ID: 1002348010

View in Genome Browser
Species Human (GRCh38)
Location 5:178561442-178561464
Sequence GAGCAGTCCCTGCATTGTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002348010_1002348019 10 Left 1002348010 5:178561442-178561464 CCCCTACAATGCAGGGACTGCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1002348019 5:178561475-178561497 CTGGCCCGATGGAACCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 28
1002348010_1002348015 -9 Left 1002348010 5:178561442-178561464 CCCCTACAATGCAGGGACTGCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1002348015 5:178561456-178561478 GGACTGCTCTGGCAGGCTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 454
1002348010_1002348018 9 Left 1002348010 5:178561442-178561464 CCCCTACAATGCAGGGACTGCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1002348018 5:178561474-178561496 CCTGGCCCGATGGAACCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 62
1002348010_1002348016 -1 Left 1002348010 5:178561442-178561464 CCCCTACAATGCAGGGACTGCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1002348016 5:178561464-178561486 CTGGCAGGCTCCTGGCCCGATGG 0: 1
1: 0
2: 3
3: 19
4: 236
1002348010_1002348022 21 Left 1002348010 5:178561442-178561464 CCCCTACAATGCAGGGACTGCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002348010 Original CRISPR GAGCAGTCCCTGCATTGTAG GGG (reversed) Intronic
903225704 1:21893248-21893270 GACCAGGCCCTGCATTCCAGAGG - Intronic
903339754 1:22646243-22646265 GAGCAGGCCCTGCAGTGGGGCGG + Intronic
904069762 1:27785291-27785313 ATGCAGTCCCTGCCTTCTAGAGG + Intronic
905860060 1:41344420-41344442 GAGCCGTCCCTTCATGGTGGTGG + Intergenic
911396302 1:97314990-97315012 GCTCAGACCCTGCATGGTAGAGG + Intronic
911781294 1:101882775-101882797 CAGCTGTCCCTGCCTTGTTGAGG - Intronic
917949252 1:180012968-180012990 CAGCAGTGCCTGCTATGTAGTGG - Intronic
918983933 1:191598037-191598059 GAGCATTCCTTCCAATGTAGAGG - Intergenic
924434828 1:244030135-244030157 GACTAGTCCCTGCATCTTAGGGG + Intergenic
924752095 1:246903402-246903424 GTCCAGTCCCCTCATTGTAGAGG + Intronic
1063093652 10:2890307-2890329 GAGCAATCCCTCCATGCTAGAGG - Intergenic
1065833929 10:29640197-29640219 GAGCAGTTTCTGGGTTGTAGGGG - Intronic
1065869232 10:29941809-29941831 AGGTAGTCCCTGCATTATAGTGG - Intergenic
1086626509 11:88961739-88961761 GAGCATTCCCTTCATTTTAATGG + Intronic
1091629105 12:2145835-2145857 GGGGAGGCCCTGCAGTGTAGAGG + Intronic
1092162304 12:6322483-6322505 GAGAAGTCCCTGCCATGCAGAGG - Intronic
1095844723 12:46732404-46732426 GAGCAGCACCTGCATTTTTGAGG - Intergenic
1097277595 12:57823894-57823916 GAGCACTCACTGCATTCTCGGGG + Exonic
1102426325 12:112847001-112847023 AAACAGCCCCTGCCTTGTAGGGG + Intronic
1103059791 12:117849167-117849189 GACCAGTCCCTCCATTCCAGAGG + Intronic
1113288898 13:108884045-108884067 GAGCTTTCCCTCCCTTGTAGAGG - Intronic
