ID: 1002355186

View in Genome Browser
Species Human (GRCh38)
Location 5:178622275-178622297
Sequence TTATATAAGGGGAAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002355186_1002355194 29 Left 1002355186 5:178622275-178622297 CCTTCCCCCTTCCCCTTATATAA 0: 1
1: 0
2: 1
3: 35
4: 390
Right 1002355194 5:178622327-178622349 CTGACTACAAATAAGCTGTTTGG 0: 1
1: 0
2: 0
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002355186 Original CRISPR TTATATAAGGGGAAGGGGGA AGG (reversed) Intronic
900768334 1:4520405-4520427 TCATATAAGGTGGAGGTGGAAGG - Intergenic
901631500 1:10650337-10650359 GTTTAAAAGGGGATGGGGGAGGG - Intronic
902065513 1:13682424-13682446 ATATTTAAGGGGAAGTAGGATGG + Intergenic
902422937 1:16296326-16296348 TCATATAAAAGGAAGGGGAAAGG + Intronic
902665522 1:17935059-17935081 TTTTAAAAAGGGAAGTGGGAGGG - Intergenic
903646609 1:24899942-24899964 TTTTGTCAGGGGATGGGGGATGG + Exonic
905175784 1:36134534-36134556 TTACATCAGGGGAATGGGGCTGG + Intergenic
905828458 1:41045406-41045428 ATCTATGAGGGAAAGGGGGAAGG + Intronic
905941658 1:41867923-41867945 TTTTGGAAGGGGAGGGGGGAGGG - Intronic
908534343 1:65065290-65065312 TTCTATAAAGGGAAGGAGGGGGG - Intergenic
908665755 1:66488197-66488219 TTATTTGAGGGGAAGCAGGATGG - Intergenic
910289286 1:85584427-85584449 TTATAAAAAGGAAAGGGGGATGG - Intergenic
910452315 1:87359840-87359862 TTATATAGGAGGAAGTTGGAGGG + Intergenic
910510673 1:88000643-88000665 ATAAAAAAGGGGGAGGGGGAAGG - Intergenic
910660778 1:89670084-89670106 TTAAATAAGGGGAATGGGAAAGG - Intronic
910694671 1:89999326-89999348 TTTTACAAGGGAGAGGGGGAGGG + Intronic
911048770 1:93651797-93651819 TTATAAAAGGGGGAGGGGAAGGG - Intronic
911215393 1:95187688-95187710 GTATGGAAGGGGCAGGGGGAGGG - Intronic
912435799 1:109660211-109660233 TTATGTAAGAGGTAGTGGGAGGG + Intronic
913069485 1:115286033-115286055 GTGTAGAAGGGGCAGGGGGAGGG + Exonic
913412024 1:118562607-118562629 ATGAATAAGGGGGAGGGGGAAGG + Intergenic
915360468 1:155283554-155283576 ATATATAATGGGTGGGGGGAGGG - Intronic
915916470 1:159943737-159943759 TTAAGTGAGGGGTAGGGGGAAGG + Intronic
915930910 1:160060476-160060498 TTAGATGAGGGGAAAGGAGAAGG + Intronic
916092462 1:161318267-161318289 TTATATGCGGGGGAGGGGGAAGG - Intronic
916160539 1:161908155-161908177 TTTTATAGGGGGAATGGGAAGGG + Intronic
916165219 1:161960832-161960854 TTACAGAATGGGAAGGGGCAGGG - Exonic
917399991 1:174637123-174637145 TTATATGGGGAGAAGGGGCAGGG - Intronic
917423371 1:174888343-174888365 TTATATTAGGGGTATGTGGAGGG - Intronic
917653455 1:177102198-177102220 TTAAATAAGGGGAGGGAGGAAGG + Intronic
917721325 1:177789118-177789140 TTTTTTAAGGGGAAGGGAGTTGG + Intergenic
918093744 1:181318026-181318048 TTTTAAAAGGGGAAAGGGGTGGG - Intergenic
920187061 1:204166345-204166367 GTATAAAAGGGGAAGGGCTAAGG - Intergenic
921007621 1:211110777-211110799 TTATATTAGGAGGAGGGGTAGGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921933311 1:220773165-220773187 TGATCTCAGGGGAAGGGAGAGGG + Intronic
922110965 1:222554827-222554849 TTTTATGAGGGGAGGTGGGAAGG + Intergenic
1063989174 10:11541600-11541622 TTAAATAAGGGCAAGAGGCAAGG + Intronic
1064700955 10:18021142-18021164 TTGTATATGGTGAAAGGGGAGGG + Intronic
1064991852 10:21263377-21263399 TTATGTTAGGGGAAAGGGAAAGG + Intergenic
1065960669 10:30731904-30731926 TTTTGTAAGTGGAAGGGGCATGG - Intergenic
1066142823 10:32525096-32525118 TCAAATAGGGGGATGGGGGAGGG + Intronic
1066546009 10:36501479-36501501 ATATATAAGGGGCAAGGTGATGG - Intergenic
1067837913 10:49652913-49652935 TTAGATAAGGGGGTGGGGAAAGG - Intronic
1068430992 10:56931960-56931982 TTGTACAAGGGGAAGGATGAGGG + Intergenic
1068982488 10:63076240-63076262 TTTTTTGAGGGGGAGGGGGAAGG + Intergenic
