ID: 1002347114

View in Genome Browser
Species Human (GRCh38)
Location 5:178555799-178555821
Sequence GTCTGTGAACAGTAGTGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347114_1002347124 11 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347124 5:178555833-178555855 GACCATAGGGCAGCTCCCAGGGG No data
1002347114_1002347128 22 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347128 5:178555844-178555866 AGCTCCCAGGGGGAGGCTTCAGG No data
1002347114_1002347127 15 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347114_1002347119 -3 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347119 5:178555819-178555841 GACGGTGGAGGCCGGACCATAGG No data
1002347114_1002347123 10 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347123 5:178555832-178555854 GGACCATAGGGCAGCTCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1002347114_1002347122 9 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347122 5:178555831-178555853 CGGACCATAGGGCAGCTCCCAGG No data
1002347114_1002347125 12 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347125 5:178555834-178555856 ACCATAGGGCAGCTCCCAGGGGG 0: 1
1: 0
2: 0
3: 17
4: 142
1002347114_1002347120 -2 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC 0: 1
1: 0
2: 0
3: 4
4: 131
Right 1002347120 5:178555820-178555842 ACGGTGGAGGCCGGACCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347114 Original CRISPR GTCTGTGAACAGTAGTGACT CGG (reversed) Intronic
903690324 1:25168775-25168797 TTCTGTAAACAGTTGAGACTCGG - Intergenic
905237645 1:36561063-36561085 GTATGTGAATATTAGTGTCTGGG - Intergenic
905253849 1:36666980-36667002 TTATGTGAACTGTAGTGTCTGGG + Intergenic
906746532 1:48225952-48225974 GTCTGTGACCACTAGAGAGTGGG - Intronic
906751612 1:48267730-48267752 GTCTGTGACCACTAGGGTCTGGG + Intergenic
907975104 1:59423913-59423935 GTCTGTGAACAGGTGAGACAAGG - Intronic
909152275 1:72022765-72022787 GTCTGTGAATAGTGGCAACTTGG - Intronic
911936067 1:103974346-103974368 GTCTGTGGTGAGTTGTGACTCGG + Intergenic
914838760 1:151230346-151230368 GTCTGATAACAGTAGCCACTAGG - Intronic
915136357 1:153734423-153734445 GCCTGTGAACAGAAAGGACTGGG + Intronic
1067789102 10:49274199-49274221 GTTTGTAGACAGTAGTGACCAGG + Intergenic
1068322063 10:55432523-55432545 GTAAGAGAACAATAGTGACTTGG + Intronic
1070110184 10:73478749-73478771 GTCTATGAACAGTCATGATTAGG + Intronic
1072470397 10:95707489-95707511 GTTTGAGAGGAGTAGTGACTGGG + Intergenic
1075927181 10:126261209-126261231 GTGTGTGCACAGTCGTGCCTTGG - Intronic
1076394978 10:130131727-130131749 GTCTTTGAAAAGAACTGACTGGG - Intergenic
1078511022 11:11984052-11984074 CTCTGTGACGAGGAGTGACTAGG + Intronic
1084886101 11:72207935-72207957 GTCTGGGAGCAGAAGGGACTAGG + Intergenic
1085147910 11:74219731-74219753 GGCTGGGAACAGTAGTGGATGGG + Intronic
1091657251 12:2354658-2354680 GTCTGTGGTCAGGAGTGTCTGGG - Intronic
1093804649 12:23417438-23417460 GTCATTGAAAAGTAATGACTTGG - Intergenic
1097140580 12:56899645-56899667 GTATGTCAACAATAGTGCCTGGG - Intergenic
1098118816 12:67212450-67212472 GTGTGTGACCAGTAGTGTTTCGG - Intergenic
1102901364 12:116640274-116640296 GTATGTGTACAGTATGGACTGGG - Intergenic
1107323173 13:39211084-39211106 GTCTGGGAGCAGTTGTGCCTGGG - Intergenic
1107500986 13:40975613-40975635 GTCTTAGAACTGTAGTGACATGG + Intronic
1110307390 13:74005501-74005523 ATCTGTGAACAGTAGGCACCAGG + Intronic
1110436738 13:75484220-75484242 AAATGTGAACAGAAGTGACTTGG + Intergenic
1115197763 14:30820052-30820074 GTCTGTGAACAAAAATGCCTGGG - Intergenic
1118019123 14:61693372-61693394 CTCTGTTAACAGTAATTACTCGG - Intergenic
1121214464 14:92236561-92236583 CTCAGAGAACAGGAGTGACTTGG - Intergenic
1121329556 14:93041344-93041366 GTCTCTGCACAGTATTGCCTGGG + Intronic
1123812843 15:23946267-23946289 TTCTGTGAAGAGATGTGACTGGG - Intergenic
1124167173 15:27338549-27338571 GTCTGTGCAGAGTGTTGACTTGG + Intronic
1125314474 15:38416631-38416653 ATCTGTGAACAGTAATGATATGG + Intergenic
1126561279 15:50047071-50047093 GGCTGTGAACAGTAATTATTAGG + Intronic
1128536293 15:68493165-68493187 GTCTGTCAGCAGCAGAGACTGGG - Intergenic
1128613786 15:69093948-69093970 GTCAGTGATCAGGAGTGACAAGG - Intergenic
1131966234 15:97846719-97846741 GTCTGTGAACAGTATTTCATAGG + Intergenic
1134061580 16:11202659-11202681 GTCTGGGAACAGAAGTGCCCAGG + Intergenic
1134424547 16:14127709-14127731 GTGTGTGAACAGTAGTGGGACGG - Intronic
1137267669 16:46882628-46882650 GTCTCTGATCAGTAGGGACAGGG - Intergenic
1138789769 16:59889528-59889550 GTCTGGGAAGAGTAGTGGTTGGG + Intergenic
1140662710 16:77203244-77203266 TTCTGGGAAAAGGAGTGACTTGG + Intronic
1141810229 16:86371193-86371215 GTCTGTGGAGACAAGTGACTGGG - Intergenic
1150844985 17:68647290-68647312 TCCTGTAAACAGTCGTGACTTGG + Intergenic
1151273184 17:73012716-73012738 GGATGGGAACAGTAGTCACTGGG - Intronic
1151887952 17:76934161-76934183 CTCAGTGAACAGTAGCGTCTTGG - Intronic
1157719315 18:49911651-49911673 TCCTGTAAACAGTTGTGACTGGG - Intronic
929554734 2:42919027-42919049 GTCTGTGAACAGAAGGGGTTGGG + Intergenic
929998678 2:46846627-46846649 GGCTGTGAACGGTGGTTACTTGG - Intronic
932649094 2:73536226-73536248 GTCTGTAAACAGTAGAAACCTGG + Intronic
932975847 2:76598584-76598606 TTCTGTGAATATTAATGACTAGG + Intergenic
934683651 2:96305116-96305138 ACCTGTGAAAAGTAGTGAGTGGG + Intronic
937761553 2:125610179-125610201 GTCTCTGAACCTTTGTGACTTGG + Intergenic
938227168 2:129626041-129626063 GGCTTTGAAGAGAAGTGACTGGG + Intergenic
940979495 2:159985766-159985788 GTGTATGAACAATATTGACTGGG + Intronic
943250853 2:185519235-185519257 TTCTGTCATCAGTACTGACTAGG - Intergenic
943433338 2:187831710-187831732 AGATGTGAACAGTAGAGACTGGG + Intergenic
945515240 2:210755919-210755941 GTTTATGAACAGTAATTACTTGG + Intergenic
947738566 2:232473920-232473942 CTCTGTGAACAGAAGGGACCAGG - Intergenic
1176243425 20:64085315-64085337 TTCTGTGAACACCAGTGGCTGGG - Intronic
1178270778 21:31187810-31187832 GTCTGGAAACAGGAGTGACCAGG - Intronic
1180871993 22:19151390-19151412 ATCTGTAAAGTGTAGTGACTAGG + Intergenic
1181784961 22:25220435-25220457 GTCTGTGAACACTCAGGACTGGG + Intronic
1182085316 22:27557201-27557223 GTCTCTGAACAGAACTGACTGGG + Intergenic
1182828949 22:33289318-33289340 CCCTGTGAACATAAGTGACTTGG + Intronic
949510960 3:4766634-4766656 GACAGTGAACACCAGTGACTTGG + Exonic
954010210 3:47629957-47629979 GTCTGGCAACAGTGGTGACCAGG + Intronic
954109060 3:48424238-48424260 GTCTGTGAACAGCGGCGCCTGGG - Exonic
954139508 3:48597617-48597639 TACTGTGAAGAGAAGTGACTTGG - Intergenic
955754937 3:62217124-62217146 GCCTGTGCACAGTAGGGGCTTGG + Intronic
957182402 3:76896705-76896727 GTCTGATAACATTGGTGACTGGG + Intronic
958815222 3:98906669-98906691 TTCTGTGAACAGAAGTGTTTTGG + Intergenic
966144741 3:176797720-176797742 GAATGTGAACAGAAATGACTAGG + Intergenic
967355973 3:188571985-188572007 GTCTATGGAGATTAGTGACTTGG + Intronic
967656000 3:192049712-192049734 GTCTGAGAAGGGTAGTGAGTGGG + Intergenic
969403041 4:6969768-6969790 TTCTGTGAACTGAAATGACTAGG + Intronic
970304404 4:14716935-14716957 GTATGTGCACAGTGATGACTTGG - Intergenic
970670116 4:18387019-18387041 GTCAATGAAGAGTAGAGACTGGG - Intergenic
971250006 4:24966761-24966783 GTCTTTGAACTGAAGTGCCTGGG - Intronic
971779973 4:31020767-31020789 TGCTGTGAACAGTAGTAATTAGG - Intronic
972483203 4:39517689-39517711 ATTTGGGAATAGTAGTGACTAGG - Intronic
973057348 4:45677975-45677997 GTGTGTGCACAGTATTTACTAGG - Intergenic
977040678 4:92013462-92013484 TTCTGTAAACAGTTGCGACTCGG + Intergenic
978620183 4:110629561-110629583 GTCTGTGCACACCAGCGACTTGG + Intronic
983926781 4:173411324-173411346 GTATGAGAACAGTGATGACTTGG + Intergenic
984231615 4:177107533-177107555 TTCTGTGACCAGTGGTGAATGGG + Intergenic
985817331 5:2136659-2136681 GTGTGTGGACAGAAGTGACCAGG + Intergenic
985817368 5:2136847-2136869 GTGTGTGGACAGAAGTGACCGGG + Intergenic
985817430 5:2137161-2137183 GTGGGTGGACAGAAGTGACTAGG + Intergenic
986939736 5:12936018-12936040 GTCTTTGAACTGAAGTGCCTGGG - Intergenic
988410215 5:30877097-30877119 GTCTGTGAATATTGGTTACTGGG - Intergenic
989491962 5:42067345-42067367 GTCTGAGAAGGGTAGTGAGTGGG - Intergenic
992770598 5:80043771-80043793 GTTTGTGAACAGTAATGAGGTGG - Intronic
992951526 5:81862783-81862805 CTATGTGAACAGTAGAGATTTGG - Intergenic
993620775 5:90165153-90165175 GTCTGTGAACAGTGATGATTTGG - Intergenic
994018108 5:94992054-94992076 GGCTGTTAACAGCAGTCACTTGG + Intronic
994505180 5:100634067-100634089 GTCTTTGAACAGAATTGGCTTGG + Intergenic
994954925 5:106515956-106515978 GTGTGTGTACAGTAGTCCCTTGG - Intergenic
998635415 5:143949287-143949309 GTCTGTGAGCAGGAGAGATTTGG - Intergenic
1002347114 5:178555799-178555821 GTCTGTGAACAGTAGTGACTCGG - Intronic
1004251510 6:14026635-14026657 GGCTATGAACAGTAGATACTAGG + Intergenic
1009849644 6:69179839-69179861 GTCTGTGGCCTGTAATGACTAGG + Intronic
1013431880 6:110063082-110063104 CTCTGAGAACAGAAGTAACTTGG + Intergenic
1013770680 6:113624728-113624750 GTGTGTGAACAGTAAATACTAGG + Intergenic
1014104369 6:117546443-117546465 GCCTGTGCACATCAGTGACTGGG + Intronic
1018917098 6:168140238-168140260 GGCTGAGAACAGTAGTGAGAGGG - Intergenic
1021483205 7:21140966-21140988 GTTTATGAAAAGTAGTGAGTAGG - Intergenic
1022634530 7:32119595-32119617 TTCTCTCAACAGAAGTGACTAGG + Intronic
1023900324 7:44471978-44472000 TTCTGAGAAGAGTAGGGACTGGG - Intronic
1024490562 7:49977556-49977578 GTCTGTGATCAGAAATGATTAGG - Intronic
1028188568 7:87819127-87819149 TCCTGTAAACAGTTGTGACTCGG + Intronic
1030465854 7:109902501-109902523 GTCTGGGAAGAGTAGTGGCGGGG - Intergenic
1031735430 7:125353800-125353822 GTCTGAGAAAAGTAGAGAATGGG - Intergenic
1032940346 7:136781322-136781344 GGCTGTGAACAGTAGTGGGTGGG + Intergenic
1033015127 7:137663561-137663583 GTCTATGTACAGGAGTCACTGGG + Intronic
1033030514 7:137821378-137821400 GTCTGTGACCAGGGGTGAATTGG - Intronic
1037727046 8:21491435-21491457 GTCTGTCAACAGAAGCCACTGGG - Intergenic
1038256087 8:25952603-25952625 GTCTGTGAAAAGGAGTGAGCAGG - Intronic
1039020349 8:33197928-33197950 TTCTGTAAACAGTTGCGACTCGG - Intergenic
1043156571 8:76788679-76788701 GGCTGTGAACAGCATTGATTTGG - Intronic
1049283177 8:141760897-141760919 GTCTCTGATGAGTATTGACTGGG - Intergenic
1049686152 8:143940091-143940113 GTCTGTGAAGAGGTGTGATTGGG - Intronic
1050093741 9:2042207-2042229 GTATGTGAAGAGTATTAACTAGG + Intronic
1050145492 9:2562920-2562942 GGCTGTGAAGGGTAGTGACGGGG + Intergenic
1056849366 9:90069285-90069307 GTCTGGTAAGAGTAGTGACTTGG + Intergenic
1057216376 9:93231041-93231063 GTCTGTGAAGATTGGCGACTTGG + Exonic
1058236465 9:102496926-102496948 CTCTGTGAACGGCAGTGACGTGG + Intergenic
1059787147 9:117598230-117598252 GGCAGGGCACAGTAGTGACTGGG - Intergenic
1186334713 X:8574004-8574026 TTCTGTGCACAGGAGTGACATGG - Intronic
1187090735 X:16093818-16093840 GGCTGAGAACAGTAGTGAGGAGG - Intergenic
1187213792 X:17254919-17254941 CTCTGGGAACAGAAGGGACTAGG + Intergenic
1196517411 X:116629745-116629767 GGCTGAGAAGAGTAGTGAGTGGG - Intergenic
1198530670 X:137547731-137547753 GTTTGCCAACAGTTGTGACTGGG - Intergenic
1202089433 Y:21174484-21174506 TTCTGTAAACGGTTGTGACTCGG - Intergenic