ID: 1002347113

View in Genome Browser
Species Human (GRCh38)
Location 5:178555798-178555820
Sequence TCTGTGAACAGTAGTGACTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347113_1002347124 12 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347113_1002347119 -2 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347113_1002347118 -10 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347113_1002347127 16 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347113_1002347128 23 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347128 5:178555844-178555866 AGCTCCCAGGGGGAGGCTTCAGG No data
1002347113_1002347120 -1 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347113_1002347125 13 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347113_1002347122 10 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347113_1002347123 11 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347113 Original CRISPR TCTGTGAACAGTAGTGACTC GGG (reversed) Intronic
902022802 1:13360029-13360051 GCTGTGAACATGAGTGAGTCTGG - Intergenic
902522765 1:17030315-17030337 TCTGTCAAGTGTAGTGGCTCAGG - Intronic
905938568 1:41844310-41844332 TCTGTGAACATCAGGGATTCTGG + Intronic
907732223 1:57077868-57077890 CCTGTGAATAGTATTGCCTCGGG - Intronic
908284878 1:62585612-62585634 CCTGTGAACAGTAATGACAGTGG - Intronic
908733928 1:67256392-67256414 ACTGTGAACAATAGTGTCACAGG + Intronic
908963177 1:69726752-69726774 TCTGTGGACATAATTGACTCTGG - Intronic
911867604 1:103048851-103048873 TATGTACCCAGTAGTGACTCAGG + Intronic
912196869 1:107408231-107408253 TTTGTGATCAGTAGTCTCTCTGG + Intronic
913182269 1:116333825-116333847 TCTGTGTCCAGTGGTGACACAGG + Intergenic
919018132 1:192067576-192067598 ACCGTTCACAGTAGTGACTCAGG - Intergenic
922745908 1:228043683-228043705 TCTGTAAACAGAGGTGACTCTGG + Intronic
924261805 1:242239090-242239112 TCTTTGTACTGTAGTCACTCAGG + Intronic
1066604446 10:37146608-37146630 TCTGTAAACAGTTGTGACTATGG + Intronic
1066819287 10:39465378-39465400 GCTGTGCTCAGTAGTCACTCAGG + Intergenic
1067016324 10:42758433-42758455 TCTGATGACAGCAGTGACTCAGG + Intergenic
1067056164 10:43052724-43052746 AATGTGAACAGTGGTGAATCTGG - Intergenic
1070575484 10:77674115-77674137 TCTCTTTACAATAGTGACTCTGG - Intergenic
1071984417 10:91036308-91036330 TCTGAGAACAGCAAGGACTCAGG + Intergenic
1072200131 10:93150653-93150675 TCTATGGACAGAAGTGGCTCAGG + Intergenic
1073433320 10:103500882-103500904 TCTGAGAACTGTTGTGACTCTGG + Intronic
1074054278 10:109907975-109907997 ACTGTGAACATTAGTGTTTCTGG - Intronic
1076624117 10:131811128-131811150 TCTGAGACCAGCAGGGACTCGGG + Intergenic
1077822725 11:5765611-5765633 TCTGGGAGCAGTAATGCCTCTGG - Intronic
1077854429 11:6108288-6108310 TCCTGGAACAGTAGTGTCTCTGG - Exonic
1077862385 11:6194684-6194706 TCTCTGACCAGTAGTGGCTGAGG - Intergenic
1078490184 11:11761061-11761083 TATTTGTACAGTAGTGCCTCTGG + Intergenic
1079615868 11:22492155-22492177 TCTGTAAACGGGAGTGAATCGGG + Intergenic
1079997145 11:27306086-27306108 TCTCTCAACAGTAGTGTCACAGG - Intergenic
1080371797 11:31656055-31656077 TCAGTGAACATAAATGACTCAGG - Intronic
