ID: 1002352050

View in Genome Browser
Species Human (GRCh38)
Location 5:178590156-178590178
Sequence CCCCGCGTCGCCGCCGCCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 248}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002352040_1002352050 6 Left 1002352040 5:178590127-178590149 CCGCCGCCGCCGCCCGCCGCATT 0: 1
1: 1
2: 9
3: 92
4: 488
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352036_1002352050 26 Left 1002352036 5:178590107-178590129 CCGTCGTCGCCGAGCGCCCTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352042_1002352050 0 Left 1002352042 5:178590133-178590155 CCGCCGCCCGCCGCATTGCCCTT 0: 1
1: 0
2: 0
3: 13
4: 136
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352043_1002352050 -3 Left 1002352043 5:178590136-178590158 CCGCCCGCCGCATTGCCCTTCCC 0: 1
1: 0
2: 1
3: 26
4: 335
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352044_1002352050 -6 Left 1002352044 5:178590139-178590161 CCCGCCGCATTGCCCTTCCCCGC 0: 1
1: 0
2: 0
3: 11
4: 205
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352045_1002352050 -7 Left 1002352045 5:178590140-178590162 CCGCCGCATTGCCCTTCCCCGCG 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352035_1002352050 30 Left 1002352035 5:178590103-178590125 CCGGCCGTCGTCGCCGAGCGCCC 0: 1
1: 1
2: 0
3: 6
4: 77
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352041_1002352050 3 Left 1002352041 5:178590130-178590152 CCGCCGCCGCCCGCCGCATTGCC 0: 1
1: 0
2: 2
3: 31
4: 345
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352046_1002352050 -10 Left 1002352046 5:178590143-178590165 CCGCATTGCCCTTCCCCGCGTCG 0: 1
1: 0
2: 0
3: 6
4: 166
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352037_1002352050 17 Left 1002352037 5:178590116-178590138 CCGAGCGCCCTCCGCCGCCGCCG 0: 1
1: 2
2: 20
3: 159
4: 893
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352039_1002352050 9 Left 1002352039 5:178590124-178590146 CCTCCGCCGCCGCCGCCCGCCGC 0: 7
1: 42
2: 245
3: 996
4: 4772
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248
1002352038_1002352050 10 Left 1002352038 5:178590123-178590145 CCCTCCGCCGCCGCCGCCCGCCG 0: 1
1: 9
2: 28
3: 197
4: 1034
Right 1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG 0: 1
1: 0
2: 6
3: 61
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002352050 Original CRISPR CCCCGCGTCGCCGCCGCCAC CGG Exonic
901050835 1:6425175-6425197 GCCCACGACGCCTCCGCCACCGG + Exonic
901057401 1:6455100-6455122 CCCAGCGCCGCCGCCGCCCACGG + Intronic
901443536 1:9293314-9293336 CCCCGCGCTGCCGCCGCTGCAGG + Intronic
901506572 1:9689436-9689458 GCCCGCGCCGCCGCCGGCCCCGG + Intronic
901629026 1:10639249-10639271 CCGCCCGACGCCGCCGCCCCCGG - Exonic
901769303 1:11522451-11522473 CCCATCATCACCGCCGCCACAGG + Intronic
902476958 1:16693379-16693401 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
902823224 1:18956190-18956212 TCCCGCAGCGCCGCCGTCACCGG + Exonic
902887212 1:19414215-19414237 CCCCGCATCGCCACCCCCATCGG - Intronic
903349830 1:22710943-22710965 CCCCGCGGCGCCGCGGCCCGAGG + Intronic
