ID: 1002351940

View in Genome Browser
Species Human (GRCh38)
Location 5:178589737-178589759
Sequence GCACGTCTGCGCCAAGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002351940_1002351945 -8 Left 1002351940 5:178589737-178589759 CCTCCGCCTTGGCGCAGACGTGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1002351945 5:178589752-178589774 AGACGTGCCCATCTCTGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 125
1002351940_1002351952 16 Left 1002351940 5:178589737-178589759 CCTCCGCCTTGGCGCAGACGTGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1002351952 5:178589776-178589798 CCCGAGCGCACGCAGCCGGCGGG 0: 1
1: 1
2: 2
3: 8
4: 94
1002351940_1002351950 15 Left 1002351940 5:178589737-178589759 CCTCCGCCTTGGCGCAGACGTGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1002351950 5:178589775-178589797 CCCCGAGCGCACGCAGCCGGCGG 0: 1
1: 0
2: 0
3: 7
4: 87
1002351940_1002351948 12 Left 1002351940 5:178589737-178589759 CCTCCGCCTTGGCGCAGACGTGC 0: 1
1: 0
2: 0
3: 7
4: 56
Right 1002351948 5:178589772-178589794 CGGCCCCGAGCGCACGCAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002351940 Original CRISPR GCACGTCTGCGCCAAGGCGG AGG (reversed) Intronic