ID: 1002348012

View in Genome Browser
Species Human (GRCh38)
Location 5:178561444-178561466
Sequence CAGAGCAGTCCCTGCATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002348012_1002348022 19 Left 1002348012 5:178561444-178561466 CCTACAATGCAGGGACTGCTCTG 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1002348012_1002348019 8 Left 1002348012 5:178561444-178561466 CCTACAATGCAGGGACTGCTCTG 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1002348019 5:178561475-178561497 CTGGCCCGATGGAACCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 28
1002348012_1002348016 -3 Left 1002348012 5:178561444-178561466 CCTACAATGCAGGGACTGCTCTG 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1002348016 5:178561464-178561486 CTGGCAGGCTCCTGGCCCGATGG 0: 1
1: 0
2: 3
3: 19
4: 236
1002348012_1002348018 7 Left 1002348012 5:178561444-178561466 CCTACAATGCAGGGACTGCTCTG 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1002348018 5:178561474-178561496 CCTGGCCCGATGGAACCCTATGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002348012 Original CRISPR CAGAGCAGTCCCTGCATTGT AGG (reversed) Intronic
900745419 1:4357380-4357402 CAGAGGACTCCCTGTATCGTGGG - Intergenic
901703532 1:11058111-11058133 CAGATCAGTCCCTGCCCTCTAGG - Intronic
903249434 1:22041965-22041987 TAGAGCAGTGCCTGGAGTGTAGG + Intergenic
904400572 1:30253986-30254008 CAGGGCATTCCCTGCATTCCTGG + Intergenic
904965714 1:34370977-34370999 CATTGCACTGCCTGCATTGTTGG + Intergenic
907501632 1:54885756-54885778 CATAACAGTCCCTGCATTCTAGG + Intronic
908906652 1:69020357-69020379 CAGAAAAGACCCTGCAGTGTTGG + Intergenic
912709301 1:111938441-111938463 CAGTGAAGTCCCTGCTTTCTTGG + Intronic
921096061 1:211888184-211888206 CAATGTGGTCCCTGCATTGTTGG + Intergenic
921608970 1:217188424-217188446 CTGAAAAGTCCCTGCATGGTGGG + Intergenic
924434826 1:244030133-244030155 CAGACTAGTCCCTGCATCTTAGG + Intergenic
1062920010 10:1272660-1272682 CACAGCAGTCCCTGAAAGGTCGG - Intronic
1066212081 10:33250465-33250487 CAGCAAAGTCCCTGCATTGTAGG + Intronic
1075242153 10:120788871-120788893 CAGAGCAGTCTATGGCTTGTAGG - Intergenic
1075954746 10:126513305-126513327 AAGAGCAGTACCTGTCTTGTGGG + Intronic
1076466965 10:130689513-130689535 CTGAGCAGTCCTTGCATTTGGGG + Intergenic
1076759302 10:132592959-132592981 GAGAGCAGGCCCTGCCTAGTTGG - Intronic
1077135406 11:995663-995685 CATGGCAGGCCCTGCACTGTCGG - Intronic
1081644985 11:44783998-44784020 CAGAGCACAGCCTGCTTTGTTGG + Intronic
1090003671 11:122982058-122982080 CAAAGCAGCCCCTGCAGTGACGG - Intergenic
1092174580 12:6394390-6394412 CAGAGGAGTCCCTGGATGCTCGG + Intergenic
1097202041 12:57287420-57287442 CAGAGAGGACCTTGCATTGTTGG - Intronic
1098214743 12:68203760-68203782 CAGATCAGACCCTGCATAGGAGG + Intronic
1098978658 12:76931243-76931265 TAAAGCAGTACCTGCAATGTTGG - Intergenic
1100384399 12:94092153-94092175 CAGAGCAGTGTCTGCAGTGAAGG - Intergenic
1103517906 12:121519191-121519213 TTGAACAGTCCCGGCATTGTGGG - Intronic
1113897932 13:113777568-113777590 CACCGCAGTCCCTGCCTTCTGGG - Intronic
1114414279 14:22529629-22529651 CAGAGCAGTTCCTGCCTGGTTGG - Intergenic
1114557399 14:23569909-23569931 AAGGGCTGTCCCTGCATTGAAGG - Intronic
1114988925 14:28263553-28263575 CAGAATAGGCCCTCCATTGTGGG + Intergenic
1116793505 14:49365029-49365051 CAGAGCAGTGTCTTAATTGTAGG - Intergenic
1120938200 14:89919352-89919374 CAGTGCAGGCCCTGCAGTATGGG + Intronic
1121736802 14:96224417-96224439 CAGAGAAACCCCTGCAATGTAGG - Intronic
1122665782 14:103328532-103328554 CAGAGCAGGCCCTACAATATTGG - Intergenic
1123774729 15:23566865-23566887 CAGAGGTGACCCTGCACTGTGGG - Exonic
1125535033 15:40437704-40437726 CAGTGCAGTCCCTGCAGTGGTGG - Intergenic
1130985031 15:88839095-88839117 CAGAGCAGTCTCCGCAGTGCAGG + Intronic
1132725783 16:1337840-1337862 GGGAGCAGGCCCTGCTTTGTGGG + Intronic
1134187918 16:12098941-12098963 CAGGTCACTCCCTGCATTGTGGG + Intronic
1136271093 16:29148742-29148764 CACAGCACTCCCTGCGTTGGAGG - Intergenic
1138452048 16:57098914-57098936 TAGAGGAGTCCCTGGATTATTGG + Intronic
1138717819 16:59044492-59044514 CAGAGCAGTGGCTGCCTTGTGGG + Intergenic
1139383944 16:66552115-66552137 CAGACCAGTCCCTGCTTTTGTGG + Intronic
1140624012 16:76770261-76770283 CAGAGCAGCCCCTGCTCTCTTGG - Intergenic
1141421860 16:83922706-83922728 CAGAGCAGTCCCTGTCATGATGG + Exonic
1141706640 16:85668829-85668851 CAGAGCAATCCTTGCAGTGTGGG - Intronic
1141838509 16:86559113-86559135 GAGAGCTCTCCCTGCATTCTAGG - Intergenic
1143283608 17:5772913-5772935 CAGGGCAGTCCCTCCATATTAGG + Intronic
1151391661 17:73791326-73791348 CAGAGCAGCCTCTGCAGTTTTGG + Intergenic
1151653275 17:75483267-75483289 CAGAGCAGGGCCTGCCTGGTTGG - Intronic
1151937853 17:77274272-77274294 CAGACCAGACCCTCCATTCTTGG + Intergenic
1153988979 18:10378416-10378438 CACAGCAGTCCCTGCTGAGTGGG + Intergenic
1157599904 18:48887492-48887514 CACAGAAGTCCCTGGATTGATGG + Intergenic
1158214793 18:55088859-55088881 GAAAGCAGTCCCTGCAGTGTTGG + Intergenic
1160240662 18:77120050-77120072 CAGAGCAGGACCTGCAATTTAGG + Intronic
1160416914 18:78717981-78718003 CAGAGCAGGCCCAGCAGGGTGGG + Intergenic
1162021985 19:7872263-7872285 CAGGGGAGTGGCTGCATTGTCGG + Exonic
1167381086 19:49138417-49138439 CAGAGCACTCACAGCCTTGTCGG - Exonic
925098759 2:1228475-1228497 CAGAGCAGGCCCTCCAAGGTGGG - Intronic
927493335 2:23535233-23535255 CAGAACAGTCTCTGCATTTGTGG + Intronic
927844003 2:26462056-26462078 GTGAGCAGTCCCTGCATGGGAGG - Intronic
929927846 2:46230299-46230321 CAGAGCGATCCCTGCCTTGGCGG - Intergenic
930436677 2:51353114-51353136 CTGAGCATTCTCTGCATTTTAGG + Intergenic
934941571 2:98506816-98506838 CAGGGGAGTGCCCGCATTGTGGG - Intronic
936454670 2:112663394-112663416 CAGAGCATGCTCTGCGTTGTTGG + Exonic
937304905 2:120865209-120865231 CAGAGCAGCCACTGCATGGAGGG + Intronic
940878728 2:158924301-158924323 AAGGACAGTCCCTACATTGTAGG + Intergenic
942700929 2:178709591-178709613 CAGAGCAGAGCCTGCATCATTGG + Exonic
943523160 2:188980001-188980023 CAGAGCAGTCCCTACAAGATAGG + Intronic
944879055 2:203992774-203992796 CACAGCAGTCCCTGCCTTCCAGG - Intergenic
948859570 2:240746310-240746332 CAGACCTGTGCCTGCCTTGTAGG + Intronic
1178789676 21:35688279-35688301 CAGAACAGTCCCTGCTTTCTGGG - Intronic
1181119637 22:20657396-20657418 CTGAGCAGCTCCTGCACTGTGGG - Intergenic
1182884560 22:33762389-33762411 CAGAACAGTTCCAGCATTCTGGG + Intronic
1184875991 22:47275907-47275929 CAAAGCAGTCACTGCACAGTAGG - Intergenic
1185159498 22:49214706-49214728 CAGGGCTGTCCCTGCACTGTGGG - Intergenic
950102229 3:10365028-10365050 AAGAGCAGCCCCTGCCTTGTAGG - Intronic
950418750 3:12884284-12884306 CTGAGCATTCCCTGCCTTTTCGG + Intergenic
950535346 3:13575171-13575193 CAGGGAAGTCCCTGCATCATGGG - Intronic
951755234 3:26083814-26083836 CAGAGTAGCCCCTGCATTCTTGG - Intergenic
952380425 3:32800277-32800299 CAAAACAGTCCCTGCCTTGAAGG - Intergenic
952883013 3:37997323-37997345 GAGTTCAGACCCTGCATTGTTGG + Intronic
953497398 3:43399982-43400004 GAGAGCACTCCCTGTATTGGAGG - Intronic
953653421 3:44827087-44827109 CAGATCAGTGCCTGGCTTGTTGG - Intronic
954716565 3:52529795-52529817 CAGAGGAGGCGCTGAATTGTGGG - Intronic
957352758 3:79047549-79047571 CAAAGCAGTACCTGAATTCTTGG + Intronic
962089799 3:132231089-132231111 CAGAGCATTGCCTGTATTGTGGG + Intronic
962810092 3:138952162-138952184 CAGAGAAGTCTCTGCATTCAGGG + Exonic
964171838 3:153779798-153779820 CAGAGAAGTCCCAGCAGTGTTGG - Intergenic
964454028 3:156841125-156841147 AAGAGGAATCCCTGCATGGTGGG + Intronic
965680056 3:171240923-171240945 CAGATCAGTGCCCGCATGGTGGG + Intronic
967937344 3:194739538-194739560 CTGACCAGTGCCTGCAGTGTGGG + Intergenic
968840950 4:3005443-3005465 CAGTGCAGTCCGAGCATAGTGGG + Intronic
975365474 4:73523514-73523536 CAGTGCAGTCCCAGCAGTGGTGG - Intergenic
977673727 4:99725174-99725196 ATGGGCAGTCCCTGCATTGCTGG - Intergenic
978295216 4:107196969-107196991 CAGATGAGTTCCTGCCTTGTAGG + Intronic
980546722 4:134273283-134273305 AAGAGCAGTCACTGGATTATAGG - Intergenic
986944229 5:12995260-12995282 CAGAGCTGTCCATGCTTGGTGGG + Intergenic
987746776 5:21984470-21984492 CAGAGCTGTGCCTTCATTGCTGG + Intronic
990967078 5:61460630-61460652 CTGAGAAGTCACTGCATTATTGG - Intronic
991247083 5:64520016-64520038 CAGAGCTGTCTCTGGATTTTAGG + Intronic
991766949 5:69994231-69994253 CAGAGCTGTGCCTTCATTGCTGG + Intergenic
991846181 5:70869308-70869330 CAGAGCTGTGCCTTCATTGCTGG + Intergenic
992153084 5:73925631-73925653 CAGAGGAGTCGCTGCTTTGAAGG - Intronic
994583201 5:101674144-101674166 CAGAGCTATCACTGCAATGTAGG + Intergenic
995525207 5:113045160-113045182 CAGAGCAGTCCCTGTCTTTAAGG - Intronic
999641459 5:153677273-153677295 CAGAACAACCACTGCATTGTTGG + Intronic
1001798660 5:174524338-174524360 CAGATCTGTCCCTGCCTTGGGGG + Intergenic
1002348012 5:178561444-178561466 CAGAGCAGTCCCTGCATTGTAGG - Intronic
1002826106 6:775798-775820 GAGATCAGTCCCTGCATTGCAGG + Intergenic
1007655898 6:43450833-43450855 CAGACCAGCCCCTGCGCTGTGGG + Exonic
1011189303 6:84713490-84713512 CAGAGCAGGTCATGCAATGTGGG + Intronic
1014542323 6:122692109-122692131 CAGAGCAGTCCCAGCACTGGTGG - Intronic
1014817000 6:125947042-125947064 CAGTGCAGCCTCTGCCTTGTGGG + Intergenic
1016342780 6:143081152-143081174 CAGAGCAGGCCATGCAAGGTGGG + Intronic
1016891713 6:149014235-149014257 CAGAGGAGCCCCTGCAAGGTGGG + Intronic
1018235584 6:161720427-161720449 CAGAGCAGACCCTGCAGTGTCGG - Intronic
1018311166 6:162510491-162510513 GAGAGCAGTCCCTGCTTCCTCGG - Intronic
1018885928 6:167937169-167937191 CAGAGCAGTCCGTGAAGTGGAGG + Intronic
1019712158 7:2522666-2522688 CAGCCCAGTCCCTGCCTTCTAGG - Intronic
1021891307 7:25188552-25188574 CAGTGCAGTGTCTGCATGGTCGG + Intergenic
1023114948 7:36853633-36853655 CAGAGCACTGCATGCATTGCAGG - Intergenic
1023121201 7:36910673-36910695 CAGTGCAGACCTTGCACTGTAGG + Intronic
1024295052 7:47835077-47835099 CTGAGCAGCCCCTTCATTGCTGG - Intronic
1027599359 7:80220257-80220279 TAGAGCAGTGCCTACAATGTGGG + Intergenic
1031471787 7:122175766-122175788 CAGAGCAGGCCATGCAAGGTGGG - Intergenic
1032726089 7:134591216-134591238 CAGAGCAGGCCATGCAAGGTGGG - Intergenic
1032871700 7:135992675-135992697 CATGGCATTCCCTGAATTGTGGG + Intergenic
1035415841 7:158684990-158685012 GAGAGCAGGCCCTGCACTGATGG - Intronic
1035653772 8:1289756-1289778 CAGAGCAATTCCTGCATTCGCGG - Intergenic
1035969773 8:4234821-4234843 AAGAACAGTCTCTGCACTGTGGG + Intronic
1039900732 8:41750776-41750798 CAGAGCAGCCCAGGCACTGTTGG - Intronic
1040837567 8:51748435-51748457 CAGCTCAAACCCTGCATTGTGGG + Intronic
1040988943 8:53328309-53328331 GAGAGCACTCCCTGCACTGCAGG - Intergenic
1041500295 8:58532921-58532943 CAGTGCAGTCCCAGTATTGGTGG - Intergenic
1043434753 8:80227402-80227424 CAAAGTAGTCCCAGCATTTTGGG + Intronic
1045053277 8:98345994-98346016 CAGAGCTGTCCGGGCATGGTGGG + Intergenic
1050616891 9:7410682-7410704 CAGCTCAGCCCCTCCATTGTTGG + Intergenic
1056416920 9:86385891-86385913 CAGAAGAGACTCTGCATTGTAGG - Intergenic
1057434052 9:95023118-95023140 CAGAGCTGCCCCTGCATCATGGG + Intronic
1060946280 9:127571023-127571045 CAGAACAGACCCTGCAGTTTGGG - Intronic
1061592698 9:131608268-131608290 TAGGGCAGTTCCTGGATTGTTGG - Intronic
1061777244 9:132973581-132973603 CAGATGACTCCCTGGATTGTGGG + Intronic
1062034070 9:134375028-134375050 AAGAGCACTCCCTGCAGTGCAGG - Intronic
1062453082 9:136623612-136623634 CAGAGCAGTTCCTTCCTTGTTGG - Intergenic
1187770478 X:22690443-22690465 CTGTGCAGTCCTTGCATTGCAGG + Intergenic
1196468648 X:115999108-115999130 CAGAGCACTACCTGTATTCTGGG - Intergenic
1197954330 X:131930246-131930268 CAGAGCAGGCCATGCAAGGTGGG + Intergenic