ID: 1002390034 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:178903479-178903501 |
| Sequence | CTCAATATAAAAATGGGCAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4383 | |||
| Summary | {0: 3, 1: 29, 2: 257, 3: 904, 4: 3190} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1002390034_1002390037 | -3 | Left | 1002390034 | 5:178903479-178903501 | CCTTTGCCCATTTTTATATTGAG | 0: 3 1: 29 2: 257 3: 904 4: 3190 |
||
| Right | 1002390037 | 5:178903499-178903521 | GAGTTATTTACATATAAAAGAGG | 0: 1 1: 0 2: 3 3: 116 4: 1557 |
||||
| 1002390034_1002390038 | 14 | Left | 1002390034 | 5:178903479-178903501 | CCTTTGCCCATTTTTATATTGAG | 0: 3 1: 29 2: 257 3: 904 4: 3190 |
||
| Right | 1002390038 | 5:178903516-178903538 | AAGAGGTCTTTCCTATAAAGTGG | 0: 1 1: 0 2: 1 3: 17 4: 149 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1002390034 | Original CRISPR | CTCAATATAAAAATGGGCAA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||