903476015 1:23619638-23619660 CGCCGCGCCGACGCCGCCACCGG - Intronic
904039292 1:27575173-27575195 CCCGCCGCCGCCGCCGCCTCTGG + Intronic
904044982 1:27603463-27603485 GCCCGCGTCGCTGCCACCGCCGG - Exonic
904620452 1:31772031-31772053 CGCGCCGCCGCCGCCGCCACGGG - Intergenic
906545509 1:46616870-46616892 CCCCGCCACGCCGCGGCCACGGG + Intronic
906614591 1:47225673-47225695 TCTCGCGGCGCCGCCCCCACCGG + Exonic
907184937 1:52602379-52602401 CCTCGCGACGCCGCCACCTCCGG + Exonic
908401404 1:63775028-63775050 CCTCGCATCGCCACCGCCCCCGG + Intronic
909548043 1:76868691-76868713 CCCCGCGGGACCGCGGCCACTGG + Exonic
915070388 1:153261296-153261318 CCCGGAGGAGCCGCCGCCACCGG - Exonic
915302861 1:154961549-154961571 CGCCTCGGCGCCGCCCCCACCGG - Exonic
920401567 1:205679845-205679867 CCCCGCGGCGCCGCGGCCGTCGG + Intronic
921029719 1:211326802-211326824 CTCCGCTTCGCCGCCGCCGCCGG + Intronic
921604757 1:217139698-217139720 CCGCGCACCGCCGCCGCCGCCGG - Intergenic
922958587 1:229625909-229625931 CCCCCCGCCGCCGCCGCCTCCGG + Exonic
923007920 1:230067082-230067104 CCGCGCGGCGCCGCCGGCCCGGG + Intronic
923506394 1:234609595-234609617 CCCCGCGTCTCCCCCACCAGCGG + Intergenic
924172416 1:241356678-241356700 CCCCGCGCCGCGGCGGCCGCCGG + Intronic
924289722 1:242524714-242524736 CCCGCCGCCGCCGCCGCCCCGGG - Intergenic
1064209078 10:13348112-13348134 CCCGCCGCCGCCGCCGCCGCCGG - Exonic
1065589782 10:27252571-27252593 GCCCCCGCCGCCGCCGCCAGGGG + Intergenic
1065712734 10:28533158-28533180 CCCGCCGCCGCCGCCGCCGCTGG - Intronic
1066402605 10:35090349-35090371 CCCCGGCCGGCCGCCGCCACCGG + Exonic
1067362416 10:45594709-45594731 CCGCGCGCAGCCGCCGCCGCTGG - Intronic
1070768311 10:79068816-79068838 CGCCGCGCCGCCGCCGCTGCCGG - Intergenic
1070800833 10:79243558-79243580 CCCCGCGCCGCCGCCGCCGCCGG + Intronic
1072654623 10:97321174-97321196 ACGCGCGTCGCCGCCACCGCGGG + Exonic
1073503923 10:103967350-103967372 CCCAGAGTGGCCGCCGCCCCTGG + Exonic
1074169721 10:110919955-110919977 CCGCCCGCCGCCGCCGCCGCAGG - Intronic
1076554275 10:131311787-131311809 GCCCGCGCCGCCGCCGCCCCCGG + Intergenic
1077056131 11:594185-594207 CCCAGAGTGGCCGCAGCCACAGG - Intronic
1077247883 11:1548039-1548061 CCCCAGGACGCCGCCCCCACCGG + Intergenic
1077322073 11:1947091-1947113 CCCCGCGCCGCAGACTCCACAGG - Intergenic
1077898785 11:6473906-6473928 CCCCGCGCCGGCGCCGCCGCCGG + Intronic
1078057407 11:8019254-8019276 CCCAGCGCCGCCGCCGCCCGCGG + Intronic
1079451181 11:20601174-20601196 CCCTGCGCCGCCGCCGCCTCCGG - Exonic
1080386258 11:31812880-31812902 GGCCGCGTCGCCGCAGCCCCTGG + Intronic
1082986082 11:59172363-59172385 CCGCGCGCCGCCGCCGCCGCCGG - Intronic
1083039127 11:59669081-59669103 CCCTGCGCAGCCGCCGCCGCCGG - Intergenic
1083939503 11:65888158-65888180 CCCCGCCCCGCCGACGCCAGAGG + Intronic
1083970303 11:66070404-66070426 GCCCCCGCCGCCGCCGCCGCGGG + Intronic
1084128768 11:67118441-67118463 GGCCCCGGCGCCGCCGCCACGGG - Intergenic
1084146144 11:67266408-67266430 CCCGGAGCCGCCGCCGCCTCCGG - Exonic
1084257934 11:67955427-67955449 CCCCGCGTCCCCGGCACCCCCGG + Intergenic
1084594221 11:70107480-70107502 CCCCGCCCCGCCGCCTCCACTGG - Intronic
