ID: 1002347127

View in Genome Browser
Species Human (GRCh38)
Location 5:178555837-178555859
Sequence ATAGGGCAGCTCCCAGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002347114_1002347127 15 Left 1002347114 5:178555799-178555821 CCGAGTCACTACTGTTCACAGAC No data
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347111_1002347127 18 Left 1002347111 5:178555796-178555818 CCCCCGAGTCACTACTGTTCACA 0: 1
1: 0
2: 0
3: 4
4: 70
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347112_1002347127 17 Left 1002347112 5:178555797-178555819 CCCCGAGTCACTACTGTTCACAG 0: 1
1: 0
2: 1
3: 5
4: 63
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347109_1002347127 28 Left 1002347109 5:178555786-178555808 CCCTGGGATGCCCCCGAGTCACT 0: 1
1: 0
2: 0
3: 11
4: 68
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347110_1002347127 27 Left 1002347110 5:178555787-178555809 CCTGGGATGCCCCCGAGTCACTA 0: 1
1: 0
2: 1
3: 5
4: 57
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data
1002347113_1002347127 16 Left 1002347113 5:178555798-178555820 CCCGAGTCACTACTGTTCACAGA 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1002347127 5:178555837-178555859 ATAGGGCAGCTCCCAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002347127 Original CRISPR ATAGGGCAGCTCCCAGGGGG AGG Intronic