1117641149 14:57800259-57800281 CAGCAGTCCCTGCAGTAGAGTGG + Intronic
1119404197 14:74386517-74386539 GTGCAGACCCTGCTCTGTAGAGG + Intergenic
1125506453 15:40270465-40270487 CACACGTCCCTGCATTGTAGTGG + Intronic
1126416168 15:48419722-48419744 GTGCAGGCTCTGCATTGCAGGGG - Intronic
1131879806 15:96850843-96850865 GAACAGTCCCTGCTTTCAAGTGG + Intergenic
1132186214 15:99804165-99804187 TAGCAGCCCCTTCATTTTAGAGG + Intergenic
1132337895 15:101060628-101060650 GAGCACTCACTGCATGGCAGAGG - Intronic
1132429459 15:101748541-101748563 TAGCAGCCCCTTCATTTTAGAGG - Intergenic
1136035830 16:27539451-27539473 GAGCAGGCCAGGCATTGTGGTGG - Intronic
1147453692 17:40521387-40521409 AAGCAGTTCCTCCACTGTAGAGG - Intergenic
1149541434 17:57470937-57470959 GAGCAGTTCCTGCTCTGGAGTGG + Intronic
1150172089 17:63008515-63008537 GAGCAGTCATTGAATTGTGGTGG + Intergenic
1152648833 17:81482663-81482685 GAGCAGTCCCTGGGCTGAAGTGG + Intergenic
1156615196 18:38774965-38774987 GAGCAGTGAGTGAATTGTAGAGG + Intergenic
1159370889 18:67526494-67526516 GCGCAGTTCCTTCATTGTACTGG + Intergenic
1161914431 19:7218051-7218073 GAAGAGTCCCTGCCTTGTGGCGG + Intronic
926002993 2:9349125-9349147 GAACAGTGCCTGCCTTGTATAGG + Intronic
928500826 2:31893284-31893306 AAGAAGCCCCTGCATTGCAGAGG - Intronic
929759135 2:44791637-44791659 GTGAAGTCCCTGTATTGTATGGG - Intergenic
929996186 2:46827663-46827685 GAGCAGTCCCTGCAGTGCCCAGG - Intronic
934618418 2:95789661-95789683 GAGCAGTCCACGCCTTGTGGCGG + Intergenic
934642475 2:96034898-96034920 GAGCAGTCCACGCCTTGTGGCGG - Exonic
935056245 2:99570093-99570115 GAGCCGTCCATTCATTGTGGTGG + Intronic
937067654 2:119030026-119030048 GAGCAGTCCCCTCACTGCAGCGG - Intergenic
937894815 2:126970873-126970895 GAGCAGTCTCTACATTCCAGGGG - Intergenic
940071936 2:149698524-149698546 GAGCAGGTCCTGGGTTGTAGTGG + Intergenic
944887416 2:204077770-204077792 GTACAGTTCCTGCCTTGTAGTGG + Intergenic
946339222 2:219057567-219057589 GAGGAGTCCCTGCATTATGAGGG - Exonic
948764240 2:240211407-240211429 GAACAGTCACTGCTTTGTAGTGG - Intergenic
948859572 2:240746312-240746334 GACCTGTGCCTGCCTTGTAGGGG + Intronic
1169421904 20:5467171-5467193 GATCTGTCCCGGCAGTGTAGGGG - Intergenic
1170707175 20:18754811-18754833 GACCAATCCATGTATTGTAGTGG + Intronic
1174677220 20:52370024-52370046 GAGCAGACCCTGATTTATAGTGG - Intergenic
1176018628 20:62951766-62951788 GAGCAGGCCCTGCAGTGCAGTGG + Intergenic
1178284217 21:31311564-31311586 GAGCAGTCCATGAATTGAGGGGG + Intronic
1180592982 22:16956454-16956476 TTGCAGTTCCTGCATTGAAGGGG - Intergenic
1184766358 22:46574613-46574635 GCCCAGTCCCTGCTTGGTAGGGG - Intergenic
1185414760 22:50703982-50704004 GGGCAGGACCTGCAGTGTAGAGG + Intergenic
950008488 3:9705794-9705816 GAGCAATCTCTGCCTTGTAGTGG - Intronic
956833338 3:73074750-73074772 GACCAGTCCATGCATTGTGCAGG - Intergenic