1069167989 10:65187678-65187700 TTATATAAGGTGTAAGGGAAGGG + Intergenic
1069543443 10:69312757-69312779 TCAGATAACGGGAAGGGGAAGGG + Intronic
1070543289 10:77432845-77432867 TTACAGAGGGGGAAGGGGCAGGG + Intronic
1070580054 10:77712085-77712107 TTAAAAAAGGGGTGGGGGGATGG + Intergenic
1072093446 10:92152495-92152517 GTTTAAAAGGGGAAGGTGGAAGG - Intronic
1073259021 10:102174671-102174693 TTATCCAATGGGAAGTGGGAAGG - Intergenic
1073616291 10:104999664-104999686 TCATATAAGGGGGAGGCAGAAGG + Intronic
1074311437 10:112326428-112326450 TTACAGAAGGACAAGGGGGATGG - Intergenic
1074398063 10:113116197-113116219 CTACAAAAGGGGAAGGGGAAGGG - Intronic
1074581816 10:114726423-114726445 TGGTATAAGGCAAAGGGGGAAGG + Intergenic
1074925738 10:118068554-118068576 GCAAATAGGGGGAAGGGGGAAGG - Intergenic
1075515905 10:123108040-123108062 TTACATGGCGGGAAGGGGGAGGG - Intergenic
1075540739 10:123311621-123311643 TTAGAGGAGAGGAAGGGGGATGG - Intergenic
1076269021 10:129134231-129134253 TGATAGAAGGGGGAGGGAGAGGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076334485 10:129696315-129696337 TTATATCAGGGGGTGGGGAATGG + Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1078921712 11:15836914-15836936 TTAGATAAGGGGATGAGGGGAGG + Intergenic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082775645 11:57242477-57242499 TTATCTGAGGGAAAGGGGAAGGG + Intergenic
1083784181 11:64934336-64934358 TTATTTATTGGGCAGGGGGAGGG + Exonic
1083871465 11:65490801-65490823 TTTTATGAGGGGCAGGGGGTGGG - Intergenic
1083964482 11:66035029-66035051 TGGCACAAGGGGAAGGGGGAAGG + Intergenic
1084920296 11:72464287-72464309 ATATATGAGGGGAGGGGAGATGG - Intergenic
1085189182 11:74602955-74602977 TTATATAAGGTGATTAGGGAAGG - Intronic
1085922778 11:80978792-80978814 ATATATATGGGCAAGTGGGATGG + Intergenic
1086751937 11:90507250-90507272 TAATATAAGGAGAGTGGGGAGGG + Intergenic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087613891 11:100466706-100466728 TTACATGAGGGGTAGGGAGATGG - Intergenic
1088856583 11:113760673-113760695 TTTTAGAGGGGGGAGGGGGAGGG - Intronic
1089173500 11:116532462-116532484 CTATATCTGGGGATGGGGGAAGG + Intergenic
1089735452 11:120547507-120547529 TCAGATAAGGGGAGGGAGGAAGG + Intronic
1090770647 11:129916749-129916771 TTCTATAAGGTGGAGGGGGTTGG - Intronic
1091413815 12:262831-262853 TTATCTAAGGGGGAAGGAGAAGG + Exonic
1095158023 12:38882205-38882227 ATATATAAGAGGAAGGCAGAGGG + Intronic
1095391728 12:41715144-41715166 TTAAATATGGGGAAAAGGGATGG - Intergenic
1096337386 12:50766647-50766669 TTTTATGGGGGGAGGGGGGAGGG - Intronic
1096781054 12:53992333-53992355 CTATAGAAGGGGAAGGGGAAAGG - Intronic
1097011376 12:55955687-55955709 ATATATAAGGGGATCTGGGAAGG + Intronic
1098035409 12:66296877-66296899 TTGTATTGGGGGAATGGGGAGGG - Intergenic
1098093339 12:66927703-66927725 TTAGAAAAGAGGAAGAGGGAGGG - Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1099068196 12:78010789-78010811 TTATATAATGGGAAGATTGATGG + Intronic
1100144472 12:91660523-91660545 GTAGATGAGGGGAGGGGGGATGG + Intergenic
1100255526 12:92879528-92879550 TCATTCAAAGGGAAGGGGGAGGG + Intronic
1102210361 12:111122440-111122462 ATATAAAACGGGACGGGGGAGGG + Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1102436107 12:112925286-112925308 TTGTATGAGGAAAAGGGGGAGGG - Intronic
1102647199 12:114411393-114411415 TTATTTAAGGAGAAGGGGCATGG + Intergenic
1102753933 12:115321353-115321375 TTATTTTAGGGGAAAGGGAAAGG - Intergenic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1106066440 13:26356320-26356342 TTAAATAATGGCAAGAGGGATGG - Intronic
1106561621 13:30851630-30851652 TTTTTTGGGGGGAAGGGGGAGGG - Intergenic
