ID: 1002361447

View in Genome Browser
Species Human (GRCh38)
Location 5:178674617-178674639
Sequence AATGAAGCTAAGACAGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002361447_1002361448 23 Left 1002361447 5:178674617-178674639 CCAAGCTCTGTCTTAGCTTCATT No data
Right 1002361448 5:178674663-178674685 GTGATTTCTTCTTTGACTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002361447 Original CRISPR AATGAAGCTAAGACAGAGCT TGG (reversed) Intergenic
No off target data available for this crispr