ID: 1002390037

View in Genome Browser
Species Human (GRCh38)
Location 5:178903499-178903521
Sequence GAGTTATTTACATATAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1677
Summary {0: 1, 1: 0, 2: 3, 3: 116, 4: 1557}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002390035_1002390037 -9 Left 1002390035 5:178903485-178903507 CCCATTTTTATATTGAGTTATTT 0: 1
1: 30
2: 292
3: 1172
4: 4745
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390031_1002390037 20 Left 1002390031 5:178903456-178903478 CCTTTTAAAATACCTGTCTACAC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390030_1002390037 24 Left 1002390030 5:178903452-178903474 CCAGCCTTTTAAAATACCTGTCT 0: 1
1: 0
2: 1
3: 27
4: 280
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390033_1002390037 -2 Left 1002390033 5:178903478-178903500 CCCTTTGCCCATTTTTATATTGA 0: 1
1: 14
2: 80
3: 309
4: 1381
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390032_1002390037 8 Left 1002390032 5:178903468-178903490 CCTGTCTACACCCTTTGCCCATT 0: 1
1: 0
2: 3
3: 30
4: 268
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390034_1002390037 -3 Left 1002390034 5:178903479-178903501 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557
1002390036_1002390037 -10 Left 1002390036 5:178903486-178903508 CCATTTTTATATTGAGTTATTTA 0: 1
1: 3
2: 85
3: 602
4: 3680
Right 1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG 0: 1
1: 0
2: 3
3: 116
4: 1557

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002390037 Original CRISPR GAGTTATTTACATATAAAAG AGG Intronic
900433991 1:2618394-2618416 GAGTAATTTATAGAGAAAAGAGG - Intronic
900811843 1:4808628-4808650 GGGTAATTTACAAAGAAAAGAGG - Intergenic
900845509 1:5097264-5097286 GGGTAATTCACAAATAAAAGAGG + Intergenic
901133965 1:6980825-6980847 GAGTAATTTATAAAGAAAAGAGG - Intronic
901657770 1:10780161-10780183 GAGATATTCAGATATAAAAATGG - Intronic
902115796 1:14120108-14120130 GGGTAATTTACATAGAAAAGAGG + Intergenic
902149127 1:14428590-14428612 GAGTAATTTATAAAGAAAAGAGG + Intergenic
902541506 1:17158852-17158874 GAGCAATTTACAAAGAAAAGAGG - Intergenic
902669002 1:17959148-17959170 GGGTAATTTACAAAGAAAAGAGG - Intergenic
902854642 1:19192416-19192438 GAGATATTTACATCTCAGAGAGG + Intronic
902957063 1:19932775-19932797 GAGTAATTTATAAAGAAAAGAGG - Intergenic
903691474 1:25177005-25177027 GAGTAATTTATAAAGAAAAGAGG + Intergenic
905525938 1:38639617-38639639 GGGTAATTTACAAAGAAAAGAGG + Intergenic
905561439 1:38930326-38930348 TAGTTATTTACCTGTAAAATGGG - Intronic
905685600 1:39905331-39905353 GAGTAATTTATAAACAAAAGAGG + Intergenic
905813657 1:40931331-40931353 GGGTAATTTACAAAGAAAAGAGG + Intergenic
905964456 1:42080642-42080664 GGGTAATTCACAAATAAAAGAGG + Intergenic
906002157 1:42435712-42435734 GGTTTATTTACATGTAAAATGGG - Intronic
908579566 1:65500208-65500230 GGGTTATTTATAAAGAAAAGAGG - Intronic
908820652 1:68082934-68082956 GGGTAACTTACATAGAAAAGAGG + Intergenic
908889852 1:68833899-68833921 GAGTAATTTACAAACAAAAAAGG + Intergenic
908954709 1:69608683-69608705 GAGTGATTGACATACAGAAGTGG + Intronic
908978940 1:69930673-69930695 GGGTAATTTATATAGAAAAGAGG + Intronic
909022902 1:70452149-70452171 GGGTAATTTACAAAGAAAAGAGG + Intergenic
909112076 1:71491974-71491996 GATTAATTCACTTATAAAAGAGG + Intronic
909121943 1:71614251-71614273 GATTTATATATATATAAAACTGG - Intronic
909147183 1:71950501-71950523 GAGTTCTTTACATAGGAAATCGG - Intronic
909180380 1:72416195-72416217 GGGTAATTTACAAAGAAAAGAGG - Intergenic
909245105 1:73270849-73270871 GACTTATTTATAAATAAAATAGG - Intergenic
909377809 1:74960192-74960214 GAGTAATTTATAAAGAAAAGAGG - Intergenic
909459013 1:75887389-75887411 GAGTAATTTATAAACAAAAGAGG - Intronic
909884165 1:80919867-80919889 GAGTAATTTATAAAGAAAAGAGG + Intergenic
910103012 1:83598708-83598730 GAGTAATTTATAAAGAAAAGAGG - Intergenic
910324939 1:85995963-85995985 GAGTAATTTATAAAGAAAAGAGG - Intronic
910501687 1:87899617-87899639 AAGTTATATATATATAAAAAAGG + Intergenic
910860633 1:91739746-91739768 GGGTAATTTACAAAGAAAAGAGG + Intronic
910886682 1:91970956-91970978 GGGTAATTTACAAAGAAAAGAGG + Intronic
911222591 1:95264827-95264849 GGGTAATTTACAGAGAAAAGAGG + Intergenic
911281556 1:95935837-95935859 GAGTAATTTATAAACAAAAGAGG + Intergenic
911340004 1:96624352-96624374 GGGTAATTTACAAAGAAAAGAGG - Intergenic
912030071 1:105228944-105228966 GAGTAATTTACAAAGGAAAGAGG - Intergenic
912086717 1:106015032-106015054 GAATAATTTACAAAGAAAAGAGG + Intergenic
912521938 1:110251519-110251541 GAGTTATTTACAAAAGAAAGAGG - Intronic
912525979 1:110282954-110282976 GAGTAATTTATAAAGAAAAGAGG + Intronic
912762928 1:112385213-112385235 GGGTAATTTACACAGAAAAGAGG - Intergenic
914325962 1:146616735-146616757 TATTTATTTACATTTTAAAGAGG - Intergenic
914687133 1:149990441-149990463 GAGTTATCTACACCTAAAATAGG + Intronic
914934214 1:151964068-151964090 TAGTTATATATATATAAAACTGG - Intergenic
915090126 1:153418413-153418435 GAGTTATACAGATATAAAGGAGG + Intronic
915095368 1:153458680-153458702 GAGTTATACAGATATAAAGGAGG - Intronic
915656250 1:157363401-157363423 GAGTAATTTATAAAGAAAAGAGG - Intergenic
915665546 1:157440987-157441009 GAGTAATTTATAAAGAAAAGAGG + Intergenic
915708874 1:157874157-157874179 GAGTCATTTTCAGAGAAAAGTGG - Intronic
915961917 1:160274130-160274152 CAGCTATATACCTATAAAAGAGG + Intergenic
916152613 1:161810181-161810203 GAGTGATTTATAAAGAAAAGAGG + Intronic
916287913 1:163131384-163131406 GAGTAATTTATAAAGAAAAGAGG - Intronic