1108637738 13:52352180-52352202 ATATAAAAGGGGAAGGGGCTGGG + Intergenic
1108916009 13:55612756-55612778 TTATATTAGGGGAAGGTGTGTGG - Intergenic
1110034778 13:70669347-70669369 TGAGACAAGGGGAAGGAGGAAGG - Intergenic
1110427395 13:75383974-75383996 TTATCTCCGAGGAAGGGGGAGGG + Intronic
1110802929 13:79721304-79721326 TCTTATAAGGGGAAGGCAGAAGG + Intergenic
1110932824 13:81244290-81244312 ATATAAAAAAGGAAGGGGGAAGG - Intergenic
1110944550 13:81396310-81396332 TTAGATATGGGCAAGGAGGAGGG + Intergenic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1113749168 13:112766615-112766637 TAAGGGAAGGGGAAGGGGGAGGG + Intronic
1113927013 13:113947258-113947280 TTACTTACGGGGAAGGGGGTTGG + Intergenic
1115724489 14:36198463-36198485 TACTAGAAGGGGAAGGGGAATGG + Intergenic
1116245735 14:42409089-42409111 TTATAATAGTGGAAGGTGGAAGG - Intergenic
1116904181 14:50389168-50389190 TTATAGAAGGGACAGGGGCATGG - Intronic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1117778278 14:59204619-59204641 TTATATGAGGGCAAGGGTAATGG + Intronic
1118019971 14:61701630-61701652 TTTTATAATGGAAAGGGGGAGGG - Intronic
1119146608 14:72320777-72320799 TAATATAAGGATAAGGTGGAAGG + Intronic
1119710289 14:76817259-76817281 TCATCTCAGAGGAAGGGGGAGGG - Intronic
1120717216 14:87852794-87852816 GTATAAAAGGAGAAGGGGCAAGG - Intronic
1120982216 14:90300146-90300168 TTAGGAAAGGGGCAGGGGGAGGG + Intronic
1121587284 14:95070883-95070905 TAATGTCCGGGGAAGGGGGAGGG + Intergenic
1121903062 14:97712063-97712085 TTATATAAGGAGCAGAGTGATGG + Intergenic
1122398434 14:101451633-101451655 TTATAAAAGGGGAAGAGGGTCGG - Intergenic
1122415709 14:101548613-101548635 AGATAGAAGGGGAAGAGGGAAGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1124019941 15:25911166-25911188 TTATAAAAGGGAGAGGGGAATGG + Intergenic
1124183552 15:27500868-27500890 TTATATAAGGGGGAATGGAAAGG + Intronic
1124798955 15:32810771-32810793 TGAAATAAGGGGAAGGGATAAGG + Intronic
1125602027 15:40920705-40920727 TTAGATAAAGAGAAGGGGGTGGG - Intergenic
1125792644 15:42380714-42380736 ATATATATGGGGAAGGTGGGGGG - Intronic
1125824688 15:42666399-42666421 TTACATAGGGAGAAGGGGTAAGG + Intronic
1126182196 15:45796573-45796595 TTATATAAGTGGATAGGAGAAGG - Intergenic
1126484860 15:49169090-49169112 GTATACAGGAGGAAGGGGGAAGG - Intronic
1126554745 15:49973174-49973196 ACAGATCAGGGGAAGGGGGATGG + Intronic
1127094253 15:55497108-55497130 TCTTAATAGGGGAAGGGGGAGGG - Intronic
1127203640 15:56687993-56688015 TTATATAAGGAAAAGAAGGAAGG - Intronic
1127560095 15:60127689-60127711 TAATATGAGGGGTTGGGGGAAGG + Intergenic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128211938 15:65909182-65909204 GTATAGCAGGGGAAGGGGGTAGG + Intronic
1128740981 15:70083538-70083560 TTATCTGAGGGGAGGGAGGAGGG - Intronic
1128741744 15:70088723-70088745 TTAAATATGGGGGAGGGGGCGGG + Intronic
1128930177 15:71697268-71697290 TGATGTAATGGAAAGGGGGATGG + Intronic
1129919168 15:79304983-79305005 TTATATAAAGGTAGAGGGGAGGG + Intergenic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1130977870 15:88791041-88791063 GTATATAATGGGAATGGGTAGGG - Intergenic
1131464639 15:92645622-92645644 TTATATAAGGGGCCAGGGAAGGG + Intronic
1133000229 16:2846990-2847012 TTATGTTAGGGGAAGGAGGAGGG - Intergenic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1133712587 16:8415671-8415693 ACATATAAGAGGAAGAGGGAGGG - Intergenic
1133928957 16:10216653-10216675 TAGAAGAAGGGGAAGGGGGAGGG + Intergenic
1135956553 16:26960940-26960962 TTATCTGAGGAAAAGGGGGAAGG - Intergenic
1137403976 16:48175878-48175900 TGATATATGGGGGCGGGGGAGGG - Intronic
1139308750 16:66010577-66010599 TTATCTAGGAGGAAGGTGGAGGG - Intergenic
