ID: 1002359377

View in Genome Browser
Species Human (GRCh38)
Location 5:178658588-178658610
Sequence CTGTGTGCACACAGGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002359366_1002359377 25 Left 1002359366 5:178658540-178658562 CCTGGTGAGGGAGGGAAGCTCTA No data
Right 1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG No data
1002359370_1002359377 -3 Left 1002359370 5:178658568-178658590 CCCATGTCTTCCTCCTGGTCCTG No data
Right 1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG No data
1002359371_1002359377 -4 Left 1002359371 5:178658569-178658591 CCATGTCTTCCTCCTGGTCCTGT No data
Right 1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002359377 Original CRISPR CTGTGTGCACACAGGGAAGA TGG Intergenic
No off target data available for this crispr