ID: 1002347110

View in Genome Browser
Species Human (GRCh38)
Location 5:178555787-178555809
Sequence TAGTGACTCGGGGGCATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 57}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347110_1002347120 10 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347110_1002347124 23 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347110_1002347119 9 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347110_1002347122 21 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347110_1002347118 1 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347110_1002347117 -3 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347117 5:178555807-178555829 CTACTGTTCACAGACGGTGGAGG 0: 1
1: 0
2: 0
3: 9
4: 69
1002347110_1002347115 -9 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347115 5:178555801-178555823 GAGTCACTACTGTTCACAGACGG 0: 1
1: 0
2: 0
3: 11
4: 105
1002347110_1002347123 22 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347110_1002347127 27 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347110_1002347116 -6 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347110_1002347125 24 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347110 Original CRISPR TAGTGACTCGGGGGCATCCC AGG (reversed) Intronic
901762171 1:11478667-11478689 TGGACACTCGCGGGCATCCCCGG - Intergenic
902063164 1:13662277-13662299 TTCTGACCAGGGGGCATCCCTGG + Intergenic
902224689 1:14989141-14989163 CAGTGACTCGGGGTCACCCTGGG + Intronic
902225586 1:14994518-14994540 CAGTGACTCCGGGTCACCCCGGG + Intronic
902375044 1:16026616-16026638 TAGGGACTCGGGGGCTTCCTTGG + Intronic
902380015 1:16048423-16048445 TAGGGACTCGGGGGCTTCCTTGG + Intronic
904368063 1:30029746-30029768 TAGGGACTGGAGGTCATCCCTGG + Intergenic
917920092 1:179743693-179743715 CGGCGACTCGGGGGCATCTCCGG + Intronic
1074115933 10:110457567-110457589 AGGTGACTGGGGGGCCTCCCGGG + Intergenic
1076667020 10:132099046-132099068 CTGTGATTCGGGGGCATCCTGGG - Intergenic
1076982391 11:211608-211630 TAGGGACTGGGGGGCTTCTCTGG - Intronic
1080578154 11:33618613-33618635 TGGTGACTCGGGAGCGACCCCGG + Exonic
1080696827 11:34609972-34609994 TAGTGACTCAGGGACATGCAGGG - Intergenic
1081802652 11:45870380-45870402 AATTGACTCTGGGGCATTCCAGG - Exonic
1085197417 11:74680956-74680978 CACTGACTCGGAGGCAACCCGGG + Intergenic
1092014619 12:5148297-5148319 GAGTGACATGTGGGCATCCCTGG - Intergenic
1095674211 12:44897745-44897767 TTCTGTCTCGGGGGCATTCCAGG - Intronic
1108508923 13:51137335-51137357 GAGTGACTGCTGGGCATCCCAGG - Intergenic
1113424099 13:110193700-110193722 TTCTGACTGAGGGGCATCCCAGG - Intronic
1120386693 14:83855548-83855570 TTGTGACTCGGGGGCACCAGTGG - Intergenic
1121123594 14:91392079-91392101 TAGTGCCTCTGGGGCCTCCAGGG + Intronic
1132980512 16:2736680-2736702 CAGTGACTGGGGGGCATCCCGGG + Intergenic
1137705545 16:50533359-50533381 TTGTGACTCGGGGGCTTGACTGG + Intergenic
1152539628 17:80968442-80968464 TGGTGACCCTGGAGCATCCCGGG - Intergenic
1157208049 18:45717285-45717307 AAGTTACCCAGGGGCATCCCAGG - Intergenic
1162398201 19:10430217-10430239 CAGAGATTTGGGGGCATCCCTGG + Intronic
1163527503 19:17830602-17830624 GAGGGATTCGGGGGCATACCTGG + Exonic
1164381839 19:27742558-27742580 TAGAGACACGTGGGCAACCCAGG - Intergenic
1164607745 19:29612289-29612311 TGGTGACTGGGGGCCATCTCAGG - Intronic
1165933341 19:39374346-39374368 TGGTGACTCAGGGTGATCCCAGG - Intronic
1167395320 19:49224647-49224669 TTGGGGCTGGGGGGCATCCCAGG - Intergenic
930769496 2:55117446-55117468 TCCTGACTCGGCAGCATCCCAGG + Intergenic
935154092 2:100466745-100466767 TAGTGACTCTGCAGCAGCCCTGG + Intergenic
1172871793 20:38140425-38140447 TAGTGCCTTGGGGGGATCCGTGG - Intronic
1176375005 21:6082708-6082730 TCATGACTCGGGGGAGTCCCTGG - Intergenic
1179748470 21:43455537-43455559 TCATGACTCGGGGGAGTCCCTGG + Intergenic
1183658671 22:39205839-39205861 TGGTGACTGGGGGGTGTCCCGGG - Intergenic
1184129959 22:42511903-42511925 TAGGGACTTGGAGGCCTCCCAGG - Exonic
1184140135 22:42573721-42573743 TAGGGACTTGGAGGCCTCCCAGG - Intronic
953743595 3:45556793-45556815 TAGATACTCAGGGGGATCCCAGG + Intronic
968591618 4:1462509-1462531 CAGTGTCTCGGGGCCTTCCCTGG - Intergenic
969690394 4:8701146-8701168 TAGGGACTCGGGGGCAAACTTGG - Intergenic
970144812 4:13024336-13024358 TTCTGACTATGGGGCATCCCTGG - Intergenic
970399100 4:15700884-15700906 TAGTAATTTTGGGGCATCCCTGG - Intronic
975701950 4:77075527-77075549 TGGTGACGCGGGGTCATCCGGGG + Exonic
989005336 5:36804646-36804668 TAGGGACTCGGGGGAGTCCCAGG - Intergenic
989589046 5:43096353-43096375 CTGTGACTTGGGGGCATCTCTGG + Intronic
991031976 5:62091773-62091795 TAGGGACTATGGGGAATCCCAGG - Intergenic
994743378 5:103648509-103648531 TAGAGAAATGGGGGCATCCCAGG + Intergenic
1001878615 5:175222771-175222793 TAGTGCCTCGGGGGCTACTCTGG - Intergenic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1014410540 6:121113597-121113619 TAGTGACTAGGGGGCACTACTGG + Intronic
1018892328 6:167990748-167990770 GAGTCACACGTGGGCATCCCGGG + Intergenic
1046016634 8:108613302-108613324 GAGTGGCTTGGGGGCAGCCCTGG - Intronic
1048851756 8:138652115-138652137 GAGGGACTCGGGGGGCTCCCAGG - Intronic
1049462490 8:142736566-142736588 TGGTGACTCTGGGCCATTCCAGG - Exonic
1051590619 9:18773613-18773635 AAGTGATTCGGGGGCTTCTCAGG - Intronic
1053270359 9:36745388-36745410 TGGTGACTCCTGGGCATCCCAGG + Intergenic
1056729510 9:89153592-89153614 GAGTGACTGAGGGGCCTCCCTGG - Intronic
1058396966 9:104565344-104565366 TAGTGATTCAGAGGCTTCCCCGG + Intergenic
1062319300 9:135982631-135982653 TAGTGGCCCTGAGGCATCCCTGG - Intergenic
1187766601 X:22649357-22649379 TAGTGACTCGTGCTCATCCCTGG - Intergenic
1190016479 X:46831833-46831855 TAGTGAGTCAGGGCCAGCCCTGG + Intergenic
1199765156 X:150935990-150936012 TTGTCACTCCTGGGCATCCCGGG + Intergenic