1140775744 16:78247615-78247637 TTTTATAAGGGGCAGGGGGCAGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1142333629 16:89472366-89472388 TTTACTAAGGGGAAGGGGAAGGG + Intronic
1143545282 17:7591715-7591737 TTATCTAGGGGGGAGGGGGGTGG - Exonic
1143911437 17:10253150-10253172 TTACACAGGGGGATGGGGGATGG + Intergenic
1144342494 17:14321483-14321505 TTATTTAAAGGGAAGAAGGAGGG + Intronic
1144721153 17:17470726-17470748 TTAAAGAAGGGAAAGGAGGAGGG + Intergenic
1148217276 17:45840046-45840068 TCATCACAGGGGAAGGGGGAGGG + Intergenic
1149453725 17:56770477-56770499 ATAGATGAGTGGAAGGGGGATGG - Intergenic
1150015538 17:61553092-61553114 TTTTATAAAGGGAAGGGAAAGGG - Intergenic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152513392 17:80805429-80805451 TAAAATAAGGGGAAGCAGGACGG - Intronic
1153348752 18:4056132-4056154 TTATCTATGGGGAAGGGGGCAGG + Intronic
1153655781 18:7280887-7280909 GGATATATGGGGAAGGGAGAAGG + Intergenic
1155509151 18:26559779-26559801 TTAGATCAGTGGAAGGGAGAGGG - Intronic
1155516506 18:26628739-26628761 TTATTTTTGGGGAAGGGGTATGG + Intronic
1156372253 18:36482091-36482113 TAAGATAAGAGGAAGAGGGAAGG + Intronic
1157894869 18:51456482-51456504 TTGTTTAAGGGGACGGGTGAGGG + Intergenic
1157899242 18:51498098-51498120 TTCTCCAAGGGGAAGGGAGAAGG + Intergenic
1158123519 18:54077171-54077193 TTAGAGACAGGGAAGGGGGAAGG - Intergenic
1158178509 18:54685464-54685486 TGATAAAAGGGAAAGGGGGCCGG + Intergenic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1162784601 19:13026514-13026536 TTATAAAAAGGGAAAGGGTAAGG - Intronic
1162993360 19:14317749-14317771 TAAGATTTGGGGAAGGGGGATGG + Intergenic
1163117659 19:15197967-15197989 TAATAGAAGGGGAAGGGGCAGGG + Intronic
1163627992 19:18401919-18401941 TTTTATAAGGAGCAGAGGGATGG + Intergenic
1166385617 19:42378909-42378931 TCTTAAAGGGGGAAGGGGGAAGG + Intergenic
1168350285 19:55671603-55671625 TTAGAAAAGGGGCATGGGGAAGG + Intronic
1168442100 19:56378212-56378234 TTACATTAGGGGGAGGGGGGAGG - Intronic
926225637 2:10965064-10965086 TTAGAAAAGGGGAGGGGGGTAGG + Intergenic
927230166 2:20814865-20814887 TAATAAAAGGGAAATGGGGAAGG - Intronic
927694763 2:25232234-25232256 TTTTATAATGGGAGGGGGGATGG - Exonic
928708152 2:33974394-33974416 TTATATTGGTGGAGGGGGGAGGG - Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
934473551 2:94577411-94577433 TTACAGTAGGGGGAGGGGGACGG + Intergenic
936767318 2:115868594-115868616 ATATTTCAGGGGCAGGGGGAGGG + Intergenic
937216696 2:120317669-120317691 ATATATGAGGGGAAGGGGGCAGG - Intergenic
937478422 2:122235876-122235898 TCATATAAGGGGATGGGGTACGG + Intergenic
937994898 2:127685828-127685850 TTATACATGGGGGAGGGAGATGG + Intergenic
938574335 2:132589872-132589894 TTTTATTAAGGGAAGGGGGAAGG + Intronic
938669136 2:133570536-133570558 AAATATAAGGGGAAAGGGGTGGG - Intergenic
939569559 2:143824593-143824615 TTATAAATGAGCAAGGGGGAAGG + Intergenic
939617405 2:144376843-144376865 TTTTGTAGGGGGAAGGGAGAAGG + Intergenic
939663893 2:144925976-144925998 TAAGATAAGGGGATGGGGGTTGG - Intergenic
941943072 2:171064224-171064246 TTATTAAAGGGGAAGGAGAAGGG + Intronic
942379271 2:175371389-175371411 TTAGATAAGGAGATGAGGGAGGG - Intergenic
942814431 2:180034736-180034758 TGCTATCAGGGGATGGGGGAGGG + Intergenic
942920266 2:181364722-181364744 TAATATACGTGGAAGGTGGAAGG + Intergenic
945250874 2:207765889-207765911 TGATAAAGGGGGAGGGGGGAGGG + Exonic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946370801 2:219280182-219280204 AAATCTAGGGGGAAGGGGGAGGG - Intronic
946592138 2:221262462-221262484 TTGCATAAGGGGAAGGATGAAGG - Intergenic
948155306 2:235776719-235776741 GTGTGCAAGGGGAAGGGGGAGGG - Intronic