916862685 1:168823628-168823650 GAGTAATTTATAAAGAAAAGAGG + Intergenic
916982696 1:170155163-170155185 GAGTAATTTATAAAGAAAAGAGG - Intronic
917056605 1:170988875-170988897 GAGGTATTTGCATTTAAAATAGG + Intronic
917235509 1:172887951-172887973 GAGTAATTTATAAAGAAAAGAGG + Intergenic
917766216 1:178220188-178220210 GAGTAATTTATTTAAAAAAGAGG - Intronic
917877523 1:179299468-179299490 GAGTTAGCTACATAAAAAAAGGG + Intronic
918667223 1:187166568-187166590 GAGTAATTTATAAAGAAAAGAGG - Intergenic
918686234 1:187419031-187419053 GATTTATTAACATTTCAAAGGGG + Intergenic
918842774 1:189565131-189565153 GAGTAATTTACAAAGAAAAGAGG + Intergenic
918981811 1:191571127-191571149 GGGTAATTTATAAATAAAAGAGG - Intergenic
919034886 1:192293811-192293833 ACATTTTTTACATATAAAAGTGG + Intergenic
919059224 1:192609313-192609335 AAGTTAGTTACATGAAAAAGAGG - Intergenic
919089523 1:192961336-192961358 GAGTAATTTATAAAGAAAAGAGG - Intergenic
919125527 1:193388552-193388574 GAGTTATTTATAAAGAAAAGAGG + Intergenic
919176258 1:194022215-194022237 GGGTAATTTACAAAGAAAAGAGG - Intergenic
919261904 1:195207565-195207587 GAGTAATTTATAAAGAAAAGAGG - Intergenic
919273630 1:195384237-195384259 GAGTAATTTATAAACAAAAGTGG - Intergenic
919472668 1:197998405-197998427 GAGAAATTTATATAGAAAAGAGG - Intergenic
919588116 1:199464470-199464492 GAGTAATTTATAAAGAAAAGAGG + Intergenic
919598157 1:199590301-199590323 GGGTAATTTACAAAGAAAAGAGG - Intergenic
920278098 1:204823509-204823531 GGGTAATTTACAAAGAAAAGAGG - Intergenic
920592259 1:207231815-207231837 GGGTAATTTACAAATAAAAGAGG - Intergenic
921194501 1:212741689-212741711 GAGTAATTTATAAAGAAAAGAGG - Intronic
921207309 1:212859288-212859310 GAGGTATTTGTCTATAAAAGAGG + Intronic
921210977 1:212897552-212897574 GGGTAATTTATAAATAAAAGAGG + Exonic
921253169 1:213316298-213316320 GGGTAATTTACAAAGAAAAGAGG - Intergenic
921312970 1:213862658-213862680 GAGTTATTTACATGTAAACAAGG - Intergenic
921432175 1:215078384-215078406 GGGTCATTTATATAAAAAAGAGG + Intronic
921905981 1:220496059-220496081 GAGTAATTTACAAAGAAAAGAGG + Intergenic
922073418 1:222218514-222218536 GAGTAATTTGTATAGAAAAGAGG - Intergenic
922648255 1:227312992-227313014 GAGTAATTTATAGAGAAAAGAGG - Intronic
923097035 1:230783649-230783671 GACTAATTTACAAAGAAAAGAGG - Intronic
923139961 1:231152741-231152763 GGGTTATTTATAAATAAAAGAGG + Intergenic
923269756 1:232345076-232345098 GAGTAATTTATAAAGAAAAGAGG + Intergenic
923330525 1:232919597-232919619 GAGTAATTTACAAATAAAAGAGG - Intergenic
923994983 1:239484129-239484151 GAGTAATTTATAAAGAAAAGAGG + Intronic
924060974 1:240173932-240173954 TAGTTTTTTCCATATAAAAGAGG - Intronic
924176996 1:241401253-241401275 GGGTAATTTACAAAGAAAAGAGG + Intergenic
924311700 1:242750620-242750642 GATTTATTTATTTAAAAAAGTGG + Intergenic
924312495 1:242758527-242758549 GGGTAATTTATATAGAAAAGAGG - Intergenic
1063100681 10:2947125-2947147 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1063240223 10:4161658-4161680 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1063250880 10:4273036-4273058 GTGTTATTTCAAAATAAAAGAGG + Intergenic
1063301975 10:4857567-4857589 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1063310116 10:4944341-4944363 GGGTAATTTACAAAGAAAAGAGG - Intronic
1063310375 10:4946367-4946389 GGGTAATTTACAAAGAAAAGAGG - Intronic
1063316928 10:5015800-5015822 GGGTAATTTACAAAGAAAAGAGG + Intronic
1063317182 10:5017811-5017833 GGGTAATTTACAAAGAAAAGAGG + Intronic
1063523303 10:6760463-6760485 GACATATTTACTTAAAAAAGAGG + Intergenic
1063534711 10:6872218-6872240 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1064162454 10:12958131-12958153 GGGTAATTTATAAATAAAAGAGG - Intronic
1064304110 10:14149896-14149918 GGGTAATTTACAAAGAAAAGAGG + Intronic
1064534105 10:16341222-16341244 GAGTAATTTATAAAGAAAAGGGG + Intergenic
1064558899 10:16576152-16576174 GAGTAATTTACAAAGGAAAGAGG - Intergenic
1064574416 10:16729955-16729977 GGGTAATTTACAAAGAAAAGTGG + Intronic
1064722477 10:18243849-18243871 GGGTTATTTATAAAGAAAAGAGG - Intronic
1064819206 10:19306678-19306700 CAGTAATTTATACATAAAAGAGG + Intronic
1064821483 10:19339832-19339854 GGGTAATTTAAAAATAAAAGAGG + Intronic
1064896136 10:20239371-20239393 GAGTAATTTATAAACAAAAGAGG + Intronic
1064955599 10:20905320-20905342 GGGTAATTTATAAATAAAAGAGG + Intronic
1064960933 10:20964338-20964360 GGGTAATTTACAAAGAAAAGAGG + Intronic
1064969344 10:21048510-21048532 GAGTTTTAAAAATATAAAAGTGG + Intronic
1065290962 10:24229042-24229064 GAGTTTTTCACACATAACAGAGG - Intronic
1065837609 10:29673453-29673475 GAGTAATTTATACAGAAAAGAGG + Intronic
1065902925 10:30224291-30224313 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1065915569 10:30351904-30351926 GGGTAATTTACAAAGAAAAGAGG - Intronic
1066099281 10:32103379-32103401 GGGTAATTTATAAATAAAAGAGG + Intergenic
1066149877 10:32605269-32605291 GGGTAATTTATAAATAAAAGAGG - Intronic
1066295770 10:34052950-34052972 GAGAAATTTACAAAGAAAAGAGG - Intergenic
1066418820 10:35245874-35245896 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1066499007 10:35972028-35972050 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1066684355 10:37966445-37966467 GGGTAATTTACAAAGAAAAGAGG + Intronic
1067140663 10:43653689-43653711 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1067273244 10:44810690-44810712 GGGTAATTGACAAATAAAAGAGG - Intergenic
