ID: 1002369234

View in Genome Browser
Species Human (GRCh38)
Location 5:178737607-178737629
Sequence CTTGCTGTGCAGGAGGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002369234_1002369237 -8 Left 1002369234 5:178737607-178737629 CCTTAAACCTCCTGCACAGCAAG No data
Right 1002369237 5:178737622-178737644 ACAGCAAGCTGACCAACCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002369234 Original CRISPR CTTGCTGTGCAGGAGGTTTA AGG (reversed) Intergenic
No off target data available for this crispr