1081429968 11:42966110-42966132 TCTGTGAACAAGTGTGTCTCAGG + Intergenic
1086279075 11:85164622-85164644 TCTTTCAACAGAATTGACTCTGG - Intronic
1087987798 11:104706415-104706437 TGTGTCAACAGTAGTGACTATGG - Intergenic
1089194024 11:116681313-116681335 GTTGTGAACAGTTGTCACTCTGG - Intergenic
1095794794 12:46206599-46206621 CCTGAGAACACTAGAGACTCTGG + Intronic
1098016600 12:66111295-66111317 TCTGGAAACAGTAGTGACAGTGG + Intergenic
1098180618 12:67842335-67842357 TCTGTGAACAGATGGGACACAGG + Intergenic
1101289089 12:103348513-103348535 TCTTTGAACAGCAGTATCTCAGG - Intronic
1101524169 12:105512554-105512576 TCTGTGAACACTATTGCCTTTGG - Intergenic
1102752831 12:115310778-115310800 TCAGTGAACAGCAGCCACTCTGG + Intergenic
1107500570 13:40970295-40970317 ACTTTGAACAGTAATTACTCTGG + Intronic
1108840604 13:54609436-54609458 TCTGTTAACGGTAGTGGCTAAGG + Intergenic
1109836547 13:67865660-67865682 TCTGTAATCAGAACTGACTCCGG + Intergenic
1110436739 13:75484221-75484243 AATGTGAACAGAAGTGACTTGGG + Intergenic
1110539965 13:76697000-76697022 TATGAGAATAGTAGTGTCTCAGG + Intergenic
1113322304 13:109246112-109246134 CCTGTGAACTGTAGTCACTGTGG - Intergenic
1118019122 14:61693371-61693393 TCTGTTAACAGTAATTACTCGGG - Intergenic
1119398287 14:74344795-74344817 TCATTGGACAGTAGTGGCTCTGG + Intronic
1119409114 14:74418139-74418161 ACTGTGAAGTGTTGTGACTCTGG + Intronic
1119819256 14:77600305-77600327 CCTGTGAAAAGAAGTGACTTTGG + Intronic
1120119393 14:80659719-80659741 ACAGTGAAAACTAGTGACTCAGG + Intronic
1125314475 15:38416632-38416654 TCTGTGAACAGTAATGATATGGG + Intergenic
1132598193 16:762650-762672 TCTGTGGAGGGCAGTGACTCAGG - Exonic
1133203684 16:4220034-4220056 TCCGTGAACAGTACAAACTCTGG + Intronic
1134869318 16:17637538-17637560 TCTGTGAACTGTAGTGACAGAGG - Intergenic
1135068484 16:19331954-19331976 TCTGTCAACTGTCGTGACACTGG - Intergenic
1135112251 16:19699418-19699440 GCTGTGGACAGTGCTGACTCTGG - Intronic
1138967318 16:62100341-62100363 TCTATGAACAGCAATGAGTCAGG - Intergenic
1139102930 16:63789896-63789918 TCTGTGAATAATAGTGAGGCAGG - Intergenic
1139157870 16:64466046-64466068 TTTATGAACAGTGGTGACTTAGG - Intergenic
1140799596 16:78473565-78473587 TCTGTGAGCAGACGTGATTCAGG + Intronic
1151887951 17:76934160-76934182 TCAGTGAACAGTAGCGTCTTGGG - Intronic
1154419980 18:14220801-14220823 TCAGTGAACTGTAATAACTCTGG + Intergenic
1154477816 18:14781769-14781791 TCTGTGAACAGTTGCCACTATGG + Intronic
1158438709 18:57454338-57454360 TATGGGAACATTGGTGACTCAGG - Intronic
1162528776 19:11223224-11223246 TCTGTGGGCTGTGGTGACTCTGG + Intronic
925723384 2:6849841-6849863 TTAGTGAACCGTAGTTACTCTGG - Exonic
925736392 2:6967633-6967655 TCCATTAACAGTAGTGACTGCGG + Intronic
925763944 2:7213000-7213022 TTTGAGAACAGGAGGGACTCTGG - Intergenic
927663176 2:25009955-25009977 GCTGTGAACAGTGCTGAATCCGG + Intergenic
928292325 2:30050404-30050426 TCTGGGAATAGTAGAGACCCTGG - Intergenic
929950971 2:46409222-46409244 TCTGTTGACAAAAGTGACTCAGG + Intergenic
930454284 2:51585171-51585193 TCTGTGAACACCAGTGAATGTGG - Intergenic
930761831 2:55046952-55046974 TCTTTGAACATTAGGGATTCAGG - Intronic