1067904976 10:50281318-50281340 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1068056064 10:52014198-52014220 GGGTAATTTATAAATAAAAGAGG + Intronic
1068100577 10:52547584-52547606 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1068107218 10:52633859-52633881 GAGTTACTTACATAACACAGAGG - Intergenic
1068789877 10:61016516-61016538 GAGTCATATACATATAAAAGAGG - Intergenic
1069095153 10:64250152-64250174 GAGTAATTTATTTAAAAAAGAGG + Intergenic
1069151446 10:64965871-64965893 GAGTAATTTACAAAATAAAGGGG - Intergenic
1069336761 10:67360563-67360585 GGGTAATTTATAAATAAAAGAGG + Intronic
1070137181 10:73705130-73705152 AAATTATTTACATAAAAAATTGG + Intergenic
1070211607 10:74328791-74328813 GAGTAATTTATAAAGAAAAGAGG - Intronic
1071070377 10:81684761-81684783 GGGTAATTTATAAATAAAAGAGG - Intergenic
1071121828 10:82287426-82287448 GGGTAATTTACAAAGAAAAGAGG - Intronic
1071910034 10:90221259-90221281 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1071915272 10:90288441-90288463 GACTTCTCTACAGATAAAAGAGG + Intergenic
1071989733 10:91089602-91089624 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1071989984 10:91092343-91092365 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1072276877 10:93832553-93832575 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1072494249 10:95939960-95939982 GGGTAATTTATAAATAAAAGAGG + Intergenic
1072506063 10:96068584-96068606 GAGTTATATACATGTGAAATGGG + Intergenic
1072558830 10:96549605-96549627 GATTTATTATTATATAAAAGTGG - Intronic
1072770080 10:98130563-98130585 GGGTAATTTATAAATAAAAGAGG + Intergenic
1072883083 10:99248005-99248027 GGGTAATTTATAAATAAAAGAGG - Intergenic
1073362538 10:102911572-102911594 GATAAATTTACAAATAAAAGGGG + Intergenic
1073588106 10:104730647-104730669 GAGTAATTTATACAGAAAAGAGG + Intronic
1073628977 10:105128925-105128947 GGGTTATTTTCAGATAAAAAAGG - Intronic
1073656070 10:105418068-105418090 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1073676718 10:105655391-105655413 GGGTAATTTATAAATAAAAGAGG - Intergenic
1073873123 10:107888989-107889011 AAGTTATTTATATACAAATGAGG + Intergenic
1073924012 10:108493138-108493160 GGGTTATTTATAAAGAAAAGAGG - Intergenic
1073939701 10:108682098-108682120 GAGTAATTTATAAATAAAAGAGG + Intergenic
1073981380 10:109157590-109157612 GAGTTATATTCAAATAAATGAGG + Intergenic
1074211583 10:111340252-111340274 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1074945527 10:118277465-118277487 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1075431085 10:122381641-122381663 GGGTAATTTACAAAGAAAAGAGG - Intronic
1075434184 10:122420520-122420542 GAGATATTTACAGATGAAATGGG - Intronic
1075661375 10:124199327-124199349 CAGACATTTACATATAAAAACGG + Intergenic
1075809060 10:125211258-125211280 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1076148698 10:128145789-128145811 GAGTAATTTACAAAGAAAAAAGG - Intergenic
1076281786 10:129252570-129252592 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1076310613 10:129504563-129504585 GAGCTATCGACATTTAAAAGGGG - Intronic
1077381349 11:2240463-2240485 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1077646076 11:3925789-3925811 GAGTTAATTAGTTATAATAGAGG + Intronic
1077652923 11:3990510-3990532 GAGTATTTTCCATATAAAAATGG + Intronic
1077744851 11:4891183-4891205 GGGTAATTTACAAAGAAAAGAGG + Intronic
1077750352 11:4960744-4960766 TATTTATTTACATTTAAAAAGGG + Intronic
1078042280 11:7878970-7878992 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1078443235 11:11384956-11384978 GGGTAATTTACAAAGAAAAGAGG + Intronic
1078512134 11:11992819-11992841 GGGTAATTTACAAAGAAAAGAGG - Intronic
1078576101 11:12503877-12503899 GGGTAATTTATAAATAAAAGAGG + Intronic
1078650826 11:13190696-13190718 GAGTAATTTACAAAGGAAAGAGG + Intergenic
1078718104 11:13858824-13858846 GGGTCATTTATAAATAAAAGAGG + Intergenic
1078750320 11:14155311-14155333 GGGTAATTTACAAAGAAAAGAGG + Intronic
1079208388 11:18438081-18438103 GAGTAATTTATAAAGAAAAGGGG + Intronic
1079249739 11:18778749-18778771 GAGTAATTTATAAAGAAAAGAGG - Intronic
1079267524 11:18948438-18948460 GAGTTAAATAAATTTAAAAGAGG + Intergenic
1079282622 11:19101204-19101226 GGGTAATTTACAAAGAAAAGGGG + Intergenic
1079538766 11:21546703-21546725 GCGTAATTTACAAAGAAAAGAGG - Intronic
1079552440 11:21716271-21716293 GTGTCATTTACAAAGAAAAGAGG - Intergenic
1079615129 11:22482635-22482657 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1079717439 11:23765967-23765989 GAATTATTAACATATAAATATGG + Intergenic
1079842601 11:25423429-25423451 GAGTAATTTGTAAATAAAAGAGG + Intergenic
1079962535 11:26941895-26941917 GAGCAATTTACAAAGAAAAGAGG + Intergenic
1080165166 11:29226990-29227012 GAGGTATTAACACATAAGAGAGG - Intergenic
1080223241 11:29931464-29931486 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1080367980 11:31599567-31599589 GGGTCATTTACAAACAAAAGAGG + Intronic
1080471049 11:32546093-32546115 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1080495246 11:32811527-32811549 GGGTAATTTATATAGAAAAGAGG + Intergenic
1080502230 11:32881973-32881995 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1080812169 11:35715698-35715720 GGGTAATTTACAAAGAAAAGAGG + Intronic
1080990137 11:37522568-37522590 GGGTAATTTACAGAGAAAAGAGG - Intergenic
1081005582 11:37733147-37733169 GAGTAATTTATAAACAAAAGAGG - Intergenic
1081327731 11:41766738-41766760 GAGTAATTTACAATGAAAAGAGG + Intergenic
