ID: 1002347113

View in Genome Browser
Species Human (GRCh38)
Location 5:178555798-178555820
Sequence TCTGTGAACAGTAGTGACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347113_1002347124 12 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347113_1002347123 11 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347113_1002347128 23 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347128 5:178555844-178555866 AGCTCCCAGGGGGAGGCTTCAGG No data
1002347113_1002347125 13 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347113_1002347127 16 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347113_1002347122 10 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347113_1002347118 -10 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347113_1002347119 -2 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347113_1002347120 -1 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347113 Original CRISPR TCTGTGAACAGTAGTGACTC GGG (reversed) Intronic