1085205829 11:74731361-74731383 CGCCGCGCCGCCGCCGCTGCTGG - Intronic
1087241758 11:95789290-95789312 CCCCTCTTCGCCGGCGCCTCAGG - Intronic
1089432653 11:118436559-118436581 CCCCCCGCCGCCGCCGCCCCCGG - Exonic
1089499924 11:118925843-118925865 CCGCGCGCCGCCGCCTCCCCGGG + Intronic
1202805089 11_KI270721v1_random:2404-2426 CCCCGCGCCGCAGACTCCACAGG - Intergenic
1093435484 12:19130224-19130246 CCCCGCCTCGCCGCCTCCCGGGG - Intronic
1093894821 12:24563339-24563361 CCGCGCGTCCCCGCCGCCGCCGG + Intergenic
1095773734 12:45990505-45990527 CCCTGCTTCGCCGCCGCCTCCGG - Exonic
1096073569 12:48788937-48788959 CCCCGCCCCGCCGCCCCCGCGGG + Intronic
1096101235 12:48971608-48971630 CCCAGCGCCGCCGCGGCCGCCGG + Exonic
1096551836 12:52378206-52378228 GCCCGGGTCGCCCCGGCCACTGG - Exonic
1097106776 12:56630374-56630396 CCCCACGCGGCCTCCGCCACAGG + Intronic
1097990091 12:65825008-65825030 CCCACCGCCGCCGCCGCCACCGG + Exonic
1098123824 12:67269639-67269661 GCCGCCGCCGCCGCCGCCACTGG - Exonic
1098550373 12:71755140-71755162 CGCCCCGCCGCCGCCGCCGCCGG - Exonic
1098897814 12:76083970-76083992 CCCCGCGCGGCCGCCCCCAATGG + Intronic
1100444816 12:94650580-94650602 CCCTGCGCCGCCGCCGCCGCGGG + Intergenic
1100869470 12:98895075-98895097 CCCCGCCTCGCCGCCCACCCCGG - Intronic
1103364016 12:120369340-120369362 CCCGGCGCCGCCGCCTCCGCGGG - Intergenic
1103595358 12:122021826-122021848 AGCCGCGCCGCCGCCGCCGCCGG - Exonic
1103604880 12:122079018-122079040 CGCCGCGCCACCGCCGCCTCGGG + Exonic
1105964528 13:25372323-25372345 CCCCGCGCCGCCCCCGCCCCGGG - Intronic
1107951355 13:45465064-45465086 TCCCGCTCCGCCGCCGCCTCAGG - Exonic
1110572939 13:77026539-77026561 GCCCGCGACGCCGCCGCTCCCGG - Intronic
1112290892 13:98143361-98143383 GCCCGCGCCGCCGCCGCCCGCGG + Intronic
1112505081 13:99970583-99970605 CCCGGCGCCGCCGCCGCCGCCGG - Exonic
1113768299 13:112894246-112894268 CCCCGCCCCGCCCCCGCCCCCGG + Intergenic
1118186543 14:63543135-63543157 CACGTCGTCGCCGCCGCCGCCGG - Exonic
1118607743 14:67515579-67515601 CCCGGGGTCGGCCCCGCCACGGG + Intronic
1119410386 14:74426369-74426391 CCTCGCTTCGCCGCCTCCTCCGG - Intergenic
1121758677 14:96424267-96424289 CCCCGTGTCGCCGCTGCCGCCGG - Intronic
1124500728 15:30225039-30225061 CCCGCCGCCGCCGCCGCCGCAGG + Intergenic
1124742841 15:32313628-32313650 CCCGCCGCCGCCGCCGCCGCAGG - Intergenic
1125516460 15:40323833-40323855 GCCAGCGCCGCCGCCGCCGCCGG - Intergenic
1130076511 15:80695031-80695053 CCGCGCGGCGGCGCCGCCGCTGG - Intronic
1130115365 15:81001190-81001212 CCCCGCGGCGCTGCGGCAACCGG - Exonic
1131154670 15:90067565-90067587 CAGGGCGTCGCAGCCGCCACTGG - Exonic
1131171877 15:90184794-90184816 CCCCGCCCCACCACCGCCACCGG - Intronic
1131257551 15:90872030-90872052 TCCAGCCTCCCCGCCGCCACCGG + Intronic
1132056119 15:98650687-98650709 CCCCGCGCCGCCGCAGACCCTGG - Intronic
1132320121 15:100919430-100919452 CCCGGCCCCGCCGCCGCCTCAGG + Exonic
1132560071 16:589596-589618 CGCCCCGTCGCCGGCGCCATTGG - Intronic
1132560190 16:590037-590059 CCCGGCCGCGCCGCCGCCATTGG - Intronic
1132843533 16:1989934-1989956 CCGCGCGTCCCCGCCGCGGCCGG + Exonic
