217-114128239 AGAGCCTGGGGGGGATCCCAAGG + Intronic
1094525648 12:31229103-31229125 ACAGACTGGGTGGCATCCCAGGG + Intergenic
1095096929 12:38153952-38153974 AGTGGGCCGGGGTCATCCCACGG + Intergenic
1108508922 13:51137334-51137356 AGTGACTGCTGGGCATCCCAGGG - Intergenic
1113424098 13:110193699-110193721 TCTGACTGAGGGGCATCCCAGGG - Intronic
1123449663 15:20351835-20351857 AATGGCACGGGGGCAACCCATGG - Intergenic
1126849147 15:52787076-52787098 AGTTGCTCGCGGGCAGCCCACGG + Intronic
1128550619 15:68595967-68595989 CGTGGCTCGGGAGCACCCCACGG - Intronic
1129674938 15:77627421-77627443 GGTGACTCCGGGGCATTGCAGGG - Intronic
1135496548 16:22956640-22956662 AATGACTCCAGTGCATCCCAGGG + Intergenic
1138386233 16:56637559-56637581 AATGACTTGGTGCCATCCCATGG + Intergenic
1140801299 16:78490967-78490989 GGTCACTCGGGGGCAGCTCAGGG - Intronic
1143059764 17:4189953-4189975 AGTGGCTAGCGGGAATCCCAGGG - Intronic
1146537603 17:33666588-33666610 AGTGACTGGGGGGCATCCGCTGG + Intronic
1147134252 17:38426032-38426054 AGTGAGCCAGGGGCACCCCACGG + Intergenic
1147357914 17:39912029-39912051 AGTGAATTGGGGGCATCAGAAGG + Intronic
1163528346 19:17834964-17834986 AGACACTCGGGGGCCACCCAGGG + Exonic
1164607744 19:29612288-29612310 GGTGACTGGGGGCCATCTCAGGG - Intronic
1167395319 19:49224646-49224668 TGGGGCTGGGGGGCATCCCAGGG - Intergenic
926126183 2:10273343-10273365 AGTGACTCTGGGGCCACCAAAGG + Intergenic
929884658 2:45867896-45867918 AGTGACCTGGGGGCTTCCCAAGG - Intronic
930769498 2:55117447-55117469 CCTGACTCGGCAGCATCCCAGGG + Intergenic
934517850 2:94999844-94999866 AGTGAATGGGGGGCTCCCCATGG + Intergenic
943732054 2:191312812-191312834 AGTGAGGTGTGGGCATCCCAGGG - Intronic
948167160 2:235871851-235871873 AGTGAGTCTCGGGCAGCCCAGGG + Intronic
948786738 2:240356588-240356610 AGAAACTCGGGGACCTCCCAGGG + Intergenic
1170917042 20:20636981-20637003 AGTGACTGGAGGCCAGCCCAAGG - Intronic
1174037007 20:47674599-47674621 GGTGACACGGGGACATCCTAAGG - Intronic
1174355266 20:49993629-49993651 AGATACTCGGAGGCATCACATGG - Intergenic
1178689085 21:34736224-34736246 AGTGCCCCGGGGACATACCATGG + Intergenic
1182095262 22:27621523-27621545 AGTGAGTAGGGGTCATCTCAAGG + Intergenic
1183280471 22:36929475-36929497 AGTGGCTCTGGGGACTCCCAAGG - Exonic
1184129958 22:42511902-42511924 AGGGACTTGGAGGCCTCCCAGGG - Exonic
1184140134 22:42573720-42573742 AGGGACTTGGAGGCCTCCCAGGG - Intronic
1184659469 22:45959262-45959284 AGTGACAAGGGGACAGCCCACGG - Intronic
954140278 3:48601409-48601431 AGCACCTCGGTGGCATCCCATGG - Exonic
965280352 3:166743743-166743765 AATGTCTAGGGGACATCCCAGGG - Intergenic
968657680 4:1785673-1785695 AGGGCCTCAGGGGCCTCCCAGGG - Intergenic
970126352 4:12816814-12816836 AATGACTCTGGGGCTGCCCATGG - Intergenic
970436467 4:16040327-16040349 AGTACCTCGGGGGCTGCCCAAGG + Intronic
984794215 4:183643515-183643537 AGAGTCTCAGGGACATCCCAGGG + Intronic
989005335 5:36804645-36804667 AGGGACTCGGGGGAGTCCCAGGG - Intergenic
989589047 5:43096354-43096376 TGTGACTTGGGGGCATCTCTGGG + Intronic
989606000 5:43245315-43245337 AGGGACGTGGGGGCCTCCCAGGG + Exonic
990653878 5:57933317-57933339 TGTGACTCAGGGGCCTGCCATGG + Intergenic
995124420 5:108565906-108565928 AGTGACTAGTGGGCACCACATGG + Intergenic
1002347109 5:178555786-178555808 AGTGACTCGGGGGCATCCCAGGG - Intronic
1008627481 6:53332057-53332079 AGTGACTTGGTGCCATCTCATGG - Intronic
1017524253 6:155228944-155228966 AGTGCCTAGGGGGCATGCCCAGG - Intronic
1029699336 7:102236218-102236240 AGTGCCCCTGGGTCATCCCAGGG - Intronic
1032773836 7:135089970-135089992 TGTGAATCTGAGGCATCCCATGG + Intronic
1041065130 8:54075408-54075430 AGAGACCCGGGAGCATCCCGAGG + Intronic
1046890525 8:119416630-119416652 AGTAACTTGGGGGCATCTTAAGG - Intronic
1049223370 8:141437828-141437850 AGTGACTTGGGTGCAAACCAGGG + Intergenic
1057755811 9:97834088-97834110 AGTGGGTCCTGGGCATCCCAGGG - Intergenic
1060030770 9:120213090-120213112 ATTTGATCGGGGGCATCCCATGG + Intergenic
1187766600 X:22649356-22649378 AGTGACTCGTGCTCATCCCTGGG - Intergenic