ID: 1002347116

View in Genome Browser
Species Human (GRCh38)
Location 5:178555804-178555826
Sequence TCACTACTGTTCACAGACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 43}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347100_1002347116 27 Left 1002347100 5:178555754-178555776 CCCAGGCTCCAAGGTGCCGGCCC 0: 1
1: 0
2: 1
3: 16
4: 154
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347110_1002347116 -6 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347102_1002347116 19 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347109_1002347116 -5 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347107_1002347116 6 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC 0: 1
1: 0
2: 1
3: 29
4: 200
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347101_1002347116 26 Left 1002347101 5:178555755-178555777 CCAGGCTCCAAGGTGCCGGCCCT 0: 1
1: 0
2: 2
3: 13
4: 181
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347108_1002347116 1 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA 0: 1
1: 0
2: 0
3: 10
4: 125
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347104_1002347116 11 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG 0: 1
1: 0
2: 3
3: 45
4: 432
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43
1002347106_1002347116 7 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG 0: 1
1: 0
2: 0
3: 5
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347116 Original CRISPR TCACTACTGTTCACAGACGG TGG Intronic
908340055 1:63168916-63168938 TCACTGCTGTGCACACACAGGGG - Intergenic
912026097 1:105175499-105175521 TCACTACTCTTCCCAGACACTGG + Intergenic
912476285 1:109937771-109937793 TGACTACTGTTCACAGCCTCTGG + Intergenic
918285048 1:183044679-183044701 TTACTACTGTCCACAAAAGGGGG - Intronic
1063617049 10:7609333-7609355 TCCCAACTCTTCACAGACAGTGG - Intronic
1079574470 11:21986269-21986291 TCACATCTGTTCACAGATGATGG + Intergenic
1084198326 11:67539083-67539105 TCAGTCCTGTTCACAGGAGGTGG + Intergenic
1097200859 12:57277370-57277392 TCAGTACTGTTCCCAGACCTGGG + Intronic
1097448828 12:59711221-59711243 GCACTACTGTTCCCAGAAGAAGG + Intronic
1097794787 12:63849979-63850001 TAACTCCTGTTCACAGACGACGG - Intronic
1104184209 12:126413407-126413429 TCAGGACTGTTCACAGTCTGAGG - Intergenic
1112307115 13:98284927-98284949 TCACTCCTGTTAACAGAGGTGGG + Intronic
1115623772 14:35168760-35168782 TCACTAATAGTCACATACGGGGG - Intronic
1129019535 15:72503945-72503967 ACACCGCTGTCCACAGACGGTGG - Intronic
1152442526 17:80317747-80317769 ACACTACTGTCCATAGACGGCGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1156946976 18:42844864-42844886 TCACTACTTTTGATAGAGGGTGG - Intronic
1157650742 18:49327858-49327880 TCACTACAGTCCACAGATGTTGG + Intronic
1167775233 19:51550244-51550266 TCTCTACTGGTCACAGTCAGAGG + Intergenic
926303034 2:11617871-11617893 TCACTGCTGTGCACAGGCGCAGG - Intronic
929869441 2:45745760-45745782 TCACCACTGTTCAGATACTGAGG - Intronic
934683648 2:96305111-96305133 TCACTACTTTTCACAGGTGTGGG - Intronic
946811578 2:223531013-223531035 ACACTGCTGTCCACAGATGGTGG + Intergenic
1170390314 20:15866029-15866051 TCACAACTGATCACACAGGGAGG + Intronic
1173391104 20:42634260-42634282 TCATTAACGTTCACAGTCGGTGG - Intronic
953736477 3:45498222-45498244 TCACTGCTGTTCACAAACTGGGG - Intronic
962384536 3:134922147-134922169 TCACTTCTGCTCTCAGACAGTGG - Intronic
962781851 3:138726531-138726553 ACAATACTGTTCAGAGACCGGGG + Intronic
967846796 3:194050324-194050346 TTACTACTGTTCTCAGACATTGG + Intergenic
969102052 4:4776732-4776754 TCACTGGTGTACACAGACAGGGG - Intergenic
971465999 4:26961671-26961693 TCACTATTATACACAGAAGGTGG + Intronic
973792866 4:54394637-54394659 TCACCACTGTTCAGAGAGGGAGG - Intergenic
975404084 4:73969117-73969139 TCTCTTCTGTTCACAGGCTGGGG + Intergenic
1001141680 5:169149585-169149607 TCACCACTGTTCACAAAAGTAGG - Intronic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1007267618 6:40609145-40609167 CCACTACTGTTCAAGGAAGGAGG - Intergenic
1011492560 6:87907376-87907398 TCACTACTGCTCAAAGACTTGGG - Intergenic
1011855674 6:91687546-91687568 TCATTATTGTACACAGATGGAGG - Intergenic
1018917100 6:168140243-168140265 TCACTACTGTTCTCAGCCTCTGG + Intergenic
1021134789 7:16952248-16952270 ACACTACTGTTCAAAGCCTGAGG + Intergenic
1024673816 7:51620397-51620419 TCACTACTTTTCTCAAACAGTGG - Intergenic
1032940342 7:136781317-136781339 CCACTACTGTTCACAGCCTCTGG - Intergenic
1035894725 8:3386631-3386653 TCAATACTTTTCACAGACAAAGG - Intronic
1041131920 8:54710427-54710449 ACACTGCTGTCTACAGACGGTGG - Intergenic
1056429854 9:86516526-86516548 ACACTACTGTTCATGGACAGTGG + Intergenic
1185672058 X:1820760-1820782 TCACTACTGCTCTCATGCGGTGG - Intergenic
1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG + Intergenic
1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG + Intergenic
1189319989 X:40082166-40082188 TCACATCTTTTCACAGAGGGTGG - Intronic