959781009 3:110233342-110233364 GAGCAGGCCATGCTGTGTAGTGG - Intergenic
968498651 4:932965-932987 GGGCAGTCTCTGCAGTGTTGTGG - Intronic
970964107 4:21908217-21908239 GAATAGTTCCTGCTTTGTAGAGG - Intronic
980092930 4:128461002-128461024 GAGCAGTCTCTGGCATGTAGTGG + Intergenic
980549838 4:134320498-134320520 CAGCAGTTCCTGTATTGAAGTGG - Intergenic
983490981 4:168388792-168388814 GAGCAGTCCCAGCAGGGGAGGGG + Intronic
986107435 5:4673228-4673250 GAGCATGCCCTGCAGTGCAGGGG + Intergenic
986319717 5:6620206-6620228 GAGCAGCCCCTGCATCATGGTGG - Exonic
988352335 5:30125974-30125996 AAGCTGTCCCTGTACTGTAGTGG + Intergenic
992153082 5:73925629-73925651 GAGGAGTCGCTGCTTTGAAGGGG - Intronic
996407066 5:123116067-123116089 GAGCACTCCCTGCATTTGAGAGG - Intronic
999145784 5:149392505-149392527 GTACAGTCCCTGCATTTTTGGGG - Intronic
1001071180 5:168586562-168586584 GAGCACTCCAGGCATTGTACAGG + Intergenic
1001560441 5:172665625-172665647 GGGCAGTCACTGCCTTGTAGAGG - Intronic
1002348010 5:178561442-178561464 GAGCAGTCCCTGCATTGTAGGGG - Intronic
1018235582 6:161720425-161720447 GAGCAGACCCTGCAGTGTCGGGG - Intronic
1018737985 6:166703329-166703351 TAGCAGTCACTGCATGGGAGGGG + Intronic
1020605961 7:10337251-10337273 CAGCAGTCTCTCCAGTGTAGAGG - Intergenic
1023121203 7:36910675-36910697 GTGCAGACCTTGCACTGTAGGGG + Intronic
1024295050 7:47835075-47835097 GAGCAGCCCCTTCATTGCTGGGG - Intronic
1027126175 7:75558247-75558269 GAGCTTTCCCTGTATTGTAAAGG + Exonic
1027445189 7:78265907-78265929 CAGCAGTCCCTTCATTTCAGGGG - Intronic
1033344689 7:140517971-140517993 GAGTAGTCCCTGGCTTTTAGAGG - Intergenic
1033579755 7:142721351-142721373 GAACAGTCCCTGACTTGTAAAGG - Intergenic
1036443278 8:8800046-8800068 AAGCAGTCCCTGCTTTGGGGAGG - Intronic
1036692981 8:10956412-10956434 GTGCAGTGCCTGCTTTGTATGGG - Intronic
1040287553 8:46108187-46108209 CAGCATTCCCTGCAGTCTAGCGG + Intergenic
1042611099 8:70602245-70602267 GAGCAGGAGCTGCATTGCAGTGG + Intronic
1046652866 8:116858090-116858112 GAGGAGTCCCAACATTGAAGTGG - Intronic
1051136970 9:13933411-13933433 AAGCAGTCCCTGTCTTGTGGAGG - Intergenic
1051776665 9:20641643-20641665 GAACAGTAACTGCATTTTAGAGG + Intergenic
1058173637 9:101712586-101712608 GATCAGTTCCTGCATTTTATTGG - Intronic
1059581359 9:115551920-115551942 GAGCAGTCAGTGCAGTGCAGGGG + Intergenic
1060218852 9:121754032-121754054 AAGCAGTCCCTGCTGTGAAGTGG + Intronic
1061723298 9:132567033-132567055 GAGCAGACCCTGCTTCATAGAGG + Intronic
1185928064 X:4169443-4169465 GAGATGCCCCTGCATTGTGGCGG - Intergenic
1192172193 X:68863452-68863474 GAGCAGTCACTTCATTTCAGTGG - Intergenic
1201765283 Y:17569139-17569161 GGCCAGCCCCTGCATTGTACGGG - Intergenic
1201836269 Y:18336850-18336872 GGCCAGCCCCTGCATTGTACGGG + Intergenic
1202150074 Y:21836459-21836481 GACAAGTCCCTGCAGTGTGGCGG - Intergenic