ID: 1002347114

View in Genome Browser
Species Human (GRCh38)
Location 5:178555799-178555821
Sequence GTCTGTGAACAGTAGTGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347114_1002347120 -2 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data
1002347114_1002347127 15 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347114_1002347119 -3 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347114_1002347124 11 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347114_1002347122 9 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347114_1002347123 10 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347114_1002347128 22 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347128 5:178555844-178555866 AGCTCCCAGGGGGAGGCTTCAGG No data
1002347114_1002347125 12 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347114 Original CRISPR GTCTGTGAACAGTAGTGACT CGG (reversed) Intronic