ID: 1002348022

View in Genome Browser
Species Human (GRCh38)
Location 5:178561486-178561508
Sequence GAACCCTATGGGCACCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002348012_1002348022 19 Left 1002348012 5:178561444-178561466 CCTACAATGCAGGGACTGCTCTG 0: 1
1: 0
2: 1
3: 17
4: 129
Right 1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1002348011_1002348022 20 Left 1002348011 5:178561443-178561465 CCCTACAATGCAGGGACTGCTCT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 85
1002348010_1002348022 21 Left 1002348010 5:178561442-178561464 CCCCTACAATGCAGGGACTGCTC 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002348022 Original CRISPR GAACCCTATGGGCACCCCTG AGG Intronic
900786220 1:4652597-4652619 GAACCCCTTGGGCAGCCTTGTGG - Intergenic
906546644 1:46624143-46624165 GTGTCCTCTGGGCACCCCTGTGG - Intergenic
910558417 1:88563067-88563089 GAAACCTGTGGGGACTCCTGAGG - Intergenic
915161190 1:153922254-153922276 GCACCCTGAGGGCACCACTGGGG + Intronic
920567057 1:206982424-206982446 GAAACATATGGTCACCCCTGGGG + Intergenic
922823647 1:228502176-228502198 GAACCCTGTGGGCATCTCTTTGG - Intergenic
1073323908 10:102631638-102631660 GCACCCTGTGGGCACTCCTGTGG - Exonic
1077061394 11:619271-619293 GAACCCTGGGGGCTCACCTGTGG + Intronic
1079131428 11:17749020-17749042 GAACCCTGTGAGCACCACGGAGG - Intronic
1081667483 11:44925047-44925069 GAGCCCTAAGGGCAACCCAGGGG - Intronic
1084891367 11:72238645-72238667 GACCCCCACAGGCACCCCTGGGG - Exonic
1087184775 11:95177783-95177805 TAACACTATGGCCACCCATGAGG - Exonic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1091345221 11:134847746-134847768 GAACCCTATGGGCCTTCCTAAGG + Intergenic
1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG + Intronic
1104589641 12:130074130-130074152 GAGCCCTATGGGCACTGCTGAGG + Intergenic
1107120727 13:36792633-36792655 CATCACTATGGGCACCACTGAGG + Intergenic
1112870312 13:103962873-103962895 GAACCCTTTGAGAACCCATGTGG - Intergenic
1114531061 14:23396783-23396805 GAACCCAGTGGCCATCCCTGAGG - Exonic
1118315196 14:64721787-64721809 GCACCCTAGGGGCTCTCCTGGGG - Intronic
1118824610 14:69368834-69368856 GAAGACAATGGGCATCCCTGTGG + Intergenic
1125478920 15:40066852-40066874 AACCCCTTTGGGCACCCCTGGGG - Intergenic
1129742155 15:77994504-77994526 CACCCCTATGGGAACCCCTTTGG + Intronic
1129843329 15:78756976-78756998 CACCCCTATGGGAACCCCTTTGG - Intergenic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1132980555 16:2736831-2736853 GGACACTATGGGGGCCCCTGAGG - Intergenic
1141500771 16:84442835-84442857 GAATCCTATGAGCTTCCCTGTGG + Intronic
1142607811 17:1091606-1091628 CAACACTATGGGCTCCACTGAGG + Intronic
1144521977 17:15958774-15958796 GAACCCTGTGTGCCCCCCAGAGG - Intronic
1144834249 17:18148637-18148659 GGACCCTATGGGACCCTCTGGGG - Intronic
1147960976 17:44167419-44167441 GAACCCTGTTGGCACCCATTTGG - Intergenic
1151786151 17:76275993-76276015 GAGCTCTGTGGGAACCCCTGGGG + Intronic
1157332645 18:46714716-46714738 GAGCCCTATGGGGACCTGTGAGG + Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1163794773 19:19331070-19331092 GAACCCTAAGGTGACCCCAGGGG + Intronic
1166216062 19:41335890-41335912 GAGGCCTCTGGGCTCCCCTGGGG - Intronic
1166281671 19:41798278-41798300 GAATCCTAGGGGGACCCCTCAGG - Intronic
925075837 2:1014926-1014948 GAACCCGAGGGGCAGCCTTGAGG + Intronic
927004904 2:18838080-18838102 GAACTTCATGGGAACCCCTGTGG - Intergenic
928136918 2:28694760-28694782 GATCACTCTGGGCAGCCCTGTGG + Intergenic
938081891 2:128374590-128374612 GTACCCACTCGGCACCCCTGTGG + Intergenic
938206735 2:129430670-129430692 GAACCCATTGCGCTCCCCTGGGG - Intergenic
945933539 2:215880597-215880619 CAACCCCATGGGCAGCTCTGTGG + Intergenic
946339758 2:219059736-219059758 GAAACTTTTCGGCACCCCTGAGG - Intronic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1170624592 20:18021574-18021596 GAATCCTCAGAGCACCCCTGGGG - Intronic
1173645555 20:44631206-44631228 GTACCCTCTGGGCACTCATGGGG - Intronic
1175199301 20:57266745-57266767 GAACCCACTGGGCACAGCTGGGG - Intergenic
1175718118 20:61269031-61269053 GAACCCCATGGAAAGCCCTGTGG + Intronic
1178945715 21:36946060-36946082 GAACCATAAGAGCACCCTTGTGG - Intronic
1184098253 22:42328313-42328335 GCATCCTGTGGGCTCCCCTGAGG + Intronic
951108584 3:18774039-18774061 GAACCCTATCCAGACCCCTGAGG + Intergenic
961083957 3:124050507-124050529 GAACCCTAAGGCTACTCCTGAGG - Intergenic
962418146 3:135202408-135202430 GTACCCTATGGGGGCCGCTGAGG - Intronic
963914529 3:150845936-150845958 GAACCTTGTGTGCACCCATGGGG - Intergenic
968035538 3:195544570-195544592 GAACCCTACAGTCATCCCTGAGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969477098 4:7427925-7427947 GAACCATATCACCACCCCTGAGG + Intronic
974070732 4:57121213-57121235 GAACCCCATGGGCACACAGGAGG - Intergenic
976087154 4:81418244-81418266 GGACCGTGTGGGCACCCTTGTGG - Intergenic
985894345 5:2739875-2739897 GAACCCGATGGGTCCCGCTGCGG + Intergenic
990559007 5:56965249-56965271 GAAGCCTATGTGTACCCCTAGGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002593418 5:180306496-180306518 CCACCCTCTGGGCAGCCCTGTGG + Intronic
1002925188 6:1601840-1601862 GAAGACCCTGGGCACCCCTGTGG + Intergenic
1003550520 6:7098620-7098642 CAATGCTATGGGCACCCCAGAGG - Intergenic
1007756254 6:44101626-44101648 GACCCCTGGGGGGACCCCTGGGG - Intergenic
1009347235 6:62629086-62629108 GGACACTATGGGCACCAGTGAGG + Intergenic
1009641139 6:66338025-66338047 GAAACCTAAGGGCACTGCTGTGG - Intergenic
1009941148 6:70289309-70289331 CAACACTATGGGCACAGCTGAGG + Intronic
1011531145 6:88322389-88322411 GAACCCTATGCTAACCCCTAGGG + Intergenic
1021947611 7:25743572-25743594 GAAGCCTTTGGCCACCTCTGTGG + Intergenic
1025987465 7:66466243-66466265 GAAACCTGGGGGCAGCCCTGGGG + Intergenic
1026027530 7:66759179-66759201 GAAACCTGGGGGCAGCCCTGGGG - Intronic
1026681632 7:72471530-72471552 GAACCCCATGGACACCACTTTGG - Intergenic
1038700974 8:29849012-29849034 GAACCCTGGGGGGAGCCCTGGGG - Intergenic
1039911863 8:41832684-41832706 GAACCCTCTGGGAACCCTGGGGG - Intronic
1040318419 8:46276966-46276988 CAACCCTGTGGGCTCCTCTGGGG + Intergenic
1049308869 8:141922852-141922874 GAACCGGATGGGAAGCCCTGGGG - Intergenic
1049836389 8:144738249-144738271 GAACCCCATGGGCAACCAGGTGG - Intronic
1058937241 9:109780402-109780424 GAAACTGATGGGCACCCCGGGGG - Exonic
1060210103 9:121704940-121704962 GAGCCCCATGGGCACCTTTGGGG + Intronic
1062117621 9:134817872-134817894 CCACCCTCTGGGCTCCCCTGGGG - Intronic
1203665882 Un_KI270754v1:20459-20481 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203667031 Un_KI270754v1:26098-26120 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1203668179 Un_KI270754v1:31737-31759 GAACCCTGAGGCAACCCCTGAGG + Intergenic
1186190651 X:7064579-7064601 GGACCCTCTGGGCACCTCTCAGG - Intronic
1186455653 X:9708082-9708104 GGGCCCTATAGTCACCCCTGAGG + Intronic
1190980402 X:55452470-55452492 GACCCCTATGGCCGCCTCTGTGG + Exonic
1192362252 X:70447236-70447258 GAAGCCTCTGGGTACCACTGGGG + Intronic
1199991429 X:152989735-152989757 GGACCCTGTGGCCTCCCCTGCGG + Exonic
1202046226 Y:20739260-20739282 GAACCCTATTGTCACTCCTTAGG + Intergenic