1081360132 11:42167041-42167063 GATTTATTTATAAATAAAATTGG - Intergenic
1081364212 11:42214757-42214779 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1081919025 11:46755505-46755527 TAGTTATTTATATTTAAATGGGG - Intronic
1083069534 11:59962408-59962430 TATTTGTTTACAAATAAAAGAGG - Intergenic
1084963599 11:72731582-72731604 GAGTAATTTATAAAGAAAAGAGG - Intronic
1085811239 11:79683166-79683188 GGGTAATTTACAAAGAAAAGGGG - Intergenic
1085958166 11:81426842-81426864 GAGTGATTTACAAAGAAAAGAGG + Intergenic
1086062003 11:82709252-82709274 GAGTAATTTACAGAAAAAAGAGG + Intergenic
1086126417 11:83352966-83352988 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1086402957 11:86475442-86475464 GGGTAATTTACAAAGAAAAGAGG - Intronic
1086584664 11:88437025-88437047 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1086794771 11:91085711-91085733 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1086964790 11:93016634-93016656 GAGTCATTTATAAAGAAAAGAGG + Intergenic
1087123847 11:94603312-94603334 CACTTATATACACATAAAAGAGG + Intronic
1087274964 11:96151804-96151826 GAGTAATTTATAAACAAAAGAGG - Intronic
1087341962 11:96917142-96917164 GAGTAATTTACAAAAGAAAGAGG - Intergenic
1087429387 11:98033151-98033173 GGGTAATTTATAAATAAAAGAGG - Intergenic
1087651510 11:100874043-100874065 GAGTAATTTACAAAGAAAAGAGG + Intronic
1088059440 11:105628651-105628673 GAGTAATTTACAAAGGAAAGAGG - Intronic
1088164945 11:106923651-106923673 CAAATATTGACATATAAAAGGGG + Intronic
1088405576 11:109473338-109473360 GAGTTATCAACATATTAAAGAGG + Intergenic
1088943019 11:114479808-114479830 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1089132278 11:116222138-116222160 GAGTAATTTACAAAGGAAAGAGG + Intergenic
1089383753 11:118054734-118054756 TATTTATTTACATTTCAAAGGGG - Intergenic
1089827291 11:121289998-121290020 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1089931828 11:122320535-122320557 GAGTTATTTTAAAATAAGAGCGG - Intergenic
1090105004 11:123843982-123844004 GAGTAATTTTCAAATGAAAGTGG + Intergenic
1090182044 11:124708342-124708364 GATTTATTTACTTAGAAAGGTGG + Intergenic
1090507154 11:127328388-127328410 GCGTGATTTATATAGAAAAGAGG - Intergenic
1090569076 11:128027848-128027870 GGGTAATTTATAAATAAAAGAGG + Intergenic
1090588453 11:128238605-128238627 TAGTTATTTACATCCAGAAGAGG + Intergenic
1090687036 11:129132977-129132999 GGGTAATTTACAAAGAAAAGGGG + Intronic
1090956837 11:131520855-131520877 GAGTAATTTATAAATAGAAGAGG + Intronic
1090970476 11:131638186-131638208 GCATTATTTTCATATAAGAGAGG + Intronic
1091306713 11:134541014-134541036 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1091314639 11:134604908-134604930 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1091385833 12:94024-94046 GAGTAACTTACAAAGAAAAGAGG - Intronic
1092061027 12:5550371-5550393 GAGTAATTTATAGAGAAAAGAGG - Intronic
1092656228 12:10687875-10687897 GTGTAATTTACAAAGAAAAGAGG - Intergenic
1092674340 12:10899724-10899746 GAGTAATTTATAAATAAAAGAGG - Intronic
1092789105 12:12056499-12056521 CAGTTATTTACAGATAACACAGG - Intronic
1093012985 12:14128094-14128116 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1093140601 12:15506461-15506483 GAGTAATTTACAAAGGAAAGAGG + Intronic
1093177732 12:15932039-15932061 GGGTAATTTACAAAGAAAAGGGG - Intronic
1093281981 12:17205240-17205262 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1093339431 12:17953599-17953621 AATTTATTTCCATATAACAGCGG + Intergenic
1093368667 12:18337464-18337486 GAGTAATTTATAAAGAAAAGAGG + Intronic
1093666725 12:21823141-21823163 GAATTATCTACATTCAAAAGAGG + Intronic
1093989083 12:25569885-25569907 GGGTAATTTATAAATAAAAGAGG - Intronic
1094068145 12:26383284-26383306 GGGTAATTTACAAAGAAAAGAGG - Intronic
1094071374 12:26417672-26417694 GAGTAATTTATAAACAAAAGAGG - Intronic
1094322691 12:29202867-29202889 GGGTAATTTACAAAGAAAAGAGG - Intronic
1094422695 12:30288573-30288595 AAGTTCTTTACATATCTAAGTGG - Intergenic
1094677711 12:32637289-32637311 GGGTTATTTATAAATAAAGGAGG + Intronic
1094736225 12:33237316-33237338 GGGTAATATACAAATAAAAGAGG - Intergenic
1095361817 12:41351436-41351458 GGGTAATTTACAAAGAAAAGAGG + Intronic
1095378493 12:41560002-41560024 GGGTAATTTACAAAGAAAAGAGG - Intronic
1095516985 12:43016632-43016654 GAGTAATTTATAAAGAAAAGGGG - Intergenic
1095520490 12:43058565-43058587 GAGTAATTTATAAAAAAAAGAGG - Intergenic
1095530451 12:43181295-43181317 GAGTAATTTATAAATGAAAGAGG + Intergenic
1095639132 12:44467020-44467042 GGGTAATTTATAAATAAAAGAGG - Intergenic
1095643742 12:44517511-44517533 GGGTAATTTACAAAGAAAAGGGG - Intronic
1095681463 12:44981410-44981432 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1095871280 12:47030792-47030814 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1095907921 12:47396695-47396717 CAGTAATTTACAAAGAAAAGGGG + Intergenic
1096043567 12:48542187-48542209 GCATTATTTAGATAGAAAAGGGG + Intergenic
1096373052 12:51084371-51084393 TATTTATTTAAATAGAAAAGGGG + Intergenic
1096544800 12:52330601-52330623 GGGTAATTTACAAAGAAAAGGGG - Intergenic
1096608193 12:52782591-52782613 GGGTTCTTTACATGTCAAAGTGG - Intergenic
1097139434 12:56887497-56887519 GGGTTATTTATAAAGAAAAGAGG - Intergenic
1097552322 12:61090335-61090357 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1097558004 12:61165418-61165440 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1097576411 12:61398999-61399021 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1097717440 12:62981771-62981793 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1097734256 12:63164782-63164804 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1098039763 12:66341924-66341946 GAGTAATTTATAAAGAAAAGAGG - Exonic
