ID: 1002384986

View in Genome Browser
Species Human (GRCh38)
Location 5:178860031-178860053
Sequence CGCCCAGACGTCGGAGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002384980_1002384986 4 Left 1002384980 5:178860004-178860026 CCCGGTGAGCGGCGCCGGGCTTG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1002384983_1002384986 -10 Left 1002384983 5:178860018-178860040 CCGGGCTTGAGGTCGCCCAGACG 0: 1
1: 1
2: 0
3: 4
4: 68
Right 1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1002384975_1002384986 30 Left 1002384975 5:178859978-178860000 CCAGGCGCTCTGCGGAGCTTTCG 0: 1
1: 0
2: 0
3: 1
4: 51
Right 1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG 0: 1
1: 0
2: 0
3: 5
4: 105
1002384981_1002384986 3 Left 1002384981 5:178860005-178860027 CCGGTGAGCGGCGCCGGGCTTGA 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG 0: 1
1: 0
2: 0
3: 5
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002384986 Original CRISPR CGCCCAGACGTCGGAGGAGC CGG Exonic
900224672 1:1527345-1527367 CGCCCACACGTGCCAGGAGCAGG - Intronic
900490978 1:2949026-2949048 CGGCCAGACGTCAGGGGAGCCGG + Intergenic
903867947 1:26411966-26411988 CATTCAGACGTTGGAGGAGCTGG - Intronic
904532976 1:31181484-31181506 AGCCCGGACTTCGGAGGAGTGGG - Exonic
915762023 1:158323860-158323882 GGCTCAGATGTGGGAGGAGCTGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
918070172 1:181128740-181128762 CGCCCAGCTGGCAGAGGAGCAGG - Intergenic
921179338 1:212619351-212619373 CCCCCAGGAGTCGGAGAAGCTGG + Exonic
921189779 1:212699423-212699445 CCCCCAGAGGGCGCAGGAGCTGG + Intronic
922543056 1:226433583-226433605 CTCCCAGAAGCCGGAGGAGAAGG - Intergenic
922925172 1:229342280-229342302 CGCCGAGTCCTCCGAGGAGCCGG + Exonic
1076809375 10:132878743-132878765 CGCCCAGCCGTGGGCAGAGCAGG - Intronic
1077029732 11:459642-459664 AGCCCAGACGTGGGAGGAGGAGG - Intronic
1077196542 11:1283818-1283840 GGCCCAGAAGTTGGAGGAGACGG + Intronic
1080779904 11:35419935-35419957 CCCCCAGACGTGGGAGGATGGGG - Intronic
1083213884 11:61206574-61206596 CACCCACAGGTTGGAGGAGCCGG - Exonic
1083216768 11:61225403-61225425 CACCCACAGGTTGGAGGAGCCGG - Exonic
1083219650 11:61244229-61244251 CACCCACAGGTTGGAGGAGCCGG - Exonic
1083314935 11:61808823-61808845 AGACCAGACCACGGAGGAGCAGG - Intronic
1083821594 11:65174532-65174554 CTCCCTGACGCCAGAGGAGCTGG - Intergenic
1084187987 11:67485223-67485245 CCCCCAGAGGTCTGAGCAGCGGG - Intronic
1084770805 11:71341803-71341825 CCCCCATAGGTGGGAGGAGCTGG + Intergenic
1089432568 11:118436297-118436319 CGCCCAGGCGTCAGAGGCGGAGG + Intergenic
1089738287 11:120564537-120564559 CGCCCGGACCTCGGAGGGGATGG - Intronic
1092221381 12:6716115-6716137 CGCCCTGCACTCGGAGGAGCCGG + Intergenic
1097980102 12:65729390-65729412 CGCCCAGACCTCGGGGGCGAAGG + Intergenic
1099202467 12:79691336-79691358 CGCCCCGGAGTCGGAGGCGCCGG - Intergenic
1102788508 12:115623943-115623965 GGCCCAGGCGTCAGAGGAGATGG - Intergenic