948711458 2:239828071-239828093 TCATATGAGGTGAAGGGAGAGGG + Intergenic
948862213 2:240758146-240758168 TTATTTCAGGGGACGTGGGATGG - Intronic
1168815263 20:732441-732463 TGATAGATGAGGAAGGGGGAAGG - Intergenic
1169258441 20:4117551-4117573 TGGCAGAAGGGGAAGGGGGAGGG + Intergenic
1170604118 20:17863247-17863269 TTGTATAAGAGCAAGTGGGATGG - Intergenic
1173690998 20:44960752-44960774 TTAAATAAGGGGATGAAGGAAGG + Intergenic
1173728658 20:45313787-45313809 TGATATATGGGGAAAGGGCATGG - Intronic
1174152370 20:48494414-48494436 TTAAATAGGGCCAAGGGGGAGGG - Intergenic
1174631549 20:51962653-51962675 TAATAATAGGGGATGGGGGATGG + Intergenic
1174969231 20:55255192-55255214 TTACATTAAGGGAAGGGGGAGGG - Intergenic
1175096934 20:56548676-56548698 GTAAAGAAGGGGAAGGAGGATGG - Intergenic
1175310896 20:58010994-58011016 TTACATCAGGGGCAGGGGGCTGG + Intergenic
1175661431 20:60816323-60816345 TAATAAAAGGAGAAGGGGAAGGG - Intergenic
1175866949 20:62183753-62183775 TTATAAAAGGGGGACGGGAAAGG + Intronic
1176017429 20:62942497-62942519 TTATGTCAGGGGCAGGGGAAGGG + Intronic
1176065039 20:63190099-63190121 AAATATAAGGGGGAGGGGGAAGG + Intergenic
1177419011 21:20831344-20831366 TTCTGTAAGGGATAGGGGGAAGG - Intergenic
1178359960 21:31940955-31940977 TTATATGAGGGGAAAAGAGAAGG + Intronic
1178681577 21:34676601-34676623 TGGTATGAAGGGAAGGGGGATGG + Intronic
1179481997 21:41684444-41684466 TGATATGAGGGGAGGGAGGAGGG + Intergenic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1183945793 22:41325060-41325082 TTACATGAGGGGAAGGAGGGAGG - Intronic
1185219082 22:49620102-49620124 TTATGTTAAGGGCAGGGGGACGG - Intronic
949388637 3:3534921-3534943 TTATTTAAGGAGAATGAGGAAGG - Intergenic
949507872 3:4743732-4743754 TTGTTGAGGGGGAAGGGGGAGGG + Intronic
950138503 3:10599794-10599816 TTCTATAAGGGGGTGGGGGGTGG + Intronic
951114632 3:18845583-18845605 TAATATAAAGGAAAGGAGGAAGG - Intergenic
952284434 3:31954578-31954600 CTATATTGGGGGCAGGGGGAAGG + Intronic
952285380 3:31963262-31963284 TTATATAAGGAGAAGGGGATGGG - Intronic
952875629 3:37941977-37941999 TTAAGTAAGGGGATTGGGGAGGG + Intronic
953419371 3:42742605-42742627 TTGTAAAAGGGAGAGGGGGAGGG - Intronic
953503060 3:43456667-43456689 TTAAATAAGTGAAAGGTGGAAGG + Intronic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
953894913 3:46789763-46789785 TAATAAAAGGGGAAAGTGGATGG + Intronic
954489938 3:50893973-50893995 TTAGGTGAGGGGAGGGGGGAGGG + Intronic
954735304 3:52702691-52702713 TTAGATATGGGGTTGGGGGATGG - Intronic
954971712 3:54656799-54656821 TTCTAACTGGGGAAGGGGGAAGG - Intronic
957040171 3:75330243-75330265 TAATAAAAGGGGAAGGAGAAAGG + Intergenic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957311104 3:78520051-78520073 TTATATGATGGGAAAGGTGAGGG + Intergenic
957374638 3:79340155-79340177 TTATATAAGGTGATGGGGAAAGG - Intronic
957841157 3:85671598-85671620 TTAGAGAAGGGGAAGGAGAAGGG - Intronic
957875028 3:86133437-86133459 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
960360270 3:116702646-116702668 TGAAATAAAGGGAAAGGGGAAGG + Intronic
961067168 3:123885004-123885026 TTAAAAAAGGGGAAAGGGGAGGG + Intergenic
963199825 3:142574838-142574860 TGAAATAAGGGTAAGAGGGAGGG + Intronic
963962055 3:151320655-151320677 TTGATTAAAGGGAAGGGGGATGG + Intronic
963982328 3:151552492-151552514 TTATGTTAGGGGAAGAGGGAGGG + Intergenic
964204852 3:154162297-154162319 TGATTTAAGTGGAAGGGAGATGG + Intronic
964306189 3:155342827-155342849 TTATATAAGGTGAGGAGTGAGGG + Intergenic
964814663 3:160703991-160704013 TAAAATAAGGGGCAGGGGAAGGG - Intergenic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
966185220 3:177221062-177221084 GTCTAGAAGAGGAAGGGGGAAGG - Intergenic
