ID: 1002347118

View in Genome Browser
Species Human (GRCh38)
Location 5:178555811-178555833
Sequence TGTTCACAGACGGTGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 134}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347107_1002347118 13 Left 1002347107 5:178555775-178555797 CCTCACCAGTTCCCTGGGATGCC No data
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347112_1002347118 -9 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347113_1002347118 -10 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347104_1002347118 18 Left 1002347104 5:178555770-178555792 CCGGCCCTCACCAGTTCCCTGGG No data
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347108_1002347118 8 Left 1002347108 5:178555780-178555802 CCAGTTCCCTGGGATGCCCCCGA No data
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347110_1002347118 1 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347109_1002347118 2 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347111_1002347118 -8 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347106_1002347118 14 Left 1002347106 5:178555774-178555796 CCCTCACCAGTTCCCTGGGATGC 0: 1
1: 0
2: 2
3: 12
4: 230
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134
1002347102_1002347118 26 Left 1002347102 5:178555762-178555784 CCAAGGTGCCGGCCCTCACCAGT 0: 1
1: 0
2: 1
3: 16
4: 166
Right 1002347118 5:178555811-178555833 TGTTCACAGACGGTGGAGGCCGG 0: 1
1: 0
2: 0
3: 19
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347118 Original CRISPR TGTTCACAGACGGTGGAGGC CGG Intronic