1098088461 12:66874485-66874507 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1098656678 12:73039715-73039737 GGGTAATTTATAAATAAAAGAGG - Intergenic
1098836554 12:75430085-75430107 GGGTAATTTACAAAGAAAAGAGG - Intronic
1099085398 12:78240712-78240734 GAGTTCTCAACATAGAAAAGAGG + Intergenic
1099397540 12:82159319-82159341 GGGTAATTTACAAACAAAAGAGG - Intergenic
1099419846 12:82443583-82443605 GAGTAATTTATAAAGAAAAGAGG + Intronic
1099433927 12:82620728-82620750 GAGTAATTTACAAATGAAAGAGG + Intergenic
1099621428 12:85006520-85006542 GGGTAATTTATATAGAAAAGAGG - Intergenic
1099708993 12:86195924-86195946 GAAATATTTACATATAATATGGG - Intronic
1099767531 12:87006993-87007015 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1099856159 12:88169635-88169657 TAGTTCTTTACAAATAAAATGGG - Intronic
1099926035 12:89018955-89018977 GATTTATTAAAACATAAAAGGGG - Intergenic
1100047819 12:90405631-90405653 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1100052045 12:90460770-90460792 GAGTAATTTATAAAAAAAAGAGG + Intergenic
1100067688 12:90669819-90669841 GTGTAATTTATAAATAAAAGAGG - Intergenic
1100217837 12:92470793-92470815 GAATTATTTAAATAAAAAAGTGG - Intergenic
1100380961 12:94061251-94061273 GGGTAATTTATAAATAAAAGAGG - Intergenic
1100792145 12:98142430-98142452 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1100895881 12:99182037-99182059 GAGTAATTTATAAACAAAAGAGG + Intronic
1100900007 12:99227404-99227426 GAGTGATTTATAAAGAAAAGAGG - Intronic
1100900579 12:99236323-99236345 GGGTTATTTATAAAGAAAAGAGG + Intronic
1101142551 12:101811461-101811483 GAGTAATTTATAAATAAAAGAGG + Intronic
1101308206 12:103552774-103552796 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1101429332 12:104613703-104613725 GAGTAATTTACAAAGAAAAGAGG - Intronic
1101690655 12:107077024-107077046 GAGTTATATATAAAGAAAAGAGG - Intronic
1101821666 12:108189037-108189059 GCGTTACTTATTTATAAAAGAGG + Intronic
1101840251 12:108322810-108322832 GAGTAATTTACTAAGAAAAGAGG - Intronic
1102497495 12:113329678-113329700 GAGTTAGTGACATAGGAAAGAGG - Intronic
1102500228 12:113347015-113347037 GAGTAATTTATAAAGAAAAGAGG - Intronic
1103163103 12:118747162-118747184 GAGCTCTTTACATATGACAGAGG + Intergenic
1103532883 12:121614634-121614656 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1104145364 12:126028955-126028977 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1104189656 12:126467754-126467776 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1104260052 12:127173959-127173981 GGGTAATTTATAAATAAAAGGGG + Intergenic
1104363178 12:128153105-128153127 GGGTAATTTACAAATAAAAGAGG + Intergenic
1104466941 12:128998172-128998194 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1104468454 12:129008738-129008760 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1104549342 12:129742219-129742241 GAGTAATTTATAAAGAAAAGAGG + Intronic
1105229374 13:18475812-18475834 GGGTTATTTGAAGATAAAAGAGG + Intergenic
1105434820 13:20367405-20367427 GGGTTATTTATAAATAAAAAAGG + Intergenic
1105576784 13:21661236-21661258 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1105901482 13:24758138-24758160 GGGTAATTTACAAATAAAAGAGG - Intergenic
1105970586 13:25426153-25426175 GGGTAATTTATAGATAAAAGAGG + Intronic
1106034898 13:26034805-26034827 CATTTATTGAAATATAAAAGAGG - Intergenic
1106532577 13:30607547-30607569 GGGTAATTTACAAAGAAAAGAGG - Intronic
1106732464 13:32555779-32555801 GAGTAATTTAGAAACAAAAGAGG + Intergenic
1106861271 13:33911498-33911520 GAGTAATTTATAAAAAAAAGAGG + Intronic
1106898663 13:34332492-34332514 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1106964971 13:35052971-35052993 GAAGTGTTAACATATAAAAGGGG - Intronic
1107008649 13:35644707-35644729 GAATTATTTGCAAAGAAAAGTGG - Intronic
1107063162 13:36183222-36183244 GAGTAATTTATAAAGAAAAGAGG - Intronic
1107226237 13:38050906-38050928 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1107230847 13:38108548-38108570 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1107425635 13:40289961-40289983 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1107531548 13:41287152-41287174 CAGTTATTTATAAAGAAAAGAGG + Intergenic
1107641541 13:42448331-42448353 GGGTAATTTATATAGAAAAGAGG - Intergenic
1107976759 13:45695954-45695976 GAGGAATTTACATAGAACAGGGG - Intergenic
1108049489 13:46417879-46417901 TAGATATTTACATAAAAATGAGG + Intronic
1108087148 13:46805263-46805285 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1108263885 13:48685071-48685093 GGGTAATTTATAAATAAAAGAGG + Intronic
1108278968 13:48841696-48841718 GAGTTATTTTCATCTTAACGGGG - Intergenic
1108279782 13:48849872-48849894 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1108799369 13:54075022-54075044 AAATTATTTGCATATAAAGGAGG - Intergenic
1108883865 13:55155756-55155778 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1108942355 13:55972382-55972404 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1108993854 13:56699539-56699561 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1109009557 13:56923024-56923046 GGGTAATTTATAAATAAAAGAGG + Intergenic