966674246 3:182568177-182568199 TTAAATAATGGGATGCGGGAGGG + Intergenic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
968846093 4:3042260-3042282 TTGTACGAGGGGAAGGGGAAGGG + Intergenic
969840473 4:9877989-9878011 TTCTATAGGAGGAAGGGGGCTGG - Intronic
971077130 4:23163070-23163092 TTATATAAGGGAAGGGTGGAAGG - Intergenic
971670628 4:29551531-29551553 TTATATAATGGAAGGGGTGAGGG - Intergenic
972138135 4:35918805-35918827 TTATATAAGGGGTGATGGGAGGG + Intergenic
972455607 4:39251329-39251351 TTGTATAAGGTGTAAGGGGAAGG - Intronic
973264486 4:48197953-48197975 ATATATAAGGGGTAGGGTGTGGG - Intronic
973602672 4:52557665-52557687 TGATATAAGGGGAAGTTGGCTGG - Intergenic
975144968 4:70956996-70957018 TTATCTTAGGGAAAGAGGGAGGG + Intronic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975991271 4:80262487-80262509 TTTTATAAGGGGGAGGCAGAGGG + Intergenic
976177068 4:82365446-82365468 TTACCTAAGGGGAAGGGAGGAGG + Intronic
976571541 4:86617566-86617588 TGCTGGAAGGGGAAGGGGGAGGG - Intronic
979379741 4:119994970-119994992 GGAAATAAGGGGAAGGGGCACGG - Intergenic
979438992 4:120728666-120728688 GTATGTAAGGGGCAGGGGGCGGG - Intronic
979517203 4:121623362-121623384 TGTTATCAGGGGCAGGGGGAGGG - Intergenic
979737922 4:124111621-124111643 TCCTATATGAGGAAGGGGGAAGG - Intergenic
979781555 4:124657593-124657615 TTAAATAAGAGCAATGGGGATGG - Intergenic
982269572 4:153572674-153572696 ATATATATAGGGAAAGGGGAAGG - Intronic
982335260 4:154229406-154229428 TTTTGTAAGGGGAATTGGGATGG + Intergenic
984310383 4:178051003-178051025 TGGTGTAAGGGGATGGGGGAGGG - Intergenic
985205141 4:187527378-187527400 TAATAGAGGGGGAAGGGAGAGGG + Intergenic
985588532 5:753127-753149 TGATAAGAGAGGAAGGGGGACGG - Intronic
985603199 5:845566-845588 TGATAAGAGAGGAAGGGGGACGG - Intronic
986921973 5:12696058-12696080 TTAAATAATGGGAAGGTGAAAGG + Intergenic
988437085 5:31189293-31189315 TTCTATAATTGGAAGGGGGTTGG + Intergenic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
990196395 5:53321602-53321624 TTATTTAAGGGGAAAGGTGTGGG - Intergenic
990699500 5:58460110-58460132 TTATATACGGGGAGGCGGGAAGG + Exonic
990709639 5:58565760-58565782 TTATAAAAGGGTAAGGAGGCTGG + Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991264548 5:64701528-64701550 TTTTAGAAGGGGCTGGGGGAAGG + Intronic
992247959 5:74847110-74847132 TTATAAAAGGGGAGCAGGGATGG - Intronic
992418707 5:76579528-76579550 TTATTTCAGGGTAATGGGGAAGG - Intronic
992757984 5:79926898-79926920 TTTTTTAAGGGGGAGGGGTAGGG - Intergenic
993511190 5:88773375-88773397 TTATGTACGAGGATGGGGGATGG - Intronic
995157256 5:108930435-108930457 TAAGAAAAGGGGAAGGGGGGAGG - Intronic
995676283 5:114665805-114665827 TTATATCAGGTGAACAGGGAAGG - Intergenic
996261623 5:121477820-121477842 TTATACAAGAGGAAGAAGGAAGG - Intergenic
996394448 5:122999045-122999067 TTAGAAGAGGGGGAGGGGGAGGG + Intronic
996665117 5:126050007-126050029 TTATATATGAGCAAGGGGAAAGG - Intergenic
996749652 5:126875718-126875740 TTCTATAAAGGGCAGGGGGAGGG + Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997777582 5:136624854-136624876 TTACACAGGGGGAAGGGAGAAGG + Intergenic
997893427 5:137695066-137695088 TTGGAAGAGGGGAAGGGGGAAGG - Intronic
998014966 5:138724746-138724768 TTCTATAATGGGAGGTGGGAGGG - Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998353478 5:141515876-141515898 TTATGGAGGGGAAAGGGGGAAGG + Exonic
998669691 5:144340006-144340028 TTAAATAAGGGGGAAAGGGAGGG + Intronic
999154130 5:149446032-149446054 TGATTTAAGGGGAGGGGGAATGG + Intergenic
999553111 5:152711560-152711582 TTAAAAAAGGGGGAGTGGGAGGG + Intergenic
999966556 5:156816461-156816483 TTTTATAAGAGGAAGGCGGTTGG + Intergenic
999990458 5:157045415-157045437 TTATATAATGGGAAGAGGAGTGG + Intronic