1132889544 16:2196912-2196934 CCCCGCGCCGCCGCCGCGTCGGG - Intergenic
1132896818 16:2233178-2233200 CCCCCCGTCGCCCCCACCTCTGG - Exonic
1132900944 16:2253994-2254016 CCCCGGGCCGCCGCCGCCACAGG - Exonic
1133241283 16:4416044-4416066 CCCCGGGTCGCCCCTGCCCCTGG - Intronic
1136913909 16:34163607-34163629 CCGCGGTTCGCCGCCGCCCCTGG + Intergenic
1136993304 16:35170297-35170319 GCCCGCGTCGCCTCCGCTCCTGG + Intergenic
1137261113 16:46830945-46830967 CCCCGGATCCCCGCCGCCGCCGG + Intronic
1138185838 16:54976996-54977018 GCCGCCGCCGCCGCCGCCACTGG + Intergenic
1142799842 17:2337987-2338009 CCCAGCGCCGCTGCCGTCACTGG - Intronic
1144269144 17:13600938-13600960 CCCCGCCTCCTCGCCGCCGCCGG + Exonic
1144756184 17:17681838-17681860 CCTCGCGCCGCCCCCGCCCCGGG - Intronic
1145925652 17:28644947-28644969 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1147015492 17:37489058-37489080 CCCCGCCTCCCCTCCGCCTCTGG - Intergenic
1147429706 17:40363811-40363833 CCCCGCGTCCCCAGCGCCATGGG - Exonic
1148754999 17:49968878-49968900 CCCTGCGTCTCCGCAGCCCCCGG + Intergenic
1149430655 17:56593887-56593909 CCCTGCGCCGCCGCCGGCCCGGG + Exonic
1150413364 17:64965921-64965943 CCCTGGGTCGCCGACGCCAGGGG + Intergenic
1151478544 17:74356879-74356901 CGCCGCGTCGCCGCCGCTGCTGG + Exonic
1151728224 17:75896641-75896663 CCGCGCGCTGCCCCCGCCACGGG - Exonic
1151866432 17:76806256-76806278 CCCCGCCGCCCCGCCGGCACGGG + Intergenic
1152245589 17:79183158-79183180 CTCTGCGCCGCCGCCGCCACCGG - Intronic
1152354145 17:79798466-79798488 CCCAGCGCCGCCCCCGCCACGGG - Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG + Intergenic
1155053824 18:22169043-22169065 TCCCGCGCCGCCGCCGCGGCGGG - Intergenic
1156350369 18:36297485-36297507 CCCCGCCCCGCCTCCGCCGCCGG + Intergenic
1156448496 18:37253740-37253762 CCCCGCGCCCCGGCCGCCCCCGG + Intronic
1158718244 18:59899784-59899806 CCGCGGGTCGGCGCCGCCGCGGG + Intergenic
1158954114 18:62523460-62523482 CCCCGCGGAGCCGCCGCCCGAGG + Exonic
1159511293 18:69400925-69400947 CCCCACCGCGCCGCCGCCCCCGG - Intergenic
1160499884 18:79396357-79396379 CCCCGCGCGGCCTCCGCCCCCGG + Intronic
1160862158 19:1242014-1242036 CCCTCCGTGGCCGCCGCCCCCGG + Intronic
1160875840 19:1295889-1295911 CCCCGCGTCCCCGCCCACTCGGG - Intronic
1160930473 19:1567677-1567699 CCCCGGGTCGCTGCCGCTGCTGG - Exonic
1161241111 19:3224558-3224580 CCGCGCGGCGCGGCCGCCAGGGG + Intergenic
1161241156 19:3224699-3224721 CCGCCCGCCGCCGCCGCCGCCGG + Exonic
1161350070 19:3786392-3786414 CCGCGCGCCGCCGCCGCCGCCGG + Intronic
1161707301 19:5828208-5828230 CCCCGCCTCGACGGCACCACTGG + Exonic
1161736913 19:5997088-5997110 CACCGCGTCGCGGAGGCCACCGG - Exonic
1162070497 19:8149519-8149541 CCCCGGGTCCCCGGCGCCGCAGG - Exonic
1162440088 19:10687382-10687404 GCCCCCGCCGCCACCGCCACTGG - Exonic
1165419946 19:35717773-35717795 CCCCGCGTCGCGGCCGCAGAGGG - Intergenic
1166706045 19:44908600-44908622 GCCCGCGTCTCCTCCGCCACCGG - Exonic
1167072765 19:47230524-47230546 CCCCCCGTCGCCGCCCCCAGCGG + Intronic
1168064058 19:53909425-53909447 CCGGCCGCCGCCGCCGCCACCGG - Exonic
1168072830 19:53962313-53962335 GCCCGCGCCGCCTCCGCCCCAGG - Intergenic
