ID: 1002386765

View in Genome Browser
Species Human (GRCh38)
Location 5:178873906-178873928
Sequence ATGAAAACTACAAACACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 7, 3: 52, 4: 418}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002386765_1002386767 23 Left 1002386765 5:178873906-178873928 CCATCAGTGTTTGTAGTTTTCAT 0: 1
1: 0
2: 7
3: 52
4: 418
Right 1002386767 5:178873952-178873974 TTCTTTTTTTTTTTTTGAGATGG 0: 3017
1: 89714
2: 69208
3: 85321
4: 120915

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002386765 Original CRISPR ATGAAAACTACAAACACTGA TGG (reversed) Intronic
900039654 1:447768-447790 ATGAAAACCACAGACAATGAAGG - Intergenic
900061086 1:682744-682766 ATGAAAACCACAGACAATGAAGG - Intergenic
901961762 1:12832019-12832041 ATGAACTCCAGAAACACTGATGG + Intergenic
901963266 1:12844420-12844442 ATAAACTCCACAAACACTGATGG + Intergenic
901963799 1:12849347-12849369 ATGAAATCCACAAACACTGATGG + Intronic
901968371 1:12886802-12886824 ATGAACTCCACAAACACTGATGG + Intronic
901969846 1:12898870-12898892 ATGAACTTCACAAACACTGATGG + Intronic
901976454 1:12948180-12948202 ATGAACTCCACAAACACTGATGG + Intronic
901984959 1:13068068-13068090 ATGAACTCCACAAACACTGATGG - Intronic
901990464 1:13108753-13108775 ATGAACTCCGCAAACACTGATGG + Intergenic
901991435 1:13117443-13117465 ATGAAATCCACAAACACTGATGG + Intergenic
901996850 1:13158702-13158724 ATGAACTCCACAAACACTGATGG + Intergenic
902008718 1:13253590-13253612 ATGAACTCCACAAACACTGATGG - Intergenic
902016803 1:13314981-13315003 ATGAACTCCACAAACACTGATGG - Intronic
902029254 1:13409700-13409722 ATGAACTCCACAAACACTGATGG - Intergenic
902248086 1:15134993-15135015 ATGGAAACAACAGACACTGGAGG + Intergenic
903876334 1:26476214-26476236 ATGCAAAAAACAAACACTGCAGG - Intergenic
904727594 1:32561541-32561563 AACAAAACCACAAACACAGAAGG - Intronic
905343814 1:37297925-37297947 ATGAGATACACAAACACTGAAGG + Intergenic
906338594 1:44957340-44957362 AGGAAAACAACAAAAACTGAAGG + Intronic
907013244 1:50985289-50985311 ATGAAAAGTGAAGACACTGAAGG - Intergenic
907346553 1:53786254-53786276 ATGACAGCTATAAACACTAAGGG - Intronic
907676794 1:56525312-56525334 AGGAAATTCACAAACACTGAAGG - Intronic
907801852 1:57774885-57774907 AAGAAAACTTCAGACACAGATGG - Intronic
908940971 1:69433378-69433400 ATGAATACTACAGAAACTGAGGG - Intergenic
909136530 1:71807317-71807339 ATGCAAACTTCAAACATTTATGG + Intronic
909435650 1:75638681-75638703 CTGAAAACTACAAAGAAAGAAGG - Intergenic
909506838 1:76401380-76401402 ATGAAAACTATAAAAAGTGATGG - Intronic
909893282 1:81035066-81035088 ATGATAAACACAAACACTGTTGG - Intergenic
910131928 1:83917708-83917730 ATTAAAATTACAACCACTAATGG + Intronic
910575805 1:88762427-88762449 ATGAAAAATAAAAACAGTTAAGG - Intronic
910652984 1:89589970-89589992 ATGACAACAACAAAAACTAATGG - Intronic
911352782 1:96774448-96774470 ATAAAATAAACAAACACTGAAGG - Intronic
911399316 1:97354911-97354933 ATGAAAAATAAAGAAACTGATGG - Intronic
911501057 1:98684657-98684679 ATGAAAAGTATAAACCCTCAAGG - Intronic
911717874 1:101155545-101155567 GTGAAAATAAAAAACACTGAAGG + Intergenic
912717461 1:111991890-111991912 CTGAAGCCTCCAAACACTGAGGG - Intergenic
912885076 1:113462524-113462546 AAGAAAACAACAGACACTGGGGG + Intronic
912934517 1:113991460-113991482 ATGTAAACTGAAAACACTCAAGG + Intergenic
912983857 1:114405619-114405641 ATGAAAGCTGCAAACAGTCAGGG - Exonic
913422170 1:118682340-118682362 ATGAAAACTAGAAACAAAAAAGG - Intergenic
915190095 1:154142725-154142747 ATTAAAAATACAAACATTAACGG + Intronic
915819770 1:159009856-159009878 ACGAAAGCTAAAAACACTGGTGG + Intronic
916190726 1:162175464-162175486 CTCAAAACAACAAACAATGATGG - Intronic
918151877 1:181803937-181803959 AGCAAAACTACAAAAACAGAAGG - Intronic
918294026 1:183138558-183138580 ATGAAAATGACCCACACTGAGGG - Intronic
918294493 1:183143354-183143376 ATAATAACTAAAAGCACTGATGG - Exonic
918533437 1:185548503-185548525 ATGATACCCACCAACACTGAGGG + Intergenic
918874471 1:190021879-190021901 ATGAAAATAATAGACACTGAGGG + Intergenic
918884056 1:190167443-190167465 ATGAAAAATTCAAAGACTGTGGG + Intronic
919839067 1:201596203-201596225 ATAATAACAGCAAACACTGATGG - Intergenic
920994758 1:210978639-210978661 ATCATAACCACACACACTGAGGG - Intronic
921115499 1:212087103-212087125 ATGAAAACAACTGAAACTGAAGG + Intronic