930766018 2:55086078-55086100 ACTGTGAACAGAAGTAACACAGG + Intronic
933484081 2:82896483-82896505 TCAGTGAAAAATAGTGACGCAGG - Intergenic
934847794 2:97673526-97673548 TCGGTGAACAGGAGTGACCTTGG + Intergenic
937821131 2:126312315-126312337 CCTGGGAACAGTAGAGACTGAGG + Intergenic
938824596 2:134992500-134992522 TCTGTGAACTGTTTTGACCCTGG - Intronic
942093133 2:172513398-172513420 GCTGTAAACAGTTGTGACTGCGG - Intergenic
943433339 2:187831711-187831733 GATGTGAACAGTAGAGACTGGGG + Intergenic
943433627 2:187835010-187835032 TATGTGGAGAGTAGCGACTCAGG + Intergenic
943948074 2:194092959-194092981 GCTGTAAACAGTTGTGACTGTGG + Intergenic
946295068 2:218777483-218777505 TAGGTGACCAGGAGTGACTCAGG + Intergenic
946939739 2:224758400-224758422 ACTGGGAGCAGTAGTGACTGTGG + Intergenic
948428236 2:237902029-237902051 GCTGTGAACACATGTGACTCAGG - Intronic
948772763 2:240259963-240259985 CCTGTGACCAGCAGTGACCCAGG + Intergenic
1172390421 20:34561487-34561509 TCTGTCCAGAGTAGTGACTGTGG - Intronic
1176243424 20:64085314-64085336 TCTGTGAACACCAGTGGCTGGGG - Intronic
1177818937 21:26010118-26010140 GCTGGGAACAGCAGTGTCTCTGG + Intronic
1177943109 21:27435190-27435212 TATGTAACCAGTAGTCACTCAGG + Intergenic
1178564123 21:33667745-33667767 ACTGTGAACAGTGCAGACTCAGG - Intronic
1182085317 22:27557202-27557224 TCTCTGAACAGAACTGACTGGGG + Intergenic
1184322031 22:43749286-43749308 TCTGTGGACACTGGTGAGTCTGG + Intronic
1185236475 22:49716499-49716521 TCTGTGAATGGTAGACACTCTGG + Intergenic
951357202 3:21682385-21682407 TTTGTGAAGAGAAGAGACTCAGG + Intronic
953078178 3:39590961-39590983 TCAGGGAACAGCAGTGGCTCAGG + Intergenic
955115517 3:55995729-55995751 CCTCTGAAAAGTTGTGACTCAGG - Intronic
963861922 3:150320635-150320657 TATGGGAACAGTAGAGACTGTGG - Intergenic
964689704 3:159436742-159436764 TATGTGAACAGTAATGGCTTAGG + Intronic
965328435 3:167337624-167337646 ACTGTTAACAGTAGTTACTCTGG - Intronic
967702532 3:192610124-192610146 TCTGTGATCCTTAGTAACTCTGG - Intronic
968933162 4:3594941-3594963 TCTGTGAACTCCAGTGTCTCTGG + Intergenic
973165234 4:47069241-47069263 TCAGTTATCTGTAGTGACTCAGG - Intronic
974564410 4:63565240-63565262 CCTCTGAAGAGTAGTGAATCAGG - Intergenic
974952641 4:68601311-68601333 CCTGTGAACATGAGTGAGTCTGG - Intronic
978507987 4:109481126-109481148 TCTGCTAACAGTAGATACTCTGG - Intronic
978509268 4:109498240-109498262 TCAGTGAACAGTAATGATTTAGG + Intronic
983197877 4:164827545-164827567 TCTGTGAAAAGTTATGACTTAGG + Intergenic
984231616 4:177107534-177107556 TCTGTGACCAGTGGTGAATGGGG + Intergenic
991052348 5:62286941-62286963 TCTGTGGAAAGTAGTGAATGAGG - Intergenic
992883317 5:81131767-81131789 TCTCTGGATAGCAGTGACTCAGG - Intronic
994084757 5:95745584-95745606 TCTTTGAAAAGTAGTGGCTTTGG - Intronic
995006904 5:107209062-107209084 AATGTGAACAGTGCTGACTCAGG - Intergenic
995121732 5:108543023-108543045 TCAGTGAAAAGGAGTGAATCTGG - Intergenic
995173185 5:109141590-109141612 TCTGGGCACAGTAGCGACTTAGG + Intronic
996951334 5:129129471-129129493 TCTGTGCATAGAAGTGCCTCTGG - Intergenic
999344956 5:150809577-150809599 ACTGTAAACAGTTGTGACTGTGG - Intergenic
