ID: 1002348011

View in Genome Browser
Species Human (GRCh38)
Location 5:178561443-178561465
Sequence AGAGCAGTCCCTGCATTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002348011_1002348018 8 Left 1002348011 5:178561443-178561465 CCCTACAATGCAGGGACTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1002348018 5:178561474-178561496 CCTGGCCCGATGGAACCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 62
1002348011_1002348015 -10 Left 1002348011 5:178561443-178561465 CCCTACAATGCAGGGACTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1002348015 5:178561456-178561478 GGACTGCTCTGGCAGGCTCCTGG 0: 1
1: 0
2: 1
3: 31
4: 454
1002348011_1002348016 -2 Left 1002348011 5:178561443-178561465 CCCTACAATGCAGGGACTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1002348016 5:178561464-178561486 CTGGCAGGCTCCTGGCCCGATGG 0: 1
1: 0
2: 3
3: 19
4: 236
1002348011_1002348022 20 Left 1002348011 5:178561443-178561465 CCCTACAATGCAGGGACTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1002348011_1002348019 9 Left 1002348011 5:178561443-178561465 CCCTACAATGCAGGGACTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1002348019 5:178561475-178561497 CTGGCCCGATGGAACCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002348011 Original CRISPR AGAGCAGTCCCTGCATTGTA GGG (reversed) Intronic
901612575 1:10510559-10510581 AAAGGAGTCCCTGTGTTGTATGG + Intronic
901762815 1:11481526-11481548 AGAGTAGTCCCAGCATGGTGTGG + Intronic
902681350 1:18046012-18046034 AGAGCAGAGCCTGAATTGGAAGG + Intergenic
909337522 1:74492959-74492981 AGAGCTCTCCCTGCCTTATAAGG - Intronic
910218186 1:84863543-84863565 AGGGCAGGCCCTCCAGTGTAAGG - Intronic
913581667 1:120233090-120233112 AGAACAGTCCCTCCCTTGTGCGG + Intergenic
914563598 1:148844537-148844559 AGAACAGTCCCTCCCTTGTGCGG + Intronic
914609229 1:149285689-149285711 AGAACAGTCCCTCCCTTGTGCGG - Intergenic
917804607 1:178602212-178602234 AGGCCAGTCCCTGCAATGCAAGG + Intergenic
918307224 1:183258344-183258366 AGGGCAGTGCATGCATTGAAAGG - Intronic
919409403 1:197225742-197225764 ACAGCAGTTCCTGCCTTGTCTGG - Intergenic
920772953 1:208906830-208906852 AGAGCAGTCACTGGTTTGGATGG + Intergenic
920859576 1:209694491-209694513 AGAGCAGTACCTGAATGATAAGG + Intronic
922074271 1:222227346-222227368 AGAGCAATACCTCCATTGTTTGG + Intergenic
922951945 1:229565864-229565886 AGTGCAGTTACTGGATTGTATGG + Intergenic
924263122 1:242252387-242252409 AGAGCAGTTCCTGCCTTGCCTGG - Intronic
924434827 1:244030134-244030156 AGACTAGTCCCTGCATCTTAGGG + Intergenic
1065833930 10:29640198-29640220 AGAGCAGTTTCTGGGTTGTAGGG - Intronic
1066721666 10:38346058-38346080 AGAGCAGTTCCTGCCTTGCCTGG + Intergenic
1066980505 10:42409590-42409612 GGAGCAGTCCCAGCATTGTCAGG - Intergenic
1068768014 10:60785846-60785868 ATAGAAGTCCCTGCATTTTGTGG + Intronic
1073650090 10:105349398-105349420 AGAGCAGTCCTTGCATGGTGAGG + Intergenic
1074641689 10:115391359-115391381 AGACTAGTCCCTGCATTGTCAGG - Intronic
1075645960 10:124096344-124096366 AGTACAGTCCCTGCACTGGAAGG - Intergenic
1075954747 10:126513306-126513328 AGAGCAGTACCTGTCTTGTGGGG + Intronic
1076759301 10:132592958-132592980 AGAGCAGGCCCTGCCTAGTTGGG - Intronic
1079615942 11:22493334-22493356 ACAGTTGTCCCTGCATTGTCAGG - Intergenic
1082010031 11:47443548-47443570 TGAGCAGTCTCTGCATCGTCAGG + Intronic
1083080867 11:60092165-60092187 AGAGTAACCCCTGCATTGTCAGG + Intronic
1085157265 11:74307174-74307196 AGATCAGTTCCTTCATTTTATGG - Intronic
1085718173 11:78890944-78890966 AGCACAGGCCCTGTATTGTATGG - Intronic
1087151194 11:94861251-94861273 AGTTCAGTCCCTGCAGTATATGG + Intronic
1089060158 11:115619808-115619830 AGAGCACTGCCGGCAGTGTATGG - Intergenic
1091207584 11:133832320-133832342 ACAGCAGTCTCTGCCTTTTAAGG - Intergenic
1098214744 12:68203761-68203783 AGATCAGACCCTGCATAGGAGGG + Intronic
1100384398 12:94092152-94092174 AGAGCAGTGTCTGCAGTGAAGGG - Intergenic
1101755175 12:107615955-107615977 AGAGCTGTCCCTGCTCTGCATGG - Intronic
1106005680 13:25768369-25768391 AGATCAGCCCCTGCATAGGAAGG - Intronic
1109642151 13:65204356-65204378 AGGGCAATCACTGCATTCTACGG - Intergenic
1111546818 13:89748891-89748913 ACAGCATTCCCTGCAGTGTATGG + Intergenic
1115696692 14:35906939-35906961 AGTGCAGTTCCTGGGTTGTATGG + Intronic
1119688501 14:76652432-76652454 ATGGCAGTGCCTGCATTGTCTGG - Intergenic
1119846562 14:77834830-77834852 AGAGAAGGTCCTGCATTGTGAGG + Intronic
1121736801 14:96224416-96224438 AGAGAAACCCCTGCAATGTAGGG - Intronic
1125538538 15:40456718-40456740 AGAGCAGTCCCTGCTGTGCCAGG - Intronic
1129287489 15:74537807-74537829 TGAGAAGGCCCTGCATGGTAAGG + Intergenic
1132725784 16:1337841-1337863 GGAGCAGGCCCTGCTTTGTGGGG + Intronic
1134027865 16:10968146-10968168 ACAGCAGTGCCTGCCTTGCAGGG + Intronic
1137660334 16:50200029-50200051 AGTGCAGTTGCTGGATTGTATGG + Intronic
1138710790 16:58968276-58968298 AGTGCAGTCGCTGGATTATATGG + Intergenic
1138717820 16:59044493-59044515 AGAGCAGTGGCTGCCTTGTGGGG + Intergenic
1141706639 16:85668828-85668850 AGAGCAATCCTTGCAGTGTGGGG - Intronic
1145068040 17:19776992-19777014 ACAGCAGTGCCTGCCTTGCAGGG - Intronic
1146940818 17:36843247-36843269 AGGCCAGTCCCTGCTTTGTCTGG + Intergenic
1151385751 17:73754165-73754187 AGAGAAGTCCCTGGAATCTAAGG - Intergenic
1153940146 18:9970003-9970025 AACGCAGTCCCTGCAGTCTAAGG - Intergenic
1154312581 18:13278810-13278832 AGAACAGTGCCTGCAGTGTCAGG + Intronic
1157190876 18:45580663-45580685 AGAGCATTACCTGCAATATATGG - Intronic
1160080896 18:75726242-75726264 AGAACAGGCCCTGCATTTTGAGG + Intergenic
1160587788 18:79922338-79922360 AGGGCACTCCCTGCACTCTACGG - Intronic
1163888686 19:19991937-19991959 ATACCTGTCCCTGCATTGGATGG - Intergenic
1164254865 19:23518786-23518808 AGAGCAGTCTCAGCTCTGTAAGG - Intergenic
1166893613 19:46009467-46009489 ATAGCAGTGCCTACCTTGTAGGG - Intronic
927844002 2:26462055-26462077 TGAGCAGTCCCTGCATGGGAGGG - Intronic
929759136 2:44791638-44791660 AGTGAAGTCCCTGTATTGTATGG - Intergenic
930407573 2:50979622-50979644 AGAGCAAGCCCTGCATGGTCTGG - Intronic
931101465 2:59006342-59006364 ATGGTAGTCCCTGTATTGTAAGG - Intergenic
931637289 2:64352051-64352073 AGAGGAGCCCCTGCCTTGAAGGG + Intergenic
931979595 2:67680206-67680228 AGAGCTTTCCCTCCATTGTCTGG - Intergenic
937079080 2:119127457-119127479 AGACCAGTGCCTGCTTTGAAAGG - Intergenic
937894816 2:126970874-126970896 AGAGCAGTCTCTACATTCCAGGG - Intergenic
941005023 2:160239157-160239179 AGAGCAGTGCCAGCTTTGTAAGG - Intronic
946339223 2:219057568-219057590 AGAGGAGTCCCTGCATTATGAGG - Exonic
948745148 2:240085887-240085909 AGAGGAATTTCTGCATTGTAGGG - Intergenic
948859571 2:240746311-240746333 AGACCTGTGCCTGCCTTGTAGGG + Intronic
1169843468 20:9964909-9964931 ATAAAAGTCCCTGCATCGTATGG - Intergenic
1170829252 20:19825345-19825367 AGAGCAGTCCATGCCATGTGTGG + Intergenic
1175132544 20:56800497-56800519 AGTGAAGTCTCTGAATTGTAAGG + Intergenic
1175164434 20:57033310-57033332 AGAGCTGTCCTGGCATTGCAGGG - Intergenic
1175368536 20:58471405-58471427 AGGGCAGGGCCTGCATTGTTTGG - Intronic
1179220468 21:39402452-39402474 AGGGAGGTCCCAGCATTGTATGG + Intronic
1180203409 21:46241219-46241241 AAGGCAGCCCCTGCACTGTAGGG + Intronic
1180858459 22:19063008-19063030 AGATCAGGCCCTGCATTGGGCGG - Intronic
1181416145 22:22760322-22760344 TGAACAGTCCCTGGTTTGTAGGG + Intronic
1182320074 22:29473057-29473079 AGAGCTGTCCCTGCTGTGTGTGG + Intergenic
1185159497 22:49214705-49214727 AGGGCTGTCCCTGCACTGTGGGG - Intergenic
958105325 3:89065206-89065228 AGAGCTGTCTCTACATTTTAAGG + Intergenic
964171837 3:153779797-153779819 AGAGAAGTCCCAGCAGTGTTGGG - Intergenic
964442122 3:156722903-156722925 AGAGCAGTCCCTCCTTGGGATGG + Intergenic
968488881 4:879244-879266 AGAGGACTTCCTGCAGTGTATGG + Intronic
970310804 4:14780291-14780313 CGAGCAGTCCATGCATTGAGTGG + Intergenic
970579003 4:17456716-17456738 AGAGCAGTGCCTTCATTTTAAGG + Intergenic
971964461 4:33535101-33535123 AGAACAGATCCTGCATTTTATGG - Intergenic
978079189 4:104571129-104571151 AGGTCAGGCCCTGCATTGTGTGG - Intergenic
980546721 4:134273282-134273304 AGAGCAGTCACTGGATTATAGGG - Intergenic
980655822 4:135784533-135784555 AGAGTAGGCTCTGCATTGTTTGG - Intergenic
985347729 4:189024239-189024261 AAAGCAATCCCTGCATTTAAAGG - Intergenic
985861651 5:2476294-2476316 AAAGCAATCCCTGCATTAAAAGG + Intergenic
990195467 5:53310340-53310362 AGAACATTCCCTCCATTTTAAGG + Intergenic
992153083 5:73925630-73925652 AGAGGAGTCGCTGCTTTGAAGGG - Intronic
992588310 5:78264929-78264951 AGGGCAGTCCCTACTTTGCATGG - Intronic
993821603 5:92624349-92624371 AGAGCAGTTCATCCATAGTAAGG + Intergenic
998108751 5:139485165-139485187 AGGGAATTCCCTGCATTGTTAGG - Intergenic
999101919 5:149032618-149032640 AGAGTAGTACGTGCCTTGTATGG - Intronic
1002348011 5:178561443-178561465 AGAGCAGTCCCTGCATTGTAGGG - Intronic
1003527351 6:6909440-6909462 TGAGCAGTCCCAACATTGCAGGG + Intergenic
1007709937 6:43816345-43816367 TGAGCAGTGCCTGCCTTGTGTGG + Intergenic
1008445579 6:51586302-51586324 AGAGAAATCACTGAATTGTATGG + Intergenic
1011257387 6:85437022-85437044 TGAGCAGTTGCTGGATTGTATGG + Intergenic
1018235583 6:161720426-161720448 AGAGCAGACCCTGCAGTGTCGGG - Intronic
1018838138 6:167500492-167500514 GGAGAATTACCTGCATTGTAAGG - Intergenic
1019712157 7:2522665-2522687 AGCCCAGTCCCTGCCTTCTAGGG - Intronic
1022195374 7:28061258-28061280 AAAGCAGCATCTGCATTGTAAGG - Intronic
1023121202 7:36910674-36910696 AGTGCAGACCTTGCACTGTAGGG + Intronic
1035415840 7:158684989-158685011 AGAGCAGGCCCTGCACTGATGGG - Intronic
1036692982 8:10956413-10956435 GGTGCAGTGCCTGCTTTGTATGG - Intronic
1040876334 8:52156130-52156152 GGAGCTGTCCCTGCCTTGCATGG - Intronic
1042146232 8:65733051-65733073 AGGGAAATGCCTGCATTGTAGGG + Intronic
1042540849 8:69905917-69905939 AGAGCAAGCCCTGCAATGTGAGG + Intergenic
1056416919 9:86385890-86385912 AGAAGAGACTCTGCATTGTAGGG - Intergenic
1056737989 9:89226050-89226072 ATGGCAGTCCCTGCCTTGCAGGG + Intergenic
1057885563 9:98827072-98827094 AGAGCAGTCCCTGCTTAGTTCGG + Intronic
1061592697 9:131608267-131608289 AGGGCAGTTCCTGGATTGTTGGG - Intronic
1062034069 9:134375027-134375049 AGAGCACTCCCTGCAGTGCAGGG - Intronic
1185466774 X:359640-359662 AGAGGTGTCCCTGTCTTGTACGG - Intronic
1189745037 X:44160220-44160242 AGAGAAGTCACTGCATGGGAAGG - Intronic
1191979814 X:66913222-66913244 AGAGCAGTCCATGGATTAAATGG + Intergenic
1192846754 X:74914299-74914321 AGTGCAATTGCTGCATTGTATGG - Intronic
1194850814 X:98866233-98866255 AGTGCAGTTGCTGGATTGTATGG + Intergenic
1198378962 X:136066345-136066367 AGAGTACTCCCTGCAATGTCTGG - Intergenic
1198617588 X:138476636-138476658 AGTGCAGTTGCTGGATTGTAGGG - Intergenic
1198668500 X:139051656-139051678 AGATCAGTCACTGCTTTATAGGG - Intronic
1201765284 Y:17569140-17569162 GGGCCAGCCCCTGCATTGTACGG - Intergenic
1201836268 Y:18336849-18336871 GGGCCAGCCCCTGCATTGTACGG + Intergenic