922714685 1:227861160-227861182 ATGGACACTACAAAAACTGAAGG + Intergenic
923231772 1:231993418-231993440 AGGAAAACTACAATTAGTGATGG - Intronic
1062765246 10:57546-57568 ATGAAAGCTACAAAGGCTTATGG + Intergenic
1064620740 10:17214512-17214534 ATGATTATTACAAACACTGATGG - Intergenic
1064728363 10:18303937-18303959 ATAAAAAATAAAAACACTGGCGG - Intronic
1066221780 10:33342433-33342455 ATGATAATTACATACTCTGAGGG - Intergenic
1067094339 10:43288736-43288758 CTGAAAACTATAAACACAGTTGG + Intergenic
1067429026 10:46230518-46230540 ATGAAACATTCATACACTGATGG + Intergenic
1068572688 10:58648352-58648374 GTGAACACAAAAAACACTGAAGG - Intronic
1068802190 10:61154024-61154046 ATGAAAACTAAATCCACTGTTGG + Intergenic
1069027588 10:63560495-63560517 ATGAAAAATAAAACCACTTATGG - Intronic
1070353254 10:75613850-75613872 ATGAAAACTGCAAGCACCAAAGG - Intronic
1070759811 10:79017033-79017055 ATGAAAAATACCTACTCTGAGGG - Intergenic
1071507867 10:86243566-86243588 ATGAAAACAGCTAACACAGAGGG + Intronic
1071823381 10:89300433-89300455 ATAAAAATGATAAACACTGAAGG + Intronic
1072288066 10:93935861-93935883 ATGAATGCTATAAACACAGAAGG + Intronic
1073623457 10:105072850-105072872 GGGAAGACCACAAACACTGATGG + Intronic
1073771166 10:106737350-106737372 CAGAAAAATGCAAACACTGATGG - Intronic
1075891094 10:125951667-125951689 ATGGAGACTAAAAACTCTGATGG - Intronic
1076308345 10:129481553-129481575 AAGAAAACTTCAAACACAAATGG - Intronic
1076965878 11:83680-83702 ATGAAAACCACAGACAATGAAGG - Intergenic
1078340084 11:10492431-10492453 ATGAAAAGAACAGACACTAAAGG - Intronic
1078974217 11:16452546-16452568 AAGAAAACTTCAAACAGTGGAGG - Intronic
1079728903 11:23915623-23915645 ATGAAAATTTTAAACACTGACGG - Intergenic
1080662830 11:34311327-34311349 AAGAAATCTAAAAATACTGAAGG + Intronic
1080730149 11:34942116-34942138 ATGAAAACAACAAAAAGAGAAGG - Intronic
1080876272 11:36277317-36277339 ATGAAAACTGACAACACTTAGGG - Intronic
1080948342 11:36999999-37000021 ATGAAAAATACAAAAACAGCTGG + Intergenic
1081078331 11:38705220-38705242 ATGACAACACCAAACAATGAGGG + Intergenic
1081393172 11:42553832-42553854 ATCAAAACTATACACACTGTGGG - Intergenic
1086321516 11:85652437-85652459 AAGAAAGCTCCATACACTGAAGG - Intronic
1086596091 11:88572757-88572779 ATAAAAAATACAACCATTGATGG - Intronic
1087466487 11:98513553-98513575 ATGGAAAATACAGACATTGATGG - Intergenic
1087501900 11:98967279-98967301 ATGAAAACTCCGAACACCAAAGG + Intergenic
1088080946 11:105912883-105912905 CTGAAAACTCCCAACACAGATGG + Intronic
1089662530 11:119994614-119994636 ATGAGATCTACAAAGACTGAGGG + Intergenic
1089949954 11:122516310-122516332 ATGAATATTACAATCAATGAAGG + Intergenic
1090150856 11:124382612-124382634 ATGAGAGCTACAAGTACTGAAGG + Exonic
1090152145 11:124396620-124396642 ATGAGAGCTACAAGTACTGAAGG + Exonic
1090695618 11:129238552-129238574 ATGAGTAATACATACACTGATGG + Intronic
1091708511 12:2718384-2718406 ATGGAAACAAGAAACACTGGGGG + Intergenic
1092460770 12:8684043-8684065 ATCAAAATTACAAACATTGGTGG - Intronic
1093406558 12:18811874-18811896 ATGGAAAATATATACACTGAGGG - Intergenic
1093909420 12:24729066-24729088 ATTAAAACTACTAACCATGAGGG + Intergenic
1094554848 12:31488429-31488451 AAGAAAGCTACAAACCCTTAAGG - Intronic
1094561551 12:31558637-31558659 ATGAAAAATACTCATACTGATGG + Intronic
1094798745 12:34005108-34005130 ATGAAAATTAAGAACAATGAAGG + Intergenic
1095882436 12:47152517-47152539 ATGAAAATTACACACAATGTGGG + Intronic
1096410093 12:51370986-51371008 ATGAAAAATCCAAACACTGTCGG + Intronic
1096785776 12:54016542-54016564 AAGAAAGCTTCAAGCACTGAGGG - Intronic
1097256237 12:57676979-57677001 AGGAAAATTATAAACTCTGATGG + Intergenic
1097731029 12:63128403-63128425 TTAAAAACTGCAAACACTCATGG - Intergenic
1097801022 12:63914164-63914186 ATGATAAGTACAATGACTGAGGG - Intronic
1097957322 12:65499492-65499514 GTGATAAATACAACCACTGATGG - Intergenic
1099071833 12:78054212-78054234 AAGAAAAGTACAAACATAGAAGG + Intronic
1099539514 12:83889467-83889489 ATGCAAACTAAAATCAATGAAGG - Intergenic
1102775145 12:115512143-115512165 ATGAAAAACAAAATCACTGAAGG - Intergenic
1103673453 12:122637174-122637196 ATGGAAAACACAAACACTTAGGG + Intergenic
1105349883 13:19605554-19605576 ATGAAAAATAAATGCACTGAAGG + Intergenic
1106361463 13:29035270-29035292 AGCAAAACTAGTAACACTGATGG + Intronic
