ID: 1002385073

View in Genome Browser
Species Human (GRCh38)
Location 5:178860324-178860346
Sequence CGCCGCCCGCCGTGAACGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 58}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002385069_1002385073 -8 Left 1002385069 5:178860309-178860331 CCTGCCTCTGGCTCGCGCCGCCC 0: 1
1: 0
2: 2
3: 17
4: 333
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385062_1002385073 17 Left 1002385062 5:178860284-178860306 CCGCTCCGGTGCCGCTGCCGACG 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385060_1002385073 27 Left 1002385060 5:178860274-178860296 CCCTCACGGGCCGCTCCGGTGCC 0: 1
1: 0
2: 2
3: 4
4: 82
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385063_1002385073 12 Left 1002385063 5:178860289-178860311 CCGGTGCCGCTGCCGACGCCCCT 0: 1
1: 0
2: 1
3: 22
4: 289
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385061_1002385073 26 Left 1002385061 5:178860275-178860297 CCTCACGGGCCGCTCCGGTGCCG 0: 1
1: 0
2: 0
3: 6
4: 91
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385059_1002385073 28 Left 1002385059 5:178860273-178860295 CCCCTCACGGGCCGCTCCGGTGC 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385064_1002385073 6 Left 1002385064 5:178860295-178860317 CCGCTGCCGACGCCCCTGCCTCT 0: 1
1: 0
2: 3
3: 70
4: 816
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385067_1002385073 -6 Left 1002385067 5:178860307-178860329 CCCCTGCCTCTGGCTCGCGCCGC 0: 1
1: 0
2: 2
3: 23
4: 235
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385068_1002385073 -7 Left 1002385068 5:178860308-178860330 CCCTGCCTCTGGCTCGCGCCGCC 0: 1
1: 0
2: 1
3: 13
4: 180
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58
1002385066_1002385073 0 Left 1002385066 5:178860301-178860323 CCGACGCCCCTGCCTCTGGCTCG 0: 1
1: 0
2: 2
3: 26
4: 303
Right 1002385073 5:178860324-178860346 CGCCGCCCGCCGTGAACGCGGGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002385073 Original CRISPR CGCCGCCCGCCGTGAACGCG GGG Intronic