ID: 1002390034

View in Genome Browser
Species Human (GRCh38)
Location 5:178903479-178903501
Sequence CTCAATATAAAAATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4383
Summary {0: 3, 1: 29, 2: 257, 3: 904, 4: 3190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002390034_1002390037 -3 Left 1002390034 5:178903479-178903501 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390034_1002390038 14 Left 1002390034 5:178903479-178903501 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002390034 Original CRISPR CTCAATATAAAAATGGGCAA AGG (reversed) Intronic
Too many off-targets to display for this crispr