1106567483 13:30898722-30898744 CTCAATTCTACAAACACTGATGG - Intergenic
1107878098 13:44808192-44808214 CTGAAAACCTCAAACCCTGAAGG - Intergenic
1108090205 13:46841582-46841604 ATGAAAACAACAACCACTCCAGG + Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1109154574 13:58890444-58890466 ATGAAAATTTCAAAAAGTGATGG - Intergenic
1109179273 13:59193776-59193798 ACTAAAACTACTAAAACTGAAGG - Intergenic
1110243967 13:73300510-73300532 CTGAAAACCAGGAACACTGATGG - Intergenic
1110407470 13:75167195-75167217 ATGAAATCTGCAAATAATGAGGG - Intergenic
1110661473 13:78063044-78063066 ATGAGATCAACAAGCACTGACGG - Intergenic
1111291441 13:86175983-86176005 AAGAAAACTACAGGCACAGATGG + Intergenic
1111494075 13:89024860-89024882 AAGAAAACTAAAAAAACTGTAGG - Intergenic
1111541494 13:89672991-89673013 GTGCAGACTACAAACACAGAGGG + Intergenic
1111720097 13:91932550-91932572 ATGAAAATTGGAAACTCTGAAGG - Intronic
1112881938 13:104118509-104118531 AGGAAAACTACAAACACAGATGG - Intergenic
1113176800 13:107574035-107574057 ATGAAAACAAAAAACAATAAAGG + Intronic
1113807252 13:113117059-113117081 AAGAAAACGACACTCACTGAGGG + Intronic
1114746628 14:25155407-25155429 AAGAAAACTGTAAACATTGATGG + Intergenic
1114977930 14:28124838-28124860 ATTAAAAATACAAAAAATGAGGG - Intergenic
1115029940 14:28783252-28783274 ATGCGATCTATAAACACTGAAGG + Intronic
1115595229 14:34902741-34902763 ATAAAAACCAAAAACAGTGAGGG - Intergenic
1116007959 14:39316910-39316932 ATGAAAACCACAAACAACAATGG + Intronic
1116299861 14:43164776-43164798 ATGAAAAATACAAAAATTGGCGG - Intergenic
1117572207 14:57058636-57058658 ATGTAAACAACAAAATCTGAGGG + Intergenic
1117755284 14:58968504-58968526 GTGAGAACAAGAAACACTGAAGG + Intergenic
1118555071 14:67009107-67009129 ATGAAAAAAACAAACACACAAGG - Intronic
1119157553 14:72424907-72424929 ATGAAGACAACCATCACTGAAGG - Intronic
1120423060 14:84313266-84313288 AAGAGAACTAAAAATACTGAAGG + Intergenic
1121217123 14:92257009-92257031 ATGGAAACAATAAACACTGGGGG - Intergenic
1121374803 14:93398698-93398720 TTGTAATCTACAAACACAGAAGG + Intronic
1121689855 14:95869852-95869874 ATGAAAACTCAAAGCAATGAGGG + Intergenic
1121750418 14:96349853-96349875 ATTAACATTACAAACACAGAGGG + Intronic
1122441453 14:101734850-101734872 ATGAAAACTCCAAAATCTTATGG - Intergenic
1123111429 14:105868941-105868963 ATGAAAACAACAAACATCAATGG - Intergenic
1123788089 15:23692346-23692368 AAGAAAACTTCAGGCACTGATGG - Intergenic
1124018505 15:25898632-25898654 AGGAAAACTACAAACAAGGGAGG + Intergenic
1125121722 15:36167811-36167833 TAGAAAACTCCAAACTCTGATGG + Intergenic
1125712569 15:41798723-41798745 ATGTAAACCAGAAACACTTAGGG - Intronic
1126272502 15:46837583-46837605 ATGAAAACTCCAGACACAAATGG + Intergenic
1126743885 15:51805387-51805409 ATGAAATCAGCAAACTCTGAAGG - Intronic
1126955754 15:53931933-53931955 ATTAAAAACACTAACACTGATGG - Intergenic
1127284662 15:57521908-57521930 GTGAAAACAACAAATACAGAGGG - Intronic
1127695158 15:61439426-61439448 ATCAAATCTACAAAAAATGAAGG + Intergenic
1128190972 15:65696529-65696551 ATGAAATCTATATACACTGTAGG + Intronic
1128432139 15:67606751-67606773 ATGAAAATTAGAAGGACTGATGG + Intronic
1130215747 15:81967459-81967481 AGGAAAAATACAAACACAGAAGG + Intergenic
1132442254 15:101879845-101879867 ATGAAAACCACAGACAATGAAGG + Intergenic
1133322932 16:4925378-4925400 ATGAATAGTAACAACACTGAGGG + Intronic
1133640563 16:7712950-7712972 ATTAAAACTACATACAGTCATGG - Intronic
1134093903 16:11406190-11406212 ATGGAAACAGTAAACACTGAGGG - Intronic
1134449127 16:14353174-14353196 ATGAAAAATAAAAACCCAGAAGG - Intergenic
1134510359 16:14841751-14841773 ATAAAAACTTAAAAAACTGAGGG - Intronic
1134698000 16:16240240-16240262 ATAAAAACTTAAAAAACTGAGGG - Intronic
1134867651 16:17622553-17622575 AGGAAAAATAGAAACACAGATGG - Intergenic
1135778638 16:25279324-25279346 ATGAGAACAACAGACACTGGGGG + Intergenic
1135879368 16:26239193-26239215 ATGAAATCAACAAACACTACAGG - Intergenic
1137092086 16:36205933-36205955 AGGAAAAATACATAGACTGATGG + Intergenic
1138100210 16:54246299-54246321 TTGAAAACTACACACAGTGGGGG + Intronic
1138693969 16:58793947-58793969 ATGAAAATAATAGACACTGAGGG - Intergenic
1139278271 16:65748267-65748289 ATGAAAACAACAACCGCTGAAGG - Intergenic
1140283378 16:73576054-73576076 AAGATAATTAGAAACACTGAGGG - Intergenic
1143035765 17:3996228-3996250 GTGGAAACTACAAAAACTGATGG - Intergenic
