ID: 1002347109

View in Genome Browser
Species Human (GRCh38)
Location 5:178555786-178555808
Sequence AGTGACTCGGGGGCATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 68}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347109_1002347125 25 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347109_1002347124 24 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347109_1002347127 28 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347109_1002347115 -8 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347109_1002347117 -2 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347109_1002347123 23 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347109_1002347122 22 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347109_1002347116 -5 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347109_1002347120 11 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347109_1002347119 10 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347109_1002347118 2 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347109 Original CRISPR AGTGACTCGGGGGCATCCCA GGG (reversed) Intronic