ID: 1002347112

View in Genome Browser
Species Human (GRCh38)
Location 5:178555797-178555819
Sequence CTGTGAACAGTAGTGACTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 63}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347112_1002347125 14 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347112_1002347128 24 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347128 5:178555844-178555866 AGCTCCCAGGGGGAGGCTTCAGG No data
1002347112_1002347122 11 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347112_1002347120 0 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347112_1002347118 -9 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347112_1002347123 12 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347112_1002347127 17 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347112_1002347124 13 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347112_1002347119 -1 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347112 Original CRISPR CTGTGAACAGTAGTGACTCG GGG (reversed) Intronic
908733929 1:67256393-67256415 CTGTGAACAATAGTGTCACAGGG + Intronic
919018130 1:192067575-192067597 CCGTTCACAGTAGTGACTCAGGG - Intergenic
920694971 1:208175039-208175061 CTTTGCACACTAGTGGCTCGTGG + Intronic
922745909 1:228043684-228043706 CTGTAAACAGAGGTGACTCTGGG + Intronic
1062763273 10:43957-43979 CTCTGAACACTAGTTACTTGTGG + Intergenic
1067056163 10:43052723-43052745 ATGTGAACAGTGGTGAATCTGGG - Intergenic
1073433321 10:103500883-103500905 CTGAGAACTGTTGTGACTCTGGG + Intronic
1076624118 10:131811129-131811151 CTGAGACCAGCAGGGACTCGGGG + Intergenic
1078819905 11:14868218-14868240 CTGTGAAGAGTACTGGCTGGAGG - Intronic
1079615869 11:22492156-22492178 CTGTAAACGGGAGTGAATCGGGG + Intergenic
1084667933 11:70586511-70586533 CTGTGAAGAGTAGTGTGTCCAGG - Intronic
1084910608 11:72385158-72385180 CTATAAACAGTAGTTACTCTTGG - Intronic
1087987797 11:104706414-104706436 GTGTCAACAGTAGTGACTATGGG - Intergenic
1094399304 12:30044472-30044494 ATGTGAATAATAGTGACTCTAGG + Intergenic
1102007385 12:109597255-109597277 GTGTCAACAGTAGAGACTCCAGG + Exonic
1103788273 12:123449987-123450009 CTGTTAACAGTAGTTGCTTGGGG - Intergenic
1112719874 13:102231375-102231397 TTGTGAACAGCAGTGACAGGAGG + Intronic
1125314476 15:38416633-38416655 CTGTGAACAGTAATGATATGGGG + Intergenic
1126047539 15:44656597-44656619 ATGTAAAAAGTAGTGACTTGGGG + Intronic
1127328192 15:57915657-57915679 CTCTGAACTGCAGTGACTTGAGG - Intergenic
1130030777 15:80311425-80311447 CTGTGAACTGAAGTGGCTGGTGG + Intergenic
1135112250 16:19699417-19699439 CTGTGGACAGTGCTGACTCTGGG - Intronic
1137918047 16:52454452-52454474 CTGTGAACCGTGGTGAGTGGTGG - Intronic
1138075109 16:54034530-54034552 CTGTGTACAGTAGTGTGTCCTGG + Intronic
1138301327 16:55932141-55932163 CTGTGAAGAGAAGTGACACATGG - Intronic
1147482268 17:40777679-40777701 CTGTGCACAGTAGTTACTCTCGG + Exonic
1147636982 17:41970071-41970093 CTTTGAGCAGTAGTCACTCCAGG - Intronic
1161378495 19:3951980-3952002 CAGGGAACAGAAGTGACTCAAGG - Intergenic
927672207 2:25078210-25078232 CAGTGAACACAAGTGCCTCGTGG + Intronic
928208512 2:29305327-29305349 CCGTGAGCAGTAATGACCCGAGG + Intronic
928666902 2:33558695-33558717 CTGTGTCCAGCAGTGACTCCAGG - Exonic
946433111 2:219635925-219635947 CTGGGACCAGAAGTGACTAGAGG - Intronic
946939740 2:224758401-224758423 CTGGGAGCAGTAGTGACTGTGGG + Intergenic
948428235 2:237902028-237902050 CTGTGAACACATGTGACTCAGGG - Intronic
1179543277 21:42098228-42098250 CAGTGAACAGCATTGAGTCGTGG - Intronic
965328434 3:167337623-167337645 CTGTTAACAGTAGTTACTCTGGG - Intronic
968066977 3:195764168-195764190 CGGAGAACAGCAGTGAGTCGGGG + Intronic
991066650 5:62431319-62431341 CTGTGCACAGAAGTGCCTGGTGG - Intronic
997271220 5:132539917-132539939 CTATGCACAGCAGTGACACGTGG + Intergenic
998487200 5:142513019-142513041 CTGTGACCAGTAGTGACCCATGG - Intergenic
1002057533 5:176607176-176607198 CTGTGAGCAGTAGAGCCTCTGGG - Intronic
1002347112 5:178555797-178555819 CTGTGAACAGTAGTGACTCGGGG - Intronic
1003255673 6:4472765-4472787 TTGTGAATAGTGGTGACTCCAGG - Intergenic
1007567852 6:42866563-42866585 CTGAGAACAGTAGTGACCCCTGG + Exonic
1008289190 6:49692817-49692839 CTGTGAACATGAGTTACTCAAGG - Exonic
1013033248 6:106356659-106356681 GTGTGAACAGTGGTGACTGCTGG - Intergenic
1013941461 6:115667982-115668004 CTGTGAACAGACTTGGCTCGGGG - Intergenic
1016078545 6:139827629-139827651 CTTTGAGCACTAGTGACTTGAGG + Intergenic
1017827849 6:158095714-158095736 TTGGGAACAGGAGGGACTCGAGG - Exonic
1026126334 7:67582869-67582891 CTGTGAAGAGAAATGACTCAGGG + Intergenic
1032940348 7:136781324-136781346 CTGTGAACAGTAGTGGGTGGGGG + Intergenic
1045035294 8:98171966-98171988 TTGTGAACAGAAGTGACTTCTGG - Intergenic
1047403191 8:124562959-124562981 GTGTCAACAGCAGTGACTCCCGG - Exonic
1047496186 8:125410738-125410760 CTGTGAAGGGAAGTGACTCACGG + Intergenic
1047771901 8:128036622-128036644 CTGTGAACTGCAGTGACGGGAGG - Intergenic
1050145494 9:2562922-2562944 CTGTGAAGGGTAGTGACGGGGGG + Intergenic
1050695881 9:8278653-8278675 CTGTGAACAGTCGTTACGAGCGG + Intergenic
1056812054 9:89772491-89772513 CTGTGAAAAGTAGTTACCCTTGG - Intergenic
1057481719 9:95449823-95449845 CTGAGGTCAGTAGTGACACGGGG - Exonic
1059786913 9:117596395-117596417 CTTTGAACAGTACTGACTCGAGG - Intergenic
1061997395 9:134193440-134193462 CTGTGGCCAGTGGGGACTCGTGG + Intergenic
1187090733 X:16093816-16093838 CTGAGAACAGTAGTGAGGAGGGG - Intergenic
1187775492 X:22751874-22751896 CTCTGCACAGTAGTGATTTGTGG - Intergenic
1187901633 X:24031749-24031771 CTGGCAACAGTAGTTACTGGAGG - Intergenic
1188433756 X:30137116-30137138 ATGAGAACAGGAGTGTCTCGGGG - Intergenic
1188844145 X:35053012-35053034 CTATGATCAGTAATGACTTGTGG + Intergenic
1189581702 X:42413827-42413849 CTGTGAAGAGGAGTGGATCGGGG + Intergenic
1192423219 X:71052588-71052610 CTGTTAACAGCAGTTACTCTGGG + Intergenic
1197612699 X:128656997-128657019 CTGTGACCAGCTGTGACTGGTGG + Intergenic
1200975477 Y:9207976-9207998 CTGTAAACAGTTGTGACCAGGGG + Intergenic