1143568500 17:7739923-7739945 ATGAAGACTACAATAAGTGAGGG + Exonic
1143787397 17:9266172-9266194 ATGACAACTGGAAACACAGAGGG + Intronic
1146050398 17:29547084-29547106 ATGGAAAGTAAGAACACTGATGG + Exonic
1146909491 17:36639406-36639428 AAGAAAATTACAAACACATAGGG - Intergenic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147632931 17:41943937-41943959 ATTAAAAATACAAAAACTGTTGG + Intronic
1149177210 17:53887437-53887459 CTAAAAACTACAAACACTGATGG + Intergenic
1149533286 17:57412751-57412773 ATGAAAACTATACAGTCTGAGGG - Intronic
1149611032 17:57957795-57957817 TTCAAAACTACAAACACTTCAGG + Intergenic
1150028454 17:61704242-61704264 ATGAAGACTACAAAAACAAAAGG - Intronic
1151407297 17:73896941-73896963 ATGGAAACTGCAAATGCTGATGG - Intergenic
1151833144 17:76567631-76567653 GGGAAAACTTCAAAAACTGAGGG + Intronic
1152871608 17:82756779-82756801 ATGTAAACTAAAAACACTTGAGG - Intronic
1153665648 18:7365812-7365834 ATGAAAACTACCCAGACTGGGGG + Intergenic
1155456823 18:26025708-26025730 AAAAAAACTACAAACCCAGATGG + Intronic
1155639464 18:27996578-27996600 ATATAAACTATAAACAGTGATGG - Intronic
1155668515 18:28340630-28340652 ATCAAAACTACGAATTCTGAAGG - Intergenic
1156499706 18:37550021-37550043 AAGAAAACTAAAAATACTAATGG + Intronic
1156583210 18:38403308-38403330 ATGGAAACAATAGACACTGAGGG - Intergenic
1156584662 18:38418854-38418876 ATGAAAATGAAAAACACAGAAGG + Intergenic
1156794638 18:41028815-41028837 ATTAAAATTAAAAATACTGATGG + Intergenic
1156997841 18:43489466-43489488 AAGAAAACAACATACAGTGATGG + Intergenic
1157262047 18:46184284-46184306 ATTAAAAATACAAAAACTGCTGG - Intronic
1158251551 18:55493802-55493824 CTGTAGACTACAAAAACTGAAGG - Intronic
1158455820 18:57606529-57606551 ATCAAATCTACAAAAACTGAGGG + Intronic
1158802873 18:60933235-60933257 ATGAAGACAACATTCACTGAGGG - Intergenic
1160576852 18:79860448-79860470 CTGAAAACTACAAACATTGGTGG - Intergenic
1160642682 19:153310-153332 ATGAAAACCACAGACAATGAAGG - Intergenic
1162663131 19:12186141-12186163 AAGATCACTACAAACACCGAGGG + Exonic
1162700444 19:12511204-12511226 ATAACAACTACAACCACAGAAGG + Intronic
1163096662 19:15063045-15063067 ATAAAAAAAAGAAACACTGAAGG - Intergenic
1163259273 19:16177812-16177834 CTAGAACCTACAAACACTGATGG - Intergenic
1163361376 19:16848464-16848486 AATAAAACTTCACACACTGATGG - Intronic
1163928289 19:20365476-20365498 AAGAAAACTGCAAAAACTGGAGG + Intergenic
1164128930 19:22344331-22344353 AAGAAAACTACAATCACTCAGGG - Intergenic
1164170490 19:22720694-22720716 AAGAAAACTAAAATCACTCAGGG + Intergenic
1164247553 19:23446064-23446086 ATAGAAACAACAAAAACTGAGGG + Intergenic
1164450028 19:28352517-28352539 ATGATATATTCAAACACTGAAGG + Intergenic
1164452264 19:28376942-28376964 ATGAAAACAATAGACACTGGGGG + Intergenic
1164645054 19:29852882-29852904 AAGGAAACAACAGACACTGAGGG - Intergenic
1164863674 19:31584402-31584424 ATGAAAACTGCAAATCCAGATGG - Intergenic
1164943852 19:32273499-32273521 ATTTAAAATATAAACACTGATGG - Intergenic
1165659002 19:37558316-37558338 AAGAAAACTCCAAAAACTGGAGG - Intronic
1167023558 19:46897222-46897244 ATGAAAATGACAACAACTGATGG + Intergenic
927428316 2:23005494-23005516 AGGAAAACAACAAATACTGCTGG - Intergenic
928708955 2:33982793-33982815 ATGAACAATACAAACATTAATGG + Intergenic
929037677 2:37710339-37710361 AGGAAAAGTAAAAACAATGAGGG + Intronic
929298714 2:40277029-40277051 ATGTAAATTAAAAACAATGATGG + Intronic
929526559 2:42708842-42708864 CAGAAAACAACAAACACTCAAGG - Intronic
930406439 2:50962693-50962715 ATGAAAACTCAAAAAACTAAAGG - Intronic
930541067 2:52707261-52707283 GTGAAATATACAAAGACTGAAGG - Intergenic
931077056 2:58727111-58727133 ATAAAAAATAAAAAAACTGAAGG - Intergenic
931391662 2:61849935-61849957 ATGGAAACCACAGACACTGCGGG + Intronic
931495928 2:62807077-62807099 ATGAAACCCACTGACACTGAGGG + Intronic
931620181 2:64202021-64202043 ATAAAAAGTACAAACAGCGAAGG + Intergenic
932025523 2:68128209-68128231 AGGAAAACCATGAACACTGATGG + Intronic
932670080 2:73729362-73729384 ATAAAAATTGCAAACACTTATGG - Intronic
933330101 2:80882435-80882457 ATGATAACTACAGATCCTGAAGG - Intergenic
935077952 2:99764087-99764109 ATTCAAACTGGAAACACTGAGGG + Intronic
935728828 2:106047666-106047688 CAGAAAAGTACAAACACAGAAGG - Intergenic
937545078 2:123006137-123006159 ATGAAAACTCCAAAGACACATGG + Intergenic