1000440621 5:161259021-161259043 GGAGAAAAGGGGAAGGGGGACGG - Intergenic
1000960701 5:167597470-167597492 TTACATATGGGGATGGGGCATGG - Intronic
1002059795 5:176619624-176619646 TTGTCTAAGGGGAAGGGAAATGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1003667638 6:8126628-8126650 TCCAAAAAGGGGAAGGGGGAGGG + Intergenic
1004274409 6:14222699-14222721 TTATGGAAGGGGCAGGGAGATGG + Intergenic
1004497018 6:16174305-16174327 TCAAAAAAGGGGAGGGGGGAGGG - Intergenic
1004982767 6:21045005-21045027 TTATAAAAGGGCAAGGCTGAAGG - Intronic
1005229258 6:23681342-23681364 TTATAGAAGAGGAAGGGGGATGG - Intergenic
1007872780 6:45060417-45060439 TTATATAAGGTGTAAGGGAAGGG - Intronic
1008046172 6:46853776-46853798 TCACACAAGGGGGAGGGGGAGGG + Exonic
1008726656 6:54429751-54429773 TTAGATAAGGGGAAAAGAGAAGG - Intergenic
1010507566 6:76679034-76679056 TTCTGTAGGGGGAGGGGGGAAGG + Intergenic
1011002479 6:82606620-82606642 TTGTTTGAGGGGAAGTGGGATGG + Intergenic
1011491595 6:87898904-87898926 TTTTTTAGGGGGGAGGGGGACGG + Intergenic
1011964069 6:93130603-93130625 ATATATATAGGGAGGGGGGAGGG + Intergenic
1013282062 6:108647717-108647739 TTATCCAAGAGGAAAGGGGAGGG + Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013653012 6:112215219-112215241 TTATTTAAGAAGATGGGGGAAGG + Intronic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1015575348 6:134665427-134665449 TGTTAGAAGGGGGAGGGGGAAGG + Intergenic
1015799585 6:137046599-137046621 CTTTATAATGGGAGGGGGGAAGG + Intergenic
1018438486 6:163785621-163785643 ATATAGAAGGGGAAAGGGCATGG + Intergenic
1018697733 6:166403790-166403812 TGATATGATGGGAAGGGGGCTGG + Intergenic
1019817438 7:3211457-3211479 TATTACAAGGGGGAGGGGGATGG + Intergenic
1019870292 7:3754668-3754690 CTAAGTAAGGGGAAGGGGGGTGG + Intronic
1020508315 7:9020452-9020474 TTGTAAAAGGGAAAGGGGGGAGG + Intergenic
1022873885 7:34507904-34507926 GTAGAGAAGGGGAAAGGGGAGGG - Intergenic
1022959997 7:35417520-35417542 TTGTATTAGGGGATGAGGGAAGG + Intergenic
1024135165 7:46399457-46399479 TAATAATAGGGGAAGGGGAAGGG + Intergenic
1026482618 7:70791102-70791124 TTTTACAAGGGGAAGGGGTGGGG - Exonic
1027168217 7:75851325-75851347 TAATTTAAGGGGGGGGGGGAGGG - Intronic
1027511440 7:79086854-79086876 CTAGATAAGGGGAAGGGTGTGGG + Intronic
1028112450 7:86958242-86958264 TTTTATAAAGGGAGGGGGAAAGG + Intronic
1028642127 7:93054247-93054269 TTATTTATGGGGTGGGGGGAGGG - Intergenic
1030606734 7:111645669-111645691 TTTTCTTAGGGGAAGGGAGATGG + Intergenic
1030872378 7:114773168-114773190 CTATATGAGGGGTTGGGGGAGGG - Intergenic
1030934649 7:115570455-115570477 TTTTAAAAAGGGGAGGGGGATGG - Intergenic
1031720011 7:125162690-125162712 TTAAAAAGGGGGGAGGGGGAGGG + Intergenic
1033027459 7:137789435-137789457 TTATATTAGGGGAAGGGCTGAGG - Intronic
1033144071 7:138855971-138855993 TAATTTAATGGGAAGGAGGAGGG - Intronic
1033646484 7:143308782-143308804 TTATTCAAGGGCAAGGGGGTTGG - Intergenic
1033840366 7:145366128-145366150 TAAGATACGGGGAGGGGGGAGGG + Intergenic
1035235677 7:157496408-157496430 TTCCAACAGGGGAAGGGGGAAGG + Intergenic
1035855988 8:2976984-2977006 TTAAATCAGGGGAAGGGATATGG - Intronic
1037104428 8:15088683-15088705 TTATATAAGTGCAGGGGGAAAGG - Intronic
1037175978 8:15946227-15946249 TTATATATAGGAAAGAGGGAAGG - Intergenic
1038499346 8:28030502-28030524 TCATATAAGGTGGAGGTGGAGGG - Intronic
1038596163 8:28888703-28888725 TTATATAAGGGGAAGGATGCGGG - Intronic
1039125766 8:34199909-34199931 TCACATAAGGGGAAAGAGGAAGG - Intergenic
1039641854 8:39231788-39231810 TAATATAGGTGGAAGGGAGATGG - Intronic
1043196986 8:77307667-77307689 TAATATAAGGTGAAGGGAGGTGG + Intergenic