1103479306 12:121240929-121240951 GGCCCAGATGTGGGAGCAGCTGG - Intronic
1112051190 13:95644696-95644718 CGCCCAGTTGCCAGAGGAGCCGG - Intronic
1114458314 14:22871747-22871769 CGCCCAGGGGTTGGAGTAGCCGG - Exonic
1117344077 14:54815676-54815698 AGCCCAGACCTGGGAGGAGTAGG - Intergenic
1121820536 14:96962265-96962287 AACCCAGACCTCTGAGGAGCGGG + Intergenic
1128455272 15:67828238-67828260 CGCGCAGGCGTGGGAGCAGCAGG + Intronic
1128676851 15:69615968-69615990 GGGCCAGACCTAGGAGGAGCTGG + Intergenic
1131342018 15:91611422-91611444 GTCCCAGACGTGGGAGGAGGGGG + Intergenic
1134625201 16:15718374-15718396 CGCCCAGCTGGAGGAGGAGCTGG - Exonic
1139699017 16:68695791-68695813 CCTCCAGACCTCGGTGGAGCTGG - Exonic
1140481739 16:75265940-75265962 CGCTCAGGAGCCGGAGGAGCCGG - Exonic
1141352502 16:83311080-83311102 AACCGAGACGTCAGAGGAGCAGG - Intronic
1142377125 16:89711929-89711951 CGCCCTGACCCCGGAGGAACGGG - Exonic
1142393252 16:89816345-89816367 CGCCCAGGCGCAGGAGGGGCCGG + Intronic
1145986977 17:29053556-29053578 TGCCCAGGGGACGGAGGAGCTGG - Exonic
1147150342 17:38510475-38510497 CGCCCAGACGGCGAGGGCGCGGG + Exonic
1147647024 17:42040133-42040155 CCCGCAGGCGCCGGAGGAGCTGG - Intronic
1154075940 18:11201828-11201850 CTCCCAGACTTCTGAGTAGCTGG + Intergenic
1156454292 18:37284383-37284405 CTCCCAGAGGTCAGAGGAGAGGG - Intronic
1160802652 19:977427-977449 CGCACAGAGGGCGGAGGAGCGGG - Intergenic
1160860345 19:1234927-1234949 CGCCGGGACGGGGGAGGAGCTGG - Intronic
1167725575 19:51210882-51210904 CGCCCAGAGATGGGAGGAGATGG - Intergenic
1167727243 19:51224892-51224914 CGCCCAGAGATGGGAGGAGATGG - Intergenic
1167860311 19:52277771-52277793 CACCCAGACGTGGGTGGAGACGG + Intronic
928022574 2:27715900-27715922 AGCCCAGGTGTCGGGGGAGCGGG - Intergenic
928336680 2:30404421-30404443 AGCCCTGATGTGGGAGGAGCTGG - Intergenic
934765458 2:96877851-96877873 CCCCCAGACCTGGGAGGGGCGGG - Intronic
948513309 2:238487654-238487676 CCCTCAGACGTCGGAGCTGCTGG + Intergenic
1173704257 20:45098510-45098532 GGCCGCGGCGTCGGAGGAGCAGG - Exonic
1175826023 20:61936978-61937000 TGCTCGGACGCCGGAGGAGCAGG + Exonic
1176083802 20:63286784-63286806 TGCCCCCACGTAGGAGGAGCTGG + Intronic
1176159795 20:63642284-63642306 CGCACAGACGCAGGAGGCGCAGG - Exonic
1176287144 21:5024163-5024185 CTCCCAGACCTTGGAGGTGCAGG + Intronic
1179870037 21:44239312-44239334 CTCCCAGACCTTGGAGGTGCAGG - Intronic
1180960110 22:19758696-19758718 CGCAGGGAGGTCGGAGGAGCGGG + Intronic
1181583793 22:23842134-23842156 CGCCCAGGCGTCAGAGGCCCTGG - Intergenic
1183184792 22:36285717-36285739 CGCCCAGCTGGAGGAGGAGCTGG - Exonic
1184426548 22:44412195-44412217 TGCCCAGAGGTCAGAGGAGGCGG - Intergenic
1185326284 22:50227354-50227376 CCCCCAGAAGTGGGAGGATCAGG - Intronic
953663176 3:44905797-44905819 CCCCCAGAGGTGGGAGGAGCAGG + Intronic
956468727 3:69542897-69542919 CGCCCAGAGCTTGGAGGAGTCGG - Intergenic