937597444 2:123687983-123688005 AAGAAAACTCCAAAAACTGGAGG + Intergenic
937672634 2:124554777-124554799 TTAAAAACTACAAACACAAAAGG + Intronic
939017842 2:136921947-136921969 ATTAACACTAAAAGCACTGAAGG - Intronic
939031805 2:137085810-137085832 ATAAAAACCACAAACTATGAGGG + Intronic
939232127 2:139442019-139442041 ATGAAAGCAACAAACAATCAAGG - Intergenic
939440497 2:142243400-142243422 ATCAAAACTACACATACTAATGG + Intergenic
939494513 2:142912306-142912328 ATGAAAACTAGACAATCTGAAGG - Intronic
939907826 2:147939852-147939874 ATGAAAAATACAAATAAAGAAGG - Intronic
940577467 2:155528961-155528983 ATGAAAATTCCAAACACCAAAGG + Intergenic
940631013 2:156238835-156238857 ATGAAAATTAGAAAAACTGTAGG - Intergenic
940715660 2:157220485-157220507 ATAAAAGCTATAAACCCTGATGG - Intergenic
941374646 2:164712262-164712284 ATGGAAAATAAAAACACTCAGGG + Intronic
942535149 2:176955586-176955608 AAGAAAAATAAAATCACTGAAGG + Intergenic
942614280 2:177774042-177774064 GTAAAACCTGCAAACACTGAGGG - Intronic
942616407 2:177795770-177795792 ATAAAAATGATAAACACTGAGGG - Intronic
943624534 2:190183629-190183651 ATTAAAAATAAAAACACTGGGGG + Intronic
944160340 2:196652887-196652909 ATGGAAACTACAAAGGCTTATGG + Intronic
945004321 2:205387634-205387656 ATGAAAAGCACAAATACTGTGGG + Intronic
945370342 2:209008528-209008550 ATGAAAAATACAAAAACACATGG + Intergenic
945411190 2:209510050-209510072 ATGAAATCTAGAAACAAGGAAGG + Intronic
945595640 2:211787524-211787546 ATGATAATTTCAAACACTTATGG - Intronic
946098638 2:217299401-217299423 ATGAAGGCTACAAACATTGTTGG + Intronic
946718117 2:222574919-222574941 ATGTAAACTAGAAATACTGAAGG + Intronic
946973835 2:225125836-225125858 ATAAAAAGTACAAATGCTGAAGG + Intergenic
947166124 2:227264035-227264057 ATAAAAACCACACAGACTGATGG - Intronic
947307485 2:228763650-228763672 ATGAGCATTACAAACACTGCAGG + Intergenic
948417058 2:237816287-237816309 ATGAAAACTATAAGCACTTGGGG + Intronic
948678713 2:239615858-239615880 TAGAAAACTACAAACATTAATGG - Intergenic
1169536946 20:6555224-6555246 AGGAAAACTACAAACGCTGATGG - Intergenic
1169657868 20:7945134-7945156 ATGAGAACAACAGACACTGCAGG - Intergenic
1169746308 20:8946540-8946562 ATAAAAAATAAAAACACTGTCGG + Intronic
1169790107 20:9401159-9401181 ATGAAAGCCTCAAACACTGCAGG - Intronic
1170334595 20:15254386-15254408 ATGATAAAAACAAAAACTGAAGG - Intronic
1170861134 20:20104863-20104885 AGAAAAACCAAAAACACTGATGG - Intronic
1172452074 20:35033246-35033268 ATAACAACAACAAACCCTGAAGG - Intronic
1173984837 20:47252995-47253017 ATGAACACTACATAAACAGATGG + Intronic
1177268786 21:18819275-18819297 ATGAAAACTATAAACAAAGGAGG - Intergenic
1178471737 21:32899580-32899602 CTGAAGACAAGAAACACTGATGG + Intergenic
1178489436 21:33039591-33039613 AGGATAAATACAACCACTGAGGG - Intergenic
1178559840 21:33628488-33628510 ATGAAAACTATAAATATTGATGG - Intronic
1178613463 21:34108584-34108606 AAGAGAAATACAAACACCGAGGG - Intronic
1180159009 21:45990739-45990761 AAGAAAACTAGAAAATCTGACGG - Intronic
1183029521 22:35093094-35093116 AGCAAAAATTCAAACACTGAGGG - Intergenic
951232354 3:20193922-20193944 AGGGGAACAACAAACACTGAGGG - Intergenic
951241214 3:20288044-20288066 ATGAAAACTGCCAAAACTTATGG + Intergenic
951994231 3:28709167-28709189 ATCATATCTACAATCACTGAAGG + Intergenic
951996319 3:28733828-28733850 ATGACAACTAAAAAAACTGGAGG - Intergenic
954937607 3:54341239-54341261 ATAAAGAGAACAAACACTGAAGG - Intronic
956483162 3:69693391-69693413 ATGACAACAACAAACACTTTAGG + Intergenic
957007645 3:74968979-74969001 AAAAACACTAAAAACACTGAAGG - Intergenic
958514413 3:95094313-95094335 ATGAAAACAAGAAACTCAGATGG + Intergenic
958548196 3:95583871-95583893 AAGAAAACAAAAAATACTGAAGG + Intergenic
958639754 3:96790503-96790525 AAGAAAACTACAAATACTAATGG - Intergenic
958706282 3:97660452-97660474 ATTCAAGCTACATACACTGAGGG - Intronic
959063452 3:101635648-101635670 AAGAAAATTACAAAAACTGGAGG + Intergenic
959247487 3:103892510-103892532 ATGAAAACTACAAATATCTAAGG - Intergenic
959343949 3:105168797-105168819 ATGAAACCTACAAATACACAAGG + Intergenic
960257993 3:115532454-115532476 ATGGCAACTTCAAAGACTGAAGG - Intergenic
961063942 3:123858072-123858094 AAGAAAACTACCAACCCTTAGGG - Intronic
962955811 3:140265682-140265704 AAGAAAACTCAAAGCACTGATGG - Intronic
964240830 3:154592381-154592403 ATGAAATCTACAAATAATGAAGG - Intergenic