1044878997 8:96702766-96702788 TTACAGAAGGAGAAAGGGGAGGG - Intronic
1046424800 8:114032676-114032698 TTATTTGGGGGGAATGGGGATGG - Intergenic
1046860573 8:119086693-119086715 TTATAGAAGGGGAAGAAGGAAGG + Intronic
1046871642 8:119210403-119210425 AGATATAATGGGGAGGGGGAGGG - Intronic
1048654521 8:136521211-136521233 TTTTAAAAGGGGCAGGGGGCAGG - Intergenic
1048884207 8:138896339-138896361 TTTTAAAAGGGGAAGGGTAAAGG + Intronic
1049093182 8:140532326-140532348 TTCTGGAAGGGGAAGGGGCAGGG - Intronic
1049359557 8:142205810-142205832 GGATGTGAGGGGAAGGGGGAAGG + Intergenic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051327046 9:15983171-15983193 GTATTTAAGAGGAAAGGGGAAGG - Intronic
1051887444 9:21908905-21908927 CTATAAATGGGGAAGGGGAAGGG - Intronic
1051895103 9:21978116-21978138 TTATGTAGGGGGGAGGGGGGAGG + Intronic
1052904627 9:33822805-33822827 TTTTTTAGGGGGAAGAGGGAAGG - Intronic
1053651215 9:40171525-40171547 TCACACAAGGGGGAGGGGGAGGG - Intergenic
1053901607 9:42800879-42800901 TCACACAAGGGGGAGGGGGAGGG - Intergenic
1054533365 9:66204678-66204700 TCACACAAGGGGGAGGGGGAGGG + Intergenic
1055030927 9:71770545-71770567 TTTTATAAGGGGAAAGGGGGTGG + Intronic
1055725751 9:79226394-79226416 TTTTAAAAGGAGAAGGAGGAAGG - Intergenic
1055758001 9:79574725-79574747 TTATGGAAAGGGAAGGGGAAAGG - Intronic
1055792053 9:79933048-79933070 AAATATAAGGGGAAGGGTTAAGG - Intergenic
1056471379 9:86907311-86907333 TGATATAAGGAGGAGGTGGAGGG + Intergenic
1057931919 9:99201098-99201120 GGATATAAGGGGCAGGGTGAGGG - Intergenic
1058566840 9:106294846-106294868 CTATATTAAAGGAAGGGGGAGGG + Intergenic
1058767083 9:108192081-108192103 TTATACAAGGGGAAAGTGGCTGG + Intergenic
1060681845 9:125573090-125573112 TTATAAAAGGGGGGGGGGGGGGG + Intronic
1062194977 9:135267951-135267973 TTATTTCAGGGGGAGGGGGCGGG - Intergenic
1188347067 X:29080087-29080109 TTATATAAAGTAAAGGGGGCTGG + Intronic
1188402709 X:29766630-29766652 ATATATAATGAGAAAGGGGATGG - Intronic
1188534470 X:31181265-31181287 TCACATATGGGGAAGTGGGAAGG + Intronic
1188553681 X:31387850-31387872 TTATATAAGGTGATCAGGGAAGG - Intronic
1189323517 X:40099434-40099456 TTTTATACTGGGAAGGGGGTGGG + Intronic
1189379933 X:40495506-40495528 TTATTAAAGGGGAAGGGAAACGG - Intergenic
1189683679 X:43542148-43542170 TTATATGAGGGAGAGGGGTAGGG - Intergenic
1190712219 X:53079194-53079216 ATAAAGAAGGGAAAGGGGGATGG - Exonic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1191646390 X:63486102-63486124 TGAGAGAAGGGGGAGGGGGAGGG + Intergenic
1192432107 X:71119320-71119342 TTTCCTTAGGGGAAGGGGGAAGG - Intronic
1193794389 X:85855386-85855408 TTAACTAAGGGGAAGAGAGAGGG + Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195521151 X:105830829-105830851 TTGTGTAGGGGGAGGGGGGAGGG + Intronic
1196535278 X:116837059-116837081 TAAAATAGGGGGAGGGGGGAGGG - Intergenic
1197193040 X:123670236-123670258 GTATATAGGGGGAATGAGGATGG - Intronic
1197450456 X:126608018-126608040 TTTCATTAGGGGAAGGGGTATGG + Intergenic
1197646957 X:129028095-129028117 TTGAATAAAGGGAAGGGAGAGGG - Intergenic
1197845818 X:130801260-130801282 TTATGGTGGGGGAAGGGGGAAGG + Intronic
1198496193 X:137196040-137196062 TTATAAAAGGGTGAGGGGGCTGG + Intergenic
1199059895 X:143342865-143342887 TGATATATGGGGAAGAGGGGTGG - Intergenic
1199300534 X:146208297-146208319 TAATATAATGGAAAAGGGGATGG + Intergenic
1199732204 X:150646264-150646286 GTATATACGGGTATGGGGGAGGG - Intronic
1200176513 X:154120932-154120954 TTTTTTAGGGGGAGGGGGGAAGG + Intergenic
1200397738 X:156001119-156001141 TTCTAGACAGGGAAGGGGGATGG - Intronic
1200847427 Y:7845315-7845337 TGGGATGAGGGGAAGGGGGAGGG + Intergenic
1201481156 Y:14440949-14440971 TTAAATATGGGGAAGCGGGCAGG - Intergenic