964052813 3:152417555-152417577 CTCCCAAACCTTGGAGGAGCAGG + Intronic
968541664 4:1171286-1171308 CGGGCAGACGTCGGCGGAGCTGG - Exonic
969732346 4:8964478-8964500 CGCCCAGACGCCGGGCCAGCCGG - Intergenic
973754918 4:54064830-54064852 CACCCAGAAGTCGGCGGAGGGGG - Intronic
976301695 4:83521664-83521686 ATCCCAGACGTCCGAGTAGCTGG + Intronic
978154393 4:105473425-105473447 CTCCCTGACGTCGGAGAGGCAGG - Intronic
984868935 4:184310298-184310320 CGCCCTGAGGTCGGTGGGGCAGG - Intergenic
985451305 4:190065369-190065391 CGCCCCGGCTCCGGAGGAGCCGG - Intergenic
991674174 5:69075455-69075477 CGACCAGACCTCGGTGGGGCAGG + Intergenic
995813012 5:116130441-116130463 CGTCCAGAAGACGGAGAAGCAGG - Intronic
997647677 5:135491836-135491858 CACCCAGACGGAGGAGGGGCGGG - Intergenic
1001975709 5:175996874-175996896 CACCCAGAAGTGGGAGAAGCAGG + Intronic
1002241719 5:177846898-177846920 CACCCAGAAGTGGGAGAAGCAGG - Intergenic
1002384986 5:178860031-178860053 CGCCCAGACGTCGGAGGAGCCGG + Exonic
1003897029 6:10617297-10617319 CGCCCAGCACTCGGAGAAGCCGG - Intronic
1007425665 6:41744428-41744450 CACCCACAAGTTGGAGGAGCCGG + Exonic
1017962059 6:159232090-159232112 CGCCAAGAAGGCAGAGGAGCTGG + Exonic
1022559784 7:31336398-31336420 CCGCCAGCCGTGGGAGGAGCAGG + Intergenic
1024733023 7:52273952-52273974 CGCCCAGTACTCGGCGGAGCTGG + Intergenic
1028154925 7:87418875-87418897 CTCCCAGCCTTGGGAGGAGCTGG - Intronic
1029200634 7:98836979-98837001 CGCCCAGACTCCAGAGGAACAGG - Intergenic
1031604163 7:123748765-123748787 CGCCCACTCGCCGGAGGAGACGG - Exonic
1033724226 7:144095823-144095845 CACGCAGAGGTGGGAGGAGCAGG - Exonic
1033725930 7:144118656-144118678 CACACAGAGGTGGGAGGAGCAGG + Intergenic
1033729204 7:144157942-144157964 CACACAGAGGTGGGAGGAGCAGG - Intergenic
1033736976 7:144232106-144232128 CACGCAGAGGTGGGAGGAGCAGG + Exonic
1033746081 7:144318840-144318862 CACGCAGAGGTGGGAGGAGCAGG - Exonic
1034075091 7:148223926-148223948 GGCCTAGAGGTCGGAGGAACCGG - Intronic
1034522068 7:151628139-151628161 CTCCCAGCTGCCGGAGGAGCTGG - Intronic
1037748271 8:21663332-21663354 AGCCCAGACTGCAGAGGAGCTGG + Intergenic
1049761209 8:144332740-144332762 GGCCCAGACGTCCAGGGAGCCGG - Exonic
1049782735 8:144436231-144436253 TGGCCAGGCCTCGGAGGAGCAGG - Exonic
1051667813 9:19481758-19481780 CGAACAGCTGTCGGAGGAGCAGG + Intergenic
1055447062 9:76394240-76394262 CGCCCAGACCCCGGACCAGCCGG + Exonic
1061782625 9:133004808-133004830 AGCCCAGAGGAGGGAGGAGCTGG + Intergenic
1062250077 9:135589444-135589466 CGCCCAGAAGACTGAGGACCCGG + Intergenic
1062580856 9:137228640-137228662 CCCCCAGGCCTCGGAGGAGGGGG + Exonic
1203791493 EBV:154066-154088 CGCCCAGGCGTCCGGGGAGGGGG + Intergenic
1186486436 X:9937482-9937504 AGACCTGAAGTCGGAGGAGCTGG + Exonic
1190321955 X:49184854-49184876 CGCCCAGAGTGCGGGGGAGCGGG + Intronic
1196925550 X:120630147-120630169 CGCGCAGGCGTCGGAAGGGCCGG + Exonic
1198197089 X:134373689-134373711 CGCCTAGACTTCGGGGGAGGGGG + Intronic