964336508 3:155660344-155660366 AAGAATACTGCATACACTGAAGG + Intronic
964739656 3:159951979-159952001 ATCCAAACGACAAACACTGTGGG + Intergenic
965065093 3:163838569-163838591 ATGAAAACTCCAAACTTTCATGG + Intergenic
965197150 3:165615245-165615267 TTGAAAACTGCAAAGAATGAGGG + Intergenic
965616960 3:170603776-170603798 ATGAAAGCCATAAACACTAATGG - Intronic
966614169 3:181896527-181896549 ATGAAAAGTACATAAACTGAAGG - Intergenic
967629137 3:191722307-191722329 ATGAAAACTGAGAACACTTAAGG + Intergenic
967882585 3:194312464-194312486 TTGAAAACAACAGAGACTGAAGG + Intergenic
969958505 4:10917843-10917865 ATGTAAAACACAAACACTGGAGG + Intergenic
970394533 4:15653492-15653514 ATGAAAGCTACAAACACCCTAGG + Intronic
970720224 4:18978840-18978862 AAGAAAACAACAATCATTGATGG - Intergenic
971469581 4:27007188-27007210 ATGAAAACCAGACTCACTGAGGG - Intronic
972421391 4:38890479-38890501 ATGGAATCTACAAACTCTGTAGG + Intronic
972682367 4:41318705-41318727 CTGAAATCTACACACACTAATGG - Intergenic
972687523 4:41365355-41365377 CTGAAGATTAAAAACACTGAGGG + Intronic
972940052 4:44184868-44184890 ATGGAAATTATAAACTCTGAGGG - Intronic
973730249 4:53816077-53816099 TTGAAAACTCAAAACACTAAAGG - Intronic
974460834 4:62185526-62185548 ATGAAAACTACAGACTCTTTAGG - Intergenic
975199376 4:71567537-71567559 ATAAAAACAACAAACACAAAAGG - Intronic
976151390 4:82095907-82095929 AGGGAAACTTCATACACTGATGG + Intergenic
978663620 4:111155747-111155769 TTGAAAACTACAAGCAAGGAAGG - Intergenic
979491704 4:121335681-121335703 CTGAAAACTATTCACACTGAGGG + Intronic
979665597 4:123307487-123307509 ATGAATACTACAGAAACTGAGGG - Intronic
979881620 4:125966056-125966078 ATGAAATATATAAACATTGAGGG - Intergenic
979896070 4:126158389-126158411 ATGAAAAGTACATCCAATGAAGG - Intergenic
980584956 4:134800248-134800270 ATAAAAAATAGAAACTCTGAGGG - Intergenic
980678030 4:136115608-136115630 ATCAAAACTACAGGCACTGATGG + Intergenic
982185603 4:152794929-152794951 AAGAAAACTTCAAAAACAGATGG - Intronic
982300129 4:153869707-153869729 AAAAGAACTACAAATACTGAGGG + Intergenic
982466872 4:155742854-155742876 AAGAAACCTACAGACAATGAGGG - Intergenic
982645811 4:158024068-158024090 ATGAACTCTAGGAACACTGAAGG + Intergenic
982737326 4:159019957-159019979 ATTAAAACTACAAAAATTGCTGG + Intronic
982890229 4:160838697-160838719 ATGAAAGGTACAAAGGCTGATGG + Intergenic
982926479 4:161343367-161343389 ATGCCAACTTCAAACACTGGAGG + Intergenic
983576062 4:169263155-169263177 AGGTTCACTACAAACACTGACGG - Intronic
983758903 4:171380188-171380210 ATAAAAACACCAAACACTTATGG - Intergenic
983877230 4:172891920-172891942 ATGAAAATTTCAAATACTGTTGG - Intronic
984289387 4:177774964-177774986 ATTAAAAGTAGAAACAGTGAGGG + Intronic
984720075 4:182962911-182962933 ATGAAAACTAAATAAATTGAAGG - Intergenic
985562572 5:597669-597691 ATGAAAATTCCAGACACAGATGG + Intergenic
987971348 5:24948865-24948887 ATCAGAACTACAAAGCCTGATGG + Intergenic
988735761 5:34019407-34019429 ATGAACATTACAAAGACTTAAGG + Intronic
989671323 5:43919993-43920015 ATGAAAACTATAAAAACTGATGG - Intergenic
989689266 5:44120901-44120923 ATGAAAAATACAATCAATTAAGG + Intergenic
990276851 5:54206258-54206280 ATGAAGAGTACAAACTCAGAAGG - Intronic
990939347 5:61186560-61186582 AAGAAAACTCCAAGCACAGATGG - Intergenic
991168922 5:63598377-63598399 ATGATGCCTACTAACACTGAGGG - Intergenic
991361995 5:65830495-65830517 ATGGAAATTATTAACACTGATGG - Intronic
991965285 5:72084767-72084789 AAGTAAAAAACAAACACTGAAGG + Intergenic
992984033 5:82209120-82209142 AAGAAAACTCCAAACCCAGATGG - Intronic
993040264 5:82806231-82806253 ATAAAAACTACAAACATGGCTGG - Intergenic
993335842 5:86657522-86657544 ATGTAAACTTCAAAAAATGAAGG + Intergenic
994081242 5:95710911-95710933 AAGAAAACTCCAAAAACTGGAGG - Intergenic
994255142 5:97584136-97584158 ATGAAAAATATAAATACTTAGGG + Intergenic
994573066 5:101538094-101538116 ATAACAACTTCAAAGACTGAAGG + Intergenic
994800156 5:104362721-104362743 ATTTAATCTACAAAAACTGAGGG + Intergenic
994967422 5:106692634-106692656 ATGAAAGGTATAAACATTGAAGG - Intergenic
995137831 5:108699651-108699673 CTGAAAACTACACTCACAGATGG - Intergenic
996546812 5:124688148-124688170 ATGAAGAATTCAAACACTCAAGG - Intronic
996676376 5:126179634-126179656 ATGAAAACTACAAATACATATGG + Intergenic
996999786 5:129746077-129746099 ATGGAAACAACAGACACTGGAGG + Intergenic