1168336499 19:55600293-55600315 CCCCGCCTCGCCGCCGCCGAGGG + Intronic
1168343808 19:55641051-55641073 CCCCGCGTCCCCGGCGCCGCCGG + Intronic
1168574678 19:57500078-57500100 CTCAGCGTGGCCGCCGCCATCGG - Exonic
1202710974 1_KI270714v1_random:19205-19227 CCCAGCGCCGCCGCCGCCCACGG - Intergenic
925143829 2:1568209-1568231 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143857 2:1568323-1568345 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143864 2:1568356-1568378 CCCTGCGTCGCGGCTGTCACTGG - Intergenic
925143872 2:1568389-1568411 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143902 2:1568517-1568539 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143910 2:1568550-1568572 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143930 2:1568631-1568653 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143950 2:1568712-1568734 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143958 2:1568745-1568767 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143966 2:1568778-1568800 CCCTGCGACGCGGCCGTCACTGG - Intergenic
925143974 2:1568810-1568832 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925143994 2:1568890-1568912 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925144002 2:1568923-1568945 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925144010 2:1568956-1568978 CCCTGCGACGCGGCCGTCACTGG - Intergenic
925144018 2:1568988-1569010 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925144038 2:1569068-1569090 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925144046 2:1569101-1569123 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925144054 2:1569134-1569156 CCCTGCGACGCGGCCGTCACTGG - Intergenic
925144062 2:1569166-1569188 CCCTGCGTCGCGGCCGTCACTGG - Intergenic
925802311 2:7613636-7613658 GCCCTCGTCGCCACAGCCACTGG - Intergenic
926154968 2:10448528-10448550 CCACGCGTGGCCCCCGCCCCCGG + Intergenic
926422946 2:12716870-12716892 CCCCCCGCCGCCCCCGCGACTGG - Exonic
927115881 2:19901668-19901690 CCCGGGGTCGCCGCGGCCCCAGG + Intronic
927441163 2:23118966-23118988 CCCTGCCTCGCCACCACCACTGG + Intergenic
927714167 2:25341766-25341788 CCCCGGCTCCCCGCCGCCTCCGG + Intronic
927904616 2:26847942-26847964 CCGCGCGCCGCCGCCGCCTGGGG - Intronic
931719474 2:65056675-65056697 CCTCGCGTCCCCGCCGGCAAGGG + Intronic
932635587 2:73385642-73385664 TGCCGCCTCGCCGCCGTCACCGG - Intergenic
936278724 2:111120774-111120796 CCCCTCGGCGCCGCGGCCGCCGG - Intronic
936433181 2:112482008-112482030 CCCTGCGCCGCCGCCGCCCCCGG + Intergenic
937065060 2:119011561-119011583 TCCTGCGGCGCGGCCGCCACTGG - Intergenic
937325724 2:120988748-120988770 CCCCGCGTGGCCGTGGCCATAGG - Exonic
938548111 2:132353221-132353243 CCTGGCTTCGCCGCAGCCACAGG - Intergenic
941119112 2:161507856-161507878 CCCGCCGCCGCCGCCGCCGCGGG + Intronic
941816293 2:169799126-169799148 CCCCTCGGCTCCGCCGCCTCCGG - Intronic
944632772 2:201643456-201643478 CCCCGCGACGCAGCGGCCTCCGG + Exonic
946394255 2:219435253-219435275 CCCCGCAGCGCCGCAGCCACAGG - Exonic
948801434 2:240435338-240435360 GCCCCCGTCCCCGCCCCCACAGG + Intergenic
948801583 2:240435737-240435759 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1168802631 20:653181-653203 CCCATCGTCGCCGCCGCCGCGGG + Exonic
1170756810 20:19212495-19212517 CCCCGCCGCGCCGCCGCCCCAGG + Intergenic
1171876980 20:30585993-30586015 CCTGGCTTCGCCGCAGCCACAGG - Intergenic
1171908819 20:30922178-30922200 CCCCGGTTCGTCGCCGCCCCTGG + Intergenic
1173243491 20:41317808-41317830 CCCCGCCCCGCGGCCGCCAGAGG - Intergenic
1173251603 20:41366696-41366718 CGCCGCGCCGCCCCCGCCGCTGG + Exonic
1174216750 20:48921795-48921817 CCCGGCGTCCCGGCCGGCACCGG - Intergenic
1174380713 20:50153736-50153758 GCCCGCGCCGCCGCCGCGCCCGG - Intergenic
1175111092 20:56648456-56648478 CCCCGCGTCACAGTGGCCACAGG - Intergenic
1175338099 20:58209656-58209678 CCCCCCGCCCCCGCCCCCACCGG + Intergenic
1175926776 20:62475195-62475217 CCCCGCGCTGCCGCCGCTGCCGG + Exonic
1176311775 21:5154459-5154481 CCCCGCGTCCCCGAGGCCATGGG + Intronic
1176414607 21:6467514-6467536 CCCCGCGAGGCCGCCACCCCGGG - Intergenic
1176550061 21:8217100-8217122 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
1176555774 21:8253457-8253479 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1176568988 21:8400135-8400157 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
1176574711 21:8436491-8436513 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1176576902 21:8444370-8444392 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
1176611325 21:8987784-8987806 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1178487059 21:33025880-33025902 GCCGCCGTCGCCGCTGCCACCGG + Intronic
1178513836 21:33229904-33229926 CGCCGCGCCGCCGCCGGCGCGGG - Intronic
1179690105 21:43075836-43075858 CCCCGCGAGGCCGCCACCCCGGG - Exonic
1179845275 21:44107576-44107598 CCCCGCGTCCCCGAGGCCACGGG - Intronic
1180960677 22:19761024-19761046 CCGTGCGCCGCCGCCGCCCCCGG + Exonic
1180991787 22:19941588-19941610 CCCCGCGTGGGCACCCCCACGGG + Exonic
1181144335 22:20833554-20833576 CCCCGCAACACCACCGCCACAGG - Intronic
1181457938 22:23070308-23070330 CGCCGCGCCGCCGCCGGCAGGGG - Intronic
1183517108 22:38272966-38272988 CCCGGAGTCTCCGCCGCCGCCGG + Exonic
1183665567 22:39244119-39244141 CCCCCGGGCGCCGCCGCCCCCGG + Exonic
1184265389 22:43343425-43343447 CCCCGCCCCTCCGACGCCACGGG - Intergenic
1184865713 22:47200893-47200915 CCCCGCCCCGCTGCAGCCACCGG - Intergenic
1185409411 22:50674361-50674383 CCCCCCGCCGCCCCCGCCCCCGG + Intergenic
1203252759 22_KI270733v1_random:125542-125564 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203254951 22_KI270733v1_random:133426-133448 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
1203260815 22_KI270733v1_random:170628-170650 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203263007 22_KI270733v1_random:178505-178527 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
954110113 3:48429013-48429035 CCCCTCCTCGCCGTCGCCGCCGG - Intronic
956659488 3:71583803-71583825 GCCGCCGCCGCCGCCGCCACCGG - Intronic
959049672 3:101512924-101512946 TCCCGGGTCGCCCCCGCCCCTGG - Intronic
961873170 3:130002743-130002765 CCCCGCGTCCCCGGCACCCCCGG + Intergenic
964201452 3:154122397-154122419 GCCTGCGCCGCCGCCGCCGCCGG + Exonic
967685279 3:192409908-192409930 CGCCGCGCCGCCGCCTCCCCAGG + Intronic
968426936 4:530221-530243 CCCTGAGGAGCCGCCGCCACAGG - Intronic
968489430 4:882123-882145 CCCTGCGTCCCTGCAGCCACAGG - Intronic
968636717 4:1684605-1684627 CCTCAGGTCGCCGCCGCCACAGG - Intergenic
968922919 4:3531991-3532013 CACGGCGTCGTCGCCGGCACGGG + Intronic
969737471 4:9001082-9001104 CCCCGCGTCCCCGGCACCCCCGG - Intergenic
970001900 4:11372840-11372862 CCCCGGGCCGCCGCCGCCACAGG + Intergenic
970913300 4:21304420-21304442 CGCCGCGCCGCCGCCACCAGTGG + Intronic
970967872 4:21948843-21948865 CCGCGCGCCCCCGCCGCCAAGGG - Intergenic
973982092 4:56315418-56315440 CCTCGCGTCGCCGGGGCCTCGGG - Exonic
974047269 4:56908350-56908372 CCCGGCGGGGCCGCCGCCGCCGG - Intronic
975342592 4:73258628-73258650 GCAGCCGTCGCCGCCGCCACCGG + Exonic
976297314 4:83485130-83485152 CCCCGCCTCGCTGCCACCACAGG - Exonic
979674683 4:123398349-123398371 TCCCCCGCCCCCGCCGCCACCGG - Intronic
981429798 4:144645871-144645893 GCCCGCCTCGCCGCGGCCCCCGG - Intergenic
984811090 4:183797348-183797370 TCCCGCGTCTCCGCCCCCGCGGG + Intergenic
986330585 5:6713851-6713873 GCCGCCGCCGCCGCCGCCACCGG + Intergenic
987374013 5:17217832-17217854 CCCCGCGCCGCCGCGGACCCGGG + Intronic
988816406 5:34839097-34839119 CCCCGCGTCGCCATGGCTACAGG + Intronic
988941379 5:36151607-36151629 CCCCGAGTGGCCGCCGCTGCGGG - Exonic
990376213 5:55173339-55173361 CCCCGCCCCGCCACCGCCTCCGG + Intergenic
992124376 5:73626054-73626076 CCGCGCCTCCCCGCTGCCACTGG - Intergenic
997704074 5:135930511-135930533 CCCCACGTCGCCACCGCCGGCGG - Intronic
1002352050 5:178590156-178590178 CCCCGCGTCGCCGCCGCCACCGG + Exonic
1002666773 5:180831185-180831207 CCCGCCGCCGCCGCCGCCTCGGG + Intergenic
1004216792 6:13711274-13711296 CCCTCCGCCGCCGCCGCCCCCGG - Exonic
1004216933 6:13711756-13711778 TCCCGCGTCGCCCCCGCCCTCGG - Intergenic
1004228944 6:13814068-13814090 CCGGGCGTCGCCGCTGCCGCCGG - Exonic
1006300726 6:33192495-33192517 CCCCACCTCGCCCCCGCCCCCGG + Exonic
1006369161 6:33633682-33633704 CGACGCGCCGCCGCCGCCAAGGG - Intronic
1006472660 6:34237335-34237357 CCCTCCGCCGCCGCCGCCGCGGG - Intronic
1009431656 6:63572649-63572671 GCCTGTGTCGCCGCCGCCTCGGG + Exonic
1011128737 6:84033708-84033730 CCCCGCGCCGCCTCCGCTGCGGG + Intergenic
1014947488 6:127515665-127515687 CCCTCCGCCGCCGCCGCCATTGG + Exonic
1016863962 6:148747769-148747791 CCGCGCGCCGCCGCCGCCCCGGG + Intronic
1016923474 6:149317889-149317911 GCCAGCGCCGCCGCCGCCTCCGG - Intronic
1017672206 6:156778582-156778604 CGCCGGGCCGCCGCCGCCCCCGG - Exonic
1017793634 6:157823068-157823090 CCGCGCCGCGCCGCCGCCCCGGG - Intronic
1019395732 7:816746-816768 CCCCGCGTCCCCCCGGCCCCCGG - Intronic
1019828332 7:3301615-3301637 CGCGCCGCCGCCGCCGCCACCGG - Exonic
1019900135 7:4013969-4013991 CCCCGTGTCCCCGCCGCCTGCGG + Intronic
1020136863 7:5592613-5592635 CCCCGCAGCGCCGCCGCCTGAGG - Intergenic
1022100249 7:27165147-27165169 TCCGGCGCCGCCGCCGCCACGGG + Exonic
1022285966 7:28956539-28956561 CCCTCCGTCGCTGCCGCCGCGGG - Exonic
1027177788 7:75915500-75915522 CCCCGCGCCGCCGCCCCCCACGG + Intronic
1029640339 7:101816192-101816214 CCCCTCCTCCCCGCCGCCGCGGG - Intronic
1034446197 7:151115417-151115439 GCCGGCGTCGCCGTCGCTACGGG - Intronic
1034560626 7:151877329-151877351 CCCCGCCGCGCCGCGGCCCCAGG + Intergenic
1035580307 8:735856-735878 CCCAGCGTCACCGCAGCCTCTGG + Intronic
1035751958 8:2002500-2002522 CCCCGTGGCGCCGCTGCCCCGGG + Exonic
1038554187 8:28494773-28494795 CCCCGCGCTGCCGCCGGCTCCGG - Intronic
1041502393 8:58553266-58553288 CCGCTCGCCGCCGCCGCCTCCGG - Exonic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1041919832 8:63168976-63168998 CTCCCCGTCGCCGCCGCTGCCGG + Intronic
1044973746 8:97644239-97644261 CGCCGCTTAGCGGCCGCCACTGG + Exonic
1045516294 8:102863626-102863648 CCCGCCGCCGCCGCCGCCGCCGG + Intronic
1049408967 8:142464082-142464104 CCCCGCCTCCCTGCCCCCACCGG + Exonic
1049411320 8:142475236-142475258 CCCCGTGTGCCAGCCGCCACTGG - Intronic
1049585301 8:143430161-143430183 CCCCGCGCCGCCGCCGCCGCCGG + Exonic
1049989354 9:977040-977062 CCCGGTGTCGCAGCCGCCACGGG + Exonic
1053131315 9:35617312-35617334 ACCCGCTTCGCCCTCGCCACTGG + Intronic
1053493150 9:38526785-38526807 CGCCGCGTCGCTGCGGCCACTGG - Intergenic
1054820447 9:69516206-69516228 CCCCGCCTCGCCGCCGCCCGCGG + Exonic
1055091117 9:72365283-72365305 CCCGCCGCCGCCGCCGCCGCCGG - Intergenic
1057152544 9:92808342-92808364 CCTGGCGTGGCCGCAGCCACTGG - Intergenic
1058525133 9:105850005-105850027 CCCCTCCTCCCCGCCGCCCCAGG - Intergenic
1058937189 9:109780222-109780244 CTCCCGGTCGCCGCCGCCGCCGG - Intronic
1060087280 9:120714212-120714234 CCCCGCGGCCCCGCCGCCACCGG + Exonic
1060555200 9:124504486-124504508 GCCCGAGCCGCCGCTGCCACCGG + Intronic
1061059798 9:128244706-128244728 ACCCTCGGCACCGCCGCCACTGG - Intronic
1061726957 9:132587281-132587303 CCCGGCCTCGCAGCCGCCGCCGG - Intronic
1062049566 9:134440253-134440275 CCAAGCCTCGCCGCCGTCACAGG - Intronic
1062305764 9:135906706-135906728 CCCGCCGCCGCCGCCGCCAACGG + Intronic
1062349593 9:136132532-136132554 CCCCGCGTCCCTGCAGCCAGGGG + Intergenic
1062554451 9:137107680-137107702 CCCCGCGTGGTCACGGCCACCGG + Intronic
1062596509 9:137302178-137302200 CCGCGCGGCGCCGCCGTCCCCGG - Exonic
1062653341 9:137589862-137589884 CCCCGGATCGCCGACACCACTGG + Intronic
1203469162 Un_GL000220v1:108693-108715 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203471353 Un_GL000220v1:116572-116594 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
1203476983 Un_GL000220v1:152665-152687 CCCCGCCTCGCCGCCGCCCGCGG + Intergenic
1203479174 Un_GL000220v1:160544-160566 TCCAGAGTCGCCGCCGCCGCCGG - Intergenic
1203360450 Un_KI270442v1:216733-216755 CCGCGGTTCGCCGCCGCCCCTGG - Intergenic
1187826178 X:23334758-23334780 GCCGCCGTCGCCGCCGCCGCGGG + Exonic
1188003526 X:25002647-25002669 CGCCACGCCGCCGCCGCCGCCGG - Intergenic
1193819889 X:86148658-86148680 CCCCGGGACGCCGGCGCCGCTGG - Exonic
1197415269 X:126165982-126166004 CCACGCGCCGCCACCGCCGCCGG - Intergenic
1199736866 X:150693540-150693562 CCCGCCGCCGCCGCCGCCGCCGG - Exonic