1109048948 13:57452771-57452793 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1109123007 13:58482393-58482415 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1109238523 13:59853639-59853661 GAGTAATTTATAAAGAAAAGTGG - Intronic
1109384720 13:61611261-61611283 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1109401115 13:61829734-61829756 GGGTAATTTATATAGAAAAGAGG - Intergenic
1109542010 13:63791162-63791184 TAGATATTTACATAAAAATGAGG + Intergenic
1109616361 13:64838202-64838224 GGGTAATTTATAAATAAAAGAGG - Intergenic
1109682830 13:65774973-65774995 GAGTCATCTACATAGAAAACAGG + Intergenic
1109817276 13:67601929-67601951 GGGTAATTTATAAATAAAAGAGG + Intergenic
1109946646 13:69442916-69442938 GGGTAATTTATAAATAAAAGAGG - Intergenic
1110028416 13:70571831-70571853 GAGTGATTTATAAAGAAAAGAGG - Intergenic
1110084042 13:71354875-71354897 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1110130459 13:72002572-72002594 GGGTAATTTATAAATAAAAGAGG + Intergenic
1110169155 13:72479722-72479744 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1110391972 13:74984487-74984509 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1110489363 13:76085976-76085998 GGGTAATTTATAAATAAAAGAGG + Intergenic
1110663090 13:78081714-78081736 GAGTTTTTTAAATTTAAAGGAGG + Intergenic
1110902354 13:80838569-80838591 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1110927089 13:81166858-81166880 GGGTTATTTATAAAGAAAAGAGG + Intergenic
1110933747 13:81257085-81257107 AGGTAATTTACAAATAAAAGAGG + Intergenic
1111030361 13:82589707-82589729 GGGTAATTTACAAATGAAAGAGG - Intergenic
1111093264 13:83474975-83474997 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1111107950 13:83670298-83670320 GTGTAATTTACAAAGAAAAGAGG - Intergenic
1111137150 13:84062826-84062848 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1111148291 13:84214421-84214443 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1111177234 13:84611110-84611132 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1111505325 13:89182731-89182753 GGGTAATTTATAAATAAAAGAGG + Intergenic
1111574255 13:90130689-90130711 GAATAATTTACATATACAATAGG - Intergenic
1111739692 13:92188285-92188307 GACTTATTGACAGATGAAAGGGG + Intronic
1111759426 13:92443000-92443022 GGGTAATTTATAAATAAAAGAGG + Intronic
1111909397 13:94293517-94293539 GGGTAATTTACAAAGAAAAGAGG - Intronic
1112104517 13:96226177-96226199 GATTTATGTACATTTCAAAGAGG + Intronic
1112136764 13:96587436-96587458 GAGTAATTTACAAAGAAAATAGG + Intronic
1112286224 13:98106925-98106947 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1112582263 13:100686590-100686612 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1112651441 13:101403048-101403070 GATTTTTTTTTATATAAAAGAGG - Intronic
1112800012 13:103100187-103100209 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1112885294 13:104162903-104162925 GAGTAATTTATACAGAAAAGAGG - Intergenic
1113062526 13:106338460-106338482 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1113702825 13:112399767-112399789 GAGTAATTTATAAAGAAAAGAGG + Intronic
1113711920 13:112471047-112471069 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1114013639 14:18402705-18402727 GGGTTATTTGAAGATAAAAGAGG + Intergenic
1114033152 14:18593983-18594005 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1114125791 14:19723782-19723804 GAGTAATTTATAAAGAAAAGAGG + Intronic
1114366219 14:22029553-22029575 GAATAATGTCCATATAAAAGAGG + Intergenic
1114649688 14:24276589-24276611 CAGTTATTTACATTTAAATTAGG - Intergenic
1114826406 14:26086169-26086191 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1114942069 14:27624710-27624732 GAGTAATTTACAAAGGAAAGAGG + Intergenic
1114978218 14:28128144-28128166 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1114982640 14:28185098-28185120 GTGTTAATTAAAAATAAAAGGGG + Intergenic
1115035882 14:28855720-28855742 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1115068665 14:29295662-29295684 GGGTTATTTATAAAGAAAAGAGG - Intergenic
1115122224 14:29951178-29951200 GGGTGATTTACAAAGAAAAGAGG - Intronic
1115134453 14:30091844-30091866 GGGTAATTTACAGAGAAAAGAGG + Intronic
1115150302 14:30276806-30276828 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1115505130 14:34086561-34086583 GAGTAATTTATAAAGAAAAGAGG + Intronic
1116184390 14:41578053-41578075 GGGTAATTTATAAATAAAAGAGG - Intergenic
1116195076 14:41715221-41715243 GACTTATTTAAAAATCAAAGAGG + Intronic
1116319950 14:43448849-43448871 GGGTAATTTATATAGAAAAGGGG + Intergenic
1116332992 14:43618417-43618439 GGGTAATTTACAAATAAAAGAGG - Intergenic
1116408708 14:44598185-44598207 GGGTAATTTACAAATAAAAGAGG + Intergenic
1116422752 14:44752070-44752092 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1116641850 14:47473539-47473561 GTGTTTTTTACATTTAAAAGAGG - Intronic
1116667908 14:47801072-47801094 GAGTTTTCTACACACAAAAGAGG - Intergenic
1116721199 14:48498094-48498116 AATTTATGTACTTATAAAAGAGG + Intergenic
1116742810 14:48777629-48777651 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1116973087 14:51087974-51087996 GAGTTATTTACAATAGAAAGGGG + Intronic
1116975320 14:51109615-51109637 GGGTTATTTATAAAGAAAAGAGG + Intergenic
1117160751 14:52987032-52987054 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1117165501 14:53028715-53028737 GAGTGATTTACAAAGAAAAGAGG - Intergenic
1117229289 14:53698890-53698912 GGGTAATTTACAAACAAAAGAGG - Intergenic
1117506218 14:56405725-56405747 GGGTAATTTATATAGAAAAGAGG + Intergenic
1117613022 14:57503714-57503736 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1117888555 14:60392230-60392252 GAGTCATTTATAAAGAAAAGAGG - Intergenic
1118046614 14:61977359-61977381 GAGTAATTTATAAATGAAAGAGG + Intergenic
1118070771 14:62244825-62244847 GGGTGATTTACAAAGAAAAGAGG - Intergenic
1118269442 14:64328622-64328644 GAGTAATTTATAAAGAAAAGAGG + Intronic
1118341586 14:64898173-64898195 AAGTAATTTACACACAAAAGCGG - Intergenic
1118368472 14:65115660-65115682 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1118824224 14:69365989-69366011 GTGTTATGTACAAATAAAACGGG + Intergenic
1119081157 14:71695322-71695344 GAGTTATATAAATGCAAAAGAGG + Intronic
1119103335 14:71900754-71900776 GGGTAATTTAAATAGAAAAGAGG + Intergenic
1119148990 14:72341103-72341125 GTGTTATTTATAAAGAAAAGAGG + Intronic
1119290075 14:73488651-73488673 GAGTAATTTATAAAGAAAAGAGG - Intronic
1119755227 14:77113034-77113056 AAGTTATTTTCAGGTAAAAGAGG + Intronic
1120041480 14:79758246-79758268 GAGTAATTTACAAAGAAAAGAGG + Intronic
1120294573 14:82623531-82623553 TTCTTCTTTACATATAAAAGAGG + Intergenic
1120392459 14:83925469-83925491 GGGTAATTTACAAATAAAAGAGG - Intergenic
1120623168 14:86791239-86791261 GAGTAATTTATAAACAAAAGAGG - Intergenic
1120671492 14:87367308-87367330 GTGTTATTTAATCATAAAAGGGG + Intergenic
1120682056 14:87491800-87491822 CAGTAATTTATAAATAAAAGAGG + Intergenic
1121054356 14:90840670-90840692 GGGTAATTTATATAGAAAAGAGG - Intergenic
1121254573 14:92521711-92521733 GGGTAATTTACAAAGAAAAGAGG - Intronic
1121288273 14:92753537-92753559 GGGTAATTTATAAATAAAAGAGG - Intergenic
1121383493 14:93495203-93495225 GAGTAATTTATAAAGAAAAGAGG + Intronic
1122039948 14:98980015-98980037 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1122121927 14:99559143-99559165 GGGTAATTTATAAATAAAAGAGG - Intronic
1122390676 14:101380526-101380548 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1123161569 14:106283100-106283122 AAGTGATTTACAAAGAAAAGAGG - Intergenic
1123176730 14:106426800-106426822 AAGTGATTTACAAAGAAAAGAGG + Intergenic
1123213500 14:106784331-106784353 AAGTAATTTACAAATAAAAGAGG + Intergenic
1123214276 14:106792014-106792036 GAGTAATTCACATAGAAAATAGG - Intergenic
1202892142 14_KI270722v1_random:168664-168686 GAGTAATTTAGAAAGAAAAGAGG + Intergenic
1202946984 14_KI270726v1_random:37145-37167 AAGTGATTTACAAAGAAAAGAGG - Intergenic
1123451405 15:20363941-20363963 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1123569026 15:21583081-21583103 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1123605136 15:22018402-22018424 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1123848924 15:24334024-24334046 GGGTAATTTATATAGAAAAGAGG + Intergenic
1124507313 15:30289535-30289557 AGGTAATTTACAAATAAAAGAGG - Intergenic
1124601793 15:31138859-31138881 TAATTATTTACATATAGAAAGGG - Intronic
1124601964 15:31140737-31140759 GAGTAATTTATAAAGAAAAGAGG - Intronic
1124733267 15:32218715-32218737 GGGTAATTTACAAAGAAAAGTGG + Intergenic
1124736242 15:32249124-32249146 AGGTAATTTACAAATAAAAGAGG + Intergenic
1124889187 15:33716221-33716243 GAGTAATTTATAAAGAAAAGAGG - Intronic
1125074790 15:35601656-35601678 TATTTATATATATATAAAAGGGG + Intergenic
1125150176 15:36522058-36522080 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1125153835 15:36563718-36563740 GGGTAATTTATAGATAAAAGAGG - Intergenic
1125878595 15:43171484-43171506 TAGTTATTCCAATATAAAAGTGG - Intronic
1125969158 15:43898026-43898048 GAGTAATTTATAAAGAAAAGAGG - Intronic
1125981449 15:44005516-44005538 GGGTAATTTACAAAGAAAAGAGG + Intronic
1126064021 15:44811366-44811388 GGGTAATTTATAAATAAAAGAGG + Intergenic
1126238846 15:46417608-46417630 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1126490502 15:49231115-49231137 GGGTAATTTATAAATAAAAGAGG + Intronic
1126933225 15:53677724-53677746 GGGTAATTTACAAAGAAAAGAGG - Intronic
1127474171 15:59316904-59316926 AAGTTATTTACATTTAGGAGTGG - Intronic
1127542322 15:59952937-59952959 GATTAATTTCCTTATAAAAGAGG - Intergenic
1127744014 15:61945197-61945219 GGGTAATTTACAAAGAAAAGAGG - Intronic
1128659880 15:69491092-69491114 GACTTATTTGCCTATCAAAGTGG - Intergenic
1129033226 15:72633264-72633286 GGGTAATTTATAAATAAAAGAGG + Intergenic
1129479748 15:75814237-75814259 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1129636541 15:77324557-77324579 GAGTAATTTATAAAGAAAAGAGG + Intronic
1129926886 15:79372463-79372485 GGGTAATTTACAAAGAAAAGAGG + Intronic
1129958733 15:79663963-79663985 GTGTTATTTACAAAGAAAAGAGG + Intergenic
1130026243 15:80272933-80272955 GGGTAATTTATAAATAAAAGAGG - Intergenic
1130448643 15:84029031-84029053 GAGTAATTTACAAAGGAAAGAGG - Intronic
1130679855 15:85987163-85987185 TTGTTATTTACATATTAAAGTGG - Intergenic
1130701702 15:86189767-86189789 GGGTAATTTACACAGAAAAGAGG - Intronic
1130731392 15:86496344-86496366 GGGTGATTTACAAACAAAAGAGG - Intronic
1130747183 15:86667877-86667899 GAGTAATTTATAAAGAAAAGAGG + Intronic
1130917212 15:88314572-88314594 GAGTAATTTACAAAAGAAAGAGG + Intergenic
1130992556 15:88884796-88884818 GGGAGATTTGCATATAAAAGAGG + Intronic
1131338215 15:91570861-91570883 GGGTGATTTATAAATAAAAGAGG - Intergenic
1131409917 15:92198995-92199017 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1131722620 15:95187279-95187301 GAGTAATTTATAAACAAAAGAGG - Intergenic
1131847483 15:96503327-96503349 GAGTAATTTATAAACAAAAGAGG + Intergenic
1132020545 15:98358112-98358134 GATTAATTTTCTTATAAAAGAGG + Intergenic
1132118092 15:99152329-99152351 GAGTAATTTATAAAGAAAAGAGG - Intronic
1132197291 15:99925201-99925223 GAGATCATTACATATAAAAATGG - Intergenic
1132199996 15:99944753-99944775 TAGTTATTTTCATCAAAAAGTGG + Intergenic
1202977381 15_KI270727v1_random:310171-310193 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1133077825 16:3293387-3293409 GCGTAATTTACAAACAAAAGAGG - Intronic
1133103213 16:3491564-3491586 GGGTTATTTATAAACAAAAGAGG + Intergenic
1133436409 16:5784003-5784025 GGGTAATTTATAAATAAAAGAGG + Intergenic
1133593268 16:7266473-7266495 GAGTAATTTATAAACAAAAGAGG - Intronic
1133662249 16:7929488-7929510 GAGTAATTTATAAAGAAAAGGGG - Intergenic
1133819407 16:9223173-9223195 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1134008965 16:10837069-10837091 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1134566587 16:15257065-15257087 GAGTAATTTACAAAGGAAAGAGG + Intergenic
1134594355 16:15483898-15483920 GGGTAATTTATAAATAAAAGAGG + Intronic
1134735909 16:16499634-16499656 GAGTAATTTACAAAGGAAAGAGG - Intergenic
1134931612 16:18212520-18212542 GAGTAATTTACAAAGGAAAGAGG + Intergenic
1135151695 16:20012623-20012645 GGGTAATTTATAAATAAAAGAGG + Intergenic
1135276386 16:21116552-21116574 GAGTAATTTACAAAAGAAAGAGG - Intronic
1135670050 16:24367588-24367610 GGGTAATTTATATATAACAGAGG - Intergenic
1136005977 16:27329288-27329310 GAGTAATTTACAAAGAAAAGAGG - Intronic
1136036267 16:27542893-27542915 GGGTAATTTACAAAGAAAAGAGG - Intronic
1137265970 16:46869378-46869400 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1137542487 16:49374427-49374449 GAGAGATTTACATCTCAAAGGGG + Intronic
1137566452 16:49535698-49535720 CAGTTCTTTACAGGTAAAAGGGG - Intronic
1137746990 16:50829603-50829625 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1137749678 16:50850311-50850333 TAGATATCTACATAAAAAAGAGG - Intergenic
1137806336 16:51309525-51309547 GGGTAATTTACAAATGAAAGAGG - Intergenic
1137816374 16:51401650-51401672 GATCTATGTATATATAAAAGGGG + Intergenic
1138038599 16:53634807-53634829 GGGTAATTTACAAAGAAAAGTGG - Intronic
1138075756 16:54041156-54041178 GAGTAATTTACAAAGGAAAGAGG + Intronic
1138364779 16:56465980-56466002 TATTTGTTTACTTATAAAAGAGG + Intronic
1138518630 16:57556076-57556098 GAGTAATTTATAAAGAAAAGAGG - Intronic
1138621986 16:58218897-58218919 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1138804451 16:60077943-60077965 GGGTAATTTACAAATAAAAAAGG + Intergenic
1138945943 16:61850086-61850108 GGGTAATTTACAAAGAAAAGAGG + Intronic
1139184075 16:64783487-64783509 GAGGTAATTACATTTAAATGAGG + Intergenic
1139362852 16:66413139-66413161 GAGTGATTTATAAAGAAAAGAGG - Intergenic
1140007604 16:71094207-71094229 TATTTATTTACATTTTAAAGAGG + Intronic
1140139011 16:72236932-72236954 AAGTATTTTGCATATAAAAGGGG - Intergenic
1140568859 16:76078290-76078312 GGGTCATTTACAAACAAAAGAGG + Intergenic
1140804460 16:78520292-78520314 GAATTTTTTAGATGTAAAAGTGG + Intronic
1141125231 16:81396447-81396469 GAGTAATGTACATGGAAAAGAGG + Intergenic
1141384134 16:83603781-83603803 GGGTAATTTACAAAGAAAAGAGG + Intronic
1141492732 16:84385609-84385631 GAGTAATTTACAAAGAAAAGAGG + Intronic
1142414286 16:89933035-89933057 AAGTGATTTCCATATCAAAGTGG + Intronic
1143326739 17:6103983-6104005 GAGTAATTTATAAAGAAAAGAGG + Intronic
1143738097 17:8928053-8928075 GAGTCATTTATAAATAAAAGAGG - Intronic
1143935979 17:10484621-10484643 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1144141631 17:12355187-12355209 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1144357770 17:14462269-14462291 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1144375976 17:14641915-14641937 GGGTTATTTAGAAATAAAAGAGG - Intergenic
1144424214 17:15126073-15126095 GAGTAATTTATAGAGAAAAGAGG - Intergenic
1144468489 17:15516133-15516155 GGGTAATTTACAAAGAAAAGAGG - Intronic
1144519074 17:15942457-15942479 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1145949301 17:28803645-28803667 GAATTATTTACATATACTATGGG + Intronic
1146099336 17:29964087-29964109 GAGTAATTTACAAAGAAAAGAGG - Intronic
1146287318 17:31582599-31582621 AAGTTATTAACAGAAAAAAGAGG - Intergenic
1146542723 17:33711550-33711572 GAGTAATTTATAAAGAAAAGAGG + Intronic
1146753941 17:35409340-35409362 GAATTATATATATATCAAAGTGG - Intergenic
1147641381 17:42003180-42003202 GACTTATTTTCATAGAAACGTGG + Intronic
1148198388 17:45731167-45731189 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1148529208 17:48373110-48373132 GGGTAATTTATAAATAAAAGAGG + Intronic
1149143298 17:53459201-53459223 GAGTAATTTACAAAGGAAAGAGG - Intergenic
1149164025 17:53727954-53727976 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1149342506 17:55701220-55701242 GAGTAATTTATGAATAAAAGAGG + Intergenic
1149469338 17:56903091-56903113 GAGTAATTTATAAAGAAAAGAGG - Intronic
1149856081 17:60084089-60084111 GAGATATTTTCACAGAAAAGGGG + Intergenic
1150546675 17:66165576-66165598 GTATCATTTACATATAAAAGTGG + Intronic
1150933532 17:69611055-69611077 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1150997185 17:70332246-70332268 GAGTAATTTACAAACAAAAGAGG + Intergenic
1151102448 17:71571571-71571593 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1151354011 17:73547840-73547862 GGGTAATTTACAAAGAAAAGAGG + Intronic
1151874783 17:76861