997914627 5:137912269-137912291 AAGAAAACTTCATACACTGTTGG - Intronic
998715738 5:144882356-144882378 ATGAAAAGTATAAAAATTGATGG + Intergenic
999722514 5:154409375-154409397 ATGATAAATAGAAACACAGAAGG + Intronic
1000401248 5:160829634-160829656 AGGAAAACTACAAAGACTACTGG - Intronic
1000475828 5:161705924-161705946 ATGATGACTACAAAAACTGTGGG - Intergenic
1000526461 5:162364576-162364598 ATGAAAAATACAAAAACAGGTGG + Intergenic
1002386765 5:178873906-178873928 ATGAAAACTACAAACACTGATGG - Intronic
1002734193 5:181371175-181371197 ATGAAAACCACAGACAATGAAGG + Intergenic
1002750348 6:102950-102972 ATGAAAACCACAGACAATGAAGG - Intergenic
1003742382 6:8956097-8956119 AACAAAACCAAAAACACTGATGG + Intergenic
1003794311 6:9582750-9582772 ATGAAAATTTCAAACTCTAAAGG + Intergenic
1004351928 6:14897720-14897742 ATGAAACCAACACACACTGCAGG + Intergenic
1004924928 6:20407045-20407067 ATGAAAATTTCAAGCACTGAGGG - Intronic
1005408043 6:25513277-25513299 ATGACAACTAAAAACACTTCAGG - Intronic
1005738803 6:28772589-28772611 AAGAAAACTCCAAAAACTGGAGG - Intergenic
1007021482 6:38526255-38526277 ATGCAAGCTCCAAACACTGGCGG + Intronic
1008764443 6:54894202-54894224 ATGGACACTACAATCCCTGAAGG - Intronic
1009539185 6:64929199-64929221 AAGAAAACTACAAAAATTGAAGG + Intronic
1009911735 6:69938103-69938125 AAGAAAAAAACAAATACTGATGG + Intronic
1010259890 6:73803709-73803731 GTGTAAAAAACAAACACTGATGG + Intronic
1011582445 6:88884718-88884740 ATGAAAACTATCTACACTAAAGG + Intronic
1011903079 6:92325246-92325268 GGGTAAACAACAAACACTGAGGG - Intergenic
1012283780 6:97363235-97363257 ACTAAAACTACAAAAACTAATGG + Intergenic
1012843340 6:104357996-104358018 ATAAAAACTACTAACTCTGCTGG + Intergenic
1013435905 6:110106502-110106524 ATGATAACTGAAAACACAGAAGG - Intronic
1014272934 6:119353733-119353755 AAGAAAGCTACACACACTGAAGG - Intergenic
1016333019 6:142973809-142973831 ATTAACACTTCAAACAATGAGGG - Intergenic
1016707590 6:147129787-147129809 ATGAAAAAAAAAAACAGTGAGGG + Intergenic
1016722397 6:147316691-147316713 ATCAAGACTAAAAACACTGATGG - Intronic
1016760770 6:147734166-147734188 ATAAAAACTAAAACCACTTAAGG - Intronic
1017161574 6:151370555-151370577 ATCAAAAATAAAACCACTGAGGG - Intronic
1017686794 6:156921875-156921897 ATGAAAGCTAAAATAACTGAAGG - Intronic
1019238441 6:170643490-170643512 ATGAAAACCACAGACAATGAAGG + Intergenic
1019948446 7:4349473-4349495 GTGAAAATTACAGACACAGAAGG - Intergenic
1020433910 7:8141418-8141440 ATGAAAACTAGAACCAGTCAGGG + Intronic
1020684707 7:11279326-11279348 ATAAAATCTACAAACACAGTGGG - Intergenic
1020748287 7:12107140-12107162 ATGAAAAAGACATACACTTAAGG + Intergenic
1021244087 7:18240433-18240455 ATATAAACTAGAAACACTGGGGG - Intronic
1021537224 7:21719496-21719518 ATCAAAACAAAAAAGACTGAAGG - Intronic
1022006956 7:26274485-26274507 ATGAAAACCACTAACACAGCCGG - Intergenic
1023129777 7:36991170-36991192 ATGAAAATTCCAAACAGTTAGGG + Intronic
1023165460 7:37338967-37338989 CTGAAAACTCCAGGCACTGATGG + Intronic
1025222838 7:57131072-57131094 AAGAGAACAACAGACACTGAGGG + Intronic
1028085971 7:86638320-86638342 ATGCAGAGCACAAACACTGAAGG - Intergenic
1028123942 7:87089735-87089757 CTGAAAAATAAAAACACTGCAGG - Intergenic
1028124070 7:87091347-87091369 ATGAAAACCACAAAAACTAGAGG - Intergenic
1030128721 7:106178976-106178998 ATGAAACTTACAACCTCTGAGGG - Intergenic
1030436045 7:109522037-109522059 TTGAAAACAAAAGACACTGACGG - Intergenic
1031020152 7:116619210-116619232 AGAAAAACTGAAAACACTGAGGG - Intergenic
1031553579 7:123144166-123144188 ATGACCACTTCAAAAACTGAGGG - Intronic
1031697102 7:124871677-124871699 ACGATAACTTCAAACACTGGTGG + Intronic
1032456010 7:132074149-132074171 ATGAAAAGGACAATCAATGAAGG - Intergenic
1034720608 7:153289338-153289360 AAGCAAACTAGAAACACAGATGG - Intergenic
1035509327 8:163117-163139 ATGAAAACCACAGACAATGAAGG - Intergenic
1035791473 8:2309478-2309500 CTGAAATCTACAAACTCTGATGG + Intergenic
1035801332 8:2412227-2412249 CTGAAATCTACAAACTCTGATGG - Intergenic
1037155517 8:15694567-15694589 ATGACAACTTCTAAGACTGAAGG - Intronic
1038240667 8:25805452-25805474 ACAAAAACTACAGACAATGAAGG - Intergenic
1039427089 8:37495078-37495100 ATAAAAAGTCCAAACACAGAAGG + Intergenic
1039607302 8:38891944-38891966 ATGACAACTTCAGACACTGAAGG + Intergenic
1040360752 8:46662041-46662063 ATCAAAACTACAACCACAGCTGG - Intergenic
1041596090 8:59654760-59654782 CTGAAAACTACAAAGGCAGAAGG - Intergenic
1043093331 8:75931992-75932014 ATGGAAACAACACACACTGGGGG + Intergenic
1043119479 8:76304661-76304683 AAGAAAATTAAACACACTGAGGG - Intergenic
1044076965 8:87833677-87833699 AGGGAAACTACAAAAACTGGCGG - Intergenic
1044162815 8:88942074-88942096 AAGAAGACTGAAAACACTGAGGG - Intergenic
1044874505 8:96651319-96651341 AAGAAAACTAGAAACTCTTATGG + Intronic
1045121840 8:99046217-99046239 AGGAAAACTACAAACACTGCTGG - Intronic
1045174596 8:99708305-99708327 ATGAAAACTAAAAATACCAAAGG - Intronic
1045278766 8:100730510-100730532 ACGAAATCTACAGAAACTGATGG + Intergenic
1045666773 8:104496136-104496158 CTGAAAACTACTCACTCTGAAGG + Intronic
1046063316 8:109165546-109165568 AGGAAAATTAAAAACACTTAGGG - Intergenic
1046880561 8:119302233-119302255 ATGACAACAACAAAAGCTGAAGG + Intergenic
1046975640 8:120273671-120273693 ATAGAAACTACAAAATCTGAAGG + Intronic
1047043068 8:121020404-121020426 ATGAAAACAAAAAACTCTAAAGG + Intergenic
1047742290 8:127816213-127816235 ATCCAAACTATGAACACTGATGG + Intergenic
1048493296 8:134914146-134914168 ATACAAACAACTAACACTGAAGG - Intergenic
1051145376 9:14021786-14021808 TTGCAAACTAAAAACAGTGAAGG - Intergenic
1051305517 9:15704671-15704693 TAGAAAACTACAAAATCTGAAGG - Intronic
1051470011 9:17427689-17427711 ATTAAAACTACCAACATTTAAGG + Intronic
1051998081 9:23243568-23243590 AAGAAAACTCCAGACACAGATGG + Intergenic
1052688882 9:31789765-31789787 CAGAAAACTACCAACACTGAGGG - Intergenic
1052845882 9:33336151-33336173 ATGAAACCCTCATACACTGATGG - Intronic
1054890927 9:70250927-70250949 AGGAAAAAAACAAAAACTGAGGG - Intergenic
1055077496 9:72231038-72231060 ATGAACACTAATAACAATGACGG - Intronic
1055194297 9:73568708-73568730 ATGAAATCTACAAAAACAGATGG + Intergenic
1055228788 9:74034845-74034867 ATAAAAAAAACAAAAACTGAGGG - Intergenic
1056157927 9:83857882-83857904 AAGAAAACTCTAAACTCTGAAGG - Intronic
1056339234 9:85608825-85608847 ATGAAAAAAACAAACAGGGAGGG + Intronic
1056352622 9:85766204-85766226 AAGAAAACTGTAAACTCTGAAGG + Intergenic
1056635589 9:88328807-88328829 ATGAATGTGACAAACACTGACGG + Intergenic
1057066005 9:92052456-92052478 CTGAAAACTATAAACTCTTAGGG + Intronic
1057740630 9:97708502-97708524 ATGAAAATCATAGACACTGAAGG - Intergenic
1058162955 9:101590179-101590201 ATGAAAAATTCTAACACTGAAGG - Intronic
1058228204 9:102393083-102393105 AAGAGAACTTCAAACAATGAAGG - Intergenic
1061607943 9:131725618-131725640 ATCAAAACTACAAACAGAGCTGG - Intronic
1062758644 9:138323782-138323804 ATGAAAACCACAGACAATGAAGG + Intergenic
1186727410 X:12372160-12372182 ATCAAATCAAGAAACACTGATGG - Intronic
1187865736 X:23721507-23721529 GTGAAATCTACAGACACAGAGGG + Intronic
1189592714 X:42532113-42532135 ATGAAAATAATAAACACTGGGGG - Intergenic
1190164873 X:48065157-48065179 AAGAAAACTCCATACCCTGATGG + Intronic
1190572480 X:51797988-51798010 ATGAAAAATACTAATACTGGTGG + Intergenic
1191238618 X:58159452-58159474 ATAAAAACTACAAACAAGGCTGG + Intergenic
1191804010 X:65114359-65114381 AAGAAAACTCCAATCACAGATGG - Intergenic
1192423430 X:71053923-71053945 AAGAAACTTACAAACACTCAGGG + Intergenic
1192919825 X:75694857-75694879 AGGAAAACTACAAACATTAAAGG + Intergenic
1193854348 X:86580238-86580260 ATAGCAACTTCAAACACTGAAGG + Intronic
1194085639 X:89524615-89524637 AAGACAACTTCAAAGACTGAAGG - Intergenic
1194921119 X:99766157-99766179 ATGAAAATTATAAACAATGATGG + Intergenic
1194982102 X:100451016-100451038 ATGGCAACTTCAAAGACTGAAGG + Intergenic
1195392910 X:104381646-104381668 ATGAACAGAACAATCACTGATGG - Intergenic
1195793123 X:108611674-108611696 AAGAAAACTACAAATCCAGATGG + Intronic
1196353220 X:114757624-114757646 ATAAAAACTAAAATCTCTGAAGG + Intronic
1196363136 X:114890446-114890468 ATGAAAACCAGAAATAATGAAGG - Intronic
1196581253 X:117381720-117381742 CTGAGAACCAGAAACACTGAGGG + Intergenic
1196769809 X:119282160-119282182 AGGAAACCTAGAAACAGTGAAGG - Intergenic
1199104665 X:143850287-143850309 ATTAAAACTCCAAACACTTCTGG + Intergenic
1200165102 X:154030466-154030488 CAGAAAAGTACAAACACCGAGGG - Exonic
1200438283 Y:3180497-3180519 AAGACAACTTCAAAGACTGAAGG - Intergenic
1200615810 Y:5379142-5379164 ATGAAATCTGAAAAAACTGATGG - Intronic
1201397893 Y:13568664-13568686 ATGAAAACAATAAACACTGTGGG - Intergenic