ID: 1002357360

View in Genome Browser
Species Human (GRCh38)
Location 5:178641621-178641643
Sequence CCTGATGATCAGGAGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002357360_1002357368 -4 Left 1002357360 5:178641621-178641643 CCGGCCTCCTCCTGATCATCAGG No data
Right 1002357368 5:178641640-178641662 CAGGGTTAGTCACCTCTGGCGGG No data
1002357360_1002357367 -5 Left 1002357360 5:178641621-178641643 CCGGCCTCCTCCTGATCATCAGG No data
Right 1002357367 5:178641639-178641661 TCAGGGTTAGTCACCTCTGGCGG No data
1002357360_1002357366 -8 Left 1002357360 5:178641621-178641643 CCGGCCTCCTCCTGATCATCAGG No data
Right 1002357366 5:178641636-178641658 TCATCAGGGTTAGTCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002357360 Original CRISPR CCTGATGATCAGGAGGAGGC CGG (reversed) Intergenic
No off target data available for this crispr