1001235345 5:170024774-170024796 TCTGAGCACAGTACTGACCCTGG + Intronic
1002017555 5:176337290-176337312 TCTTTTCACAGTGGTGACTCCGG - Intronic
1002057534 5:176607177-176607199 ACTGTGAGCAGTAGAGCCTCTGG - Intronic
1002329451 5:178431363-178431385 TCTGTCAACCGTAGTGTCTTTGG - Intronic
1002347113 5:178555798-178555820 TCTGTGAACAGTAGTGACTCGGG - Intronic
1006391681 6:33762311-33762333 TCTGGGGACAGGAGTGACACCGG - Intergenic
1006463443 6:34177241-34177263 CCTGTGAACAGGAGGGACCCAGG + Intergenic
1009801673 6:68545729-68545751 GCTGTAAACAGTTGTGACTGTGG + Intergenic
1011312026 6:85989903-85989925 TCTGTCAATATTAGTGACTGAGG + Intergenic
1012695853 6:102382994-102383016 TCTGAAAGCAGAAGTGACTCTGG - Intergenic
1012941770 6:105423192-105423214 TCTGTGAGCAGTAATTACTCAGG - Intergenic
1013701616 6:112777151-112777173 TCAGTGAACTGTATTGTCTCTGG - Intergenic
1015541732 6:134321009-134321031 TTAGTAAACAGTAGTCACTCTGG - Intergenic
1025932428 7:66006886-66006908 CCTGTGAACATGAGTGAGTCTGG + Intergenic
1026126333 7:67582868-67582890 CCTGTGAAGAGAAATGACTCAGG + Intergenic
1026227795 7:68457903-68457925 TCAGTGGACAGTAATGGCTCTGG + Intergenic
1028058113 7:86274215-86274237 GCTGTAAAGAGTAGTGACTTTGG - Intergenic
1028927355 7:96372908-96372930 TTTGGGAAAAGTAATGACTCTGG + Intergenic
1032940347 7:136781323-136781345 GCTGTGAACAGTAGTGGGTGGGG + Intergenic
1037187927 8:16087444-16087466 ACTGTAAACATTACTGACTCTGG - Intergenic
1040316809 8:46266264-46266286 CCTGTGAACATGAGTGAGTCTGG + Intergenic
1040552307 8:48446918-48446940 TTTTTGAAAAGTTGTGACTCAGG + Intergenic
1041695092 8:60727428-60727450 TCTGTTAAGAGTAGTTACTATGG - Intronic
1042360937 8:67882424-67882446 TCTCTGCTCAGTAGTTACTCTGG - Intergenic
1044912945 8:97081266-97081288 TGTGTGAGGAGTAGTGAGTCTGG - Intronic
1050049692 9:1586669-1586691 TATGTGCACAGTAGTCATTCAGG + Intergenic
1051786474 9:20750097-20750119 TCTCTGAACAGTGTTGACTTTGG + Intronic
1055022503 9:71685239-71685261 TCTGCGGACAGTGGTGGCTCTGG + Exonic
1056849367 9:90069286-90069308 TCTGGTAAGAGTAGTGACTTGGG + Intergenic
1058594314 9:106599142-106599164 TCAGTGAACTGTAGAGTCTCTGG - Intergenic
1058880182 9:109278938-109278960 ACTGTGAACAGTTCTGTCTCAGG + Intronic
1061155113 9:128855220-128855242 TCTGTGAACATGAGTGAGTCTGG - Intronic
1061273258 9:129555942-129555964 TCTGTGAACTGTCGTGGCGCTGG - Intergenic
1062207977 9:135347657-135347679 GCTCTGAAGAGTTGTGACTCAGG + Intergenic
1203756136 Un_GL000218v1:128735-128757 TTGGTGAACAGTGGTGACTTAGG - Intergenic
1185859762 X:3566609-3566631 TCTGTAAACTGTCGTGGCTCTGG + Intergenic
1187774080 X:22735351-22735373 TCTTTGTACAGTAGTCTCTCAGG - Intergenic
1188120055 X:26293936-26293958 GTTGTGAACTGTAGTTACTCTGG + Intergenic
1191159383 X:57311912-57311934 TCTGTGGACAGTAATGAAGCTGG + Intronic
1191579183 X:62741283-62741305 CCTGTGAACATGAGTGAGTCTGG - Intergenic
1192423218 X:71052587-71052609 ACTGTTAACAGCAGTTACTCTGG + Intergenic
1193612787 X:83652821-83652843 TCTGTAGCCAGTAGTGATTCAGG + Intergenic
1197906541 X:131431144-131431166 TCTGTGCCCAGTAGTCATTCAGG - Intergenic
1200260127 X:154610626-154610648 CCTGTGAACATCAGTGAGTCTGG + Intergenic