ID: 1002347111

View in Genome Browser
Species Human (GRCh38)
Location 5:178555796-178555818
Sequence TGTGAACAGTAGTGACTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 70}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347111_1002347123 13 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347111_1002347127 18 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347111_1002347124 14 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347111_1002347122 12 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347111_1002347120 1 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347111_1002347125 15 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347111_1002347119 0 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347111_1002347128 25 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347128 5:178555844-178555866 AGCTCCCAGGGGGAGGCTTCAGG No data
1002347111_1002347118 -8 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347111 Original CRISPR TGTGAACAGTAGTGACTCGG GGG (reversed) Intronic
905472588 1:38204674-38204696 TGTGTACAGTAGAGACGTGGGGG - Intergenic
906917006 1:50023214-50023236 TGTGACCAGGAGTGACCCTGAGG + Intronic
907766694 1:57420077-57420099 TTTGAACACTTGTGACTCTGTGG - Intronic
908733930 1:67256394-67256416 TGTGAACAATAGTGTCACAGGGG + Intronic
911440539 1:97920892-97920914 TGTGCTCAGTAAGGACTCGGCGG - Exonic
912729212 1:112087087-112087109 GGTGAAGAGTAGTGATTAGGAGG + Intergenic
919747739 1:201019330-201019352 TGTGAAGAGCAGTGGCTTGGAGG - Intronic
1065651716 10:27899452-27899474 TGTGAACAGTTCTGTCTCGCTGG - Intronic
1067056162 10:43052722-43052744 TGTGAACAGTGGTGAATCTGGGG - Intergenic
1067056933 10:43057980-43058002 TGGCAACAGTGGTGACTCAGTGG + Intergenic
1073433322 10:103500884-103500906 TGAGAACTGTTGTGACTCTGGGG + Intronic
1076624119 10:131811130-131811152 TGAGACCAGCAGGGACTCGGGGG + Intergenic
1078511023 11:11984055-11984077 TGTGACGAGGAGTGACTAGGAGG + Intronic
1092290674 12:7157997-7158019 TGAGGACAGCAGTGACTCGGAGG + Exonic
1099096739 12:78383600-78383622 TGTGAACAGCAGTCGCTCAGTGG + Intergenic
1103031526 12:117618282-117618304 TGTGTCCAGTAGGGACTCTGAGG - Intronic
1103506269 12:121443810-121443832 TGGGAAGAGGAGTGACTCGCTGG + Intronic
1103608734 12:122107839-122107861 TGTGACCAGTGGTGACAGGGTGG + Intronic
1113227787 13:108177935-108177957 TCTGAAGAGTAGTGACTGGAAGG + Intergenic
1124893920 15:33758280-33758302 TGTGAACAGTTCTGTCTCGCTGG - Intronic
1126047540 15:44656598-44656620 TGTAAAAAGTAGTGACTTGGGGG + Intronic
1133575696 16:7087082-7087104 TGTGAAGAGTAATGAGTCTGGGG + Intronic
1135112249 16:19699416-19699438 TGTGGACAGTGCTGACTCTGGGG - Intronic
1137815337 16:51392861-51392883 AGTGAACTGCAGTGACTCTGTGG - Intergenic
1147806014 17:43132305-43132327 TGTGAAAAATGCTGACTCGGTGG + Intergenic
1148167685 17:45494713-45494735 TGTGAAAAATGCTGACTCGGTGG - Intergenic
1158635247 18:59150543-59150565 TGTGAACACGAGTGGGTCGGAGG - Intronic
1168101646 19:54144580-54144602 TGTGAAGAGGAGCGACTTGGGGG + Intronic
927700631 2:25266163-25266185 TGTAAGCAGTAGTGACTTCGAGG - Intronic
938227169 2:129626044-129626066 TTTGAAGAGAAGTGACTGGGAGG + Intergenic
943250852 2:185519232-185519254 TGTCATCAGTACTGACTAGGTGG - Intergenic
948194015 2:236081541-236081563 TTTGAAAAGTAATGACTTGGTGG - Intronic
948379566 2:237542887-237542909 TGGGCACAGTAGTGAGTGGGGGG + Intronic
948379625 2:237543127-237543149 TGGGCACAGTAGTGAGTAGGGGG + Intronic
948379652 2:237543231-237543253 TGGGCACAGTAGTGAGTAGGGGG + Intronic
948379930 2:237544247-237544269 TGGGGACAGTAATGAGTCGGGGG + Intronic
948379938 2:237544281-237544303 TGGGCACAGTAGTGAGTGGGGGG + Intronic
948379971 2:237544400-237544422 TGGGGACAGTGGTGAGTCGGGGG + Intronic
948380103 2:237544889-237544911 TGGGGACAGTAATGAGTCGGGGG + Intronic
948380111 2:237544923-237544945 TGGGCACAGTAGTGAGTGGGGGG + Intronic
948629010 2:239289814-239289836 TGTGTACAGTAGGGAAACGGAGG - Intronic
1169678942 20:8187544-8187566 TTTTAACAGTAGTGACTGGCAGG + Intronic
1170048367 20:12112189-12112211 TTTGGATAGTAGTGACTCAGAGG + Intergenic
1174649677 20:52113903-52113925 TGTGATCGGGAGTGACTGGGTGG + Intronic
954025561 3:47780875-47780897 TTTGAAAACTACTGACTCGGCGG + Intronic
964494634 3:157275047-157275069 TGTGAACAGTAGTTATGTGGAGG - Intronic
965328433 3:167337622-167337644 TGTTAACAGTAGTTACTCTGGGG - Intronic
965511077 3:169568356-169568378 AGTGAACAGTTCTGTCTCGGAGG - Intronic
969448120 4:7256952-7256974 TGTCATCGGTAGAGACTCGGGGG + Intronic
975557190 4:75676257-75676279 TGTGAACGGTATTCATTCGGTGG + Intronic
978533786 4:109739857-109739879 TGAGAACAGAAGTGACTGTGAGG + Intergenic
978887610 4:113783873-113783895 AGTGAAGAGCAGTGACTCAGAGG + Intergenic
979169861 4:117587600-117587622 TCTGAACAGTTGAAACTCGGAGG - Intergenic
998487199 5:142513018-142513040 TGTGACCAGTAGTGACCCATGGG - Intergenic
998998377 5:147892322-147892344 TGAGAAAAATAGTGACTCTGTGG + Intronic
1000326071 5:160173417-160173439 TGTGAACTGCAGTGCCTCTGTGG - Intergenic
1002347111 5:178555796-178555818 TGTGAACAGTAGTGACTCGGGGG - Intronic
1016338907 6:143039749-143039771 TAAGAACAGAAGTGAATCGGAGG - Intergenic
1016590854 6:145742056-145742078 AGTGAACAGTTGTGTCTCGCTGG - Intergenic
1017827848 6:158095713-158095735 TGGGAACAGGAGGGACTCGAGGG - Exonic
1018917097 6:168140235-168140257 TGAGAACAGTAGTGAGAGGGTGG - Intergenic
1028278025 7:88882827-88882849 TGGGAACAGTAGATACTGGGGGG + Intronic
1035365607 7:158348144-158348166 TGTGAACAGGAGTGAACAGGTGG + Intronic
1035865928 8:3081881-3081903 TGTCCCCAGTAGTGACTCTGAGG - Intronic
1046330838 8:112713057-112713079 TGTCAACAGGACTGACTAGGTGG + Intronic
1050994524 9:12198277-12198299 TGTGAGCAGAAGTGAGTGGGAGG - Intergenic
1051343997 9:16136286-16136308 TTTGGACAGTGGTGACTGGGTGG + Intergenic
1052817540 9:33113179-33113201 TGTGTACAGTTCTGACTCTGGGG + Exonic
1059787146 9:117598227-117598249 AGGGCACAGTAGTGACTGGGAGG - Intergenic
1187090732 X:16093815-16093837 TGAGAACAGTAGTGAGGAGGGGG - Intergenic
1188411797 X:29881825-29881847 TATGTACAGTAGTGATTGGGTGG + Intronic
1192423220 X:71052589-71052611 TGTTAACAGCAGTTACTCTGGGG + Intergenic
1194158516 X:90422561-90422583 AGTGAACAGTTCTGACTCGCTGG - Intergenic
1197823310 X:130563328-130563350 TGTCTACAGCAGTGACTCAGTGG - Intergenic
1200504832 Y:3999529-3999551 AGTGAACAGTTCTGACTCGCTGG - Intergenic