ID: 1002347116

View in Genome Browser
Species Human (GRCh38)
Location 5:178555804-178555826
Sequence TCACTACTGTTCACAGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347102_1002347116 19 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347104_1002347116 11 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG No data
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347106_1002347116 7 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347110_1002347116 -6 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347109_1002347116 -5 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347100_1002347116 27 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC No data
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347108_1002347116 1 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347107_1002347116 6 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347101_1002347116 26 Left 1002347101 5:178555755-178555777 CCAGGCTCCAAGGTGCCGGCCCT 0: 1
1: 0
2: 2
3: 13
4: 181
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347116 Original CRISPR TCACTACTGTTCACAGACGG TGG Intronic