ID: 1002375672

View in Genome Browser
Species Human (GRCh38)
Location 5:178787424-178787446
Sequence GTTTTATCTTGGGGGACCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002375666_1002375672 2 Left 1002375666 5:178787399-178787421 CCCATCATTTTCGCAGCTGCAGT No data
Right 1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG No data
1002375667_1002375672 1 Left 1002375667 5:178787400-178787422 CCATCATTTTCGCAGCTGCAGTG No data
Right 1002375672 5:178787424-178787446 GTTTTATCTTGGGGGACCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002375672 Original CRISPR GTTTTATCTTGGGGGACCAA AGG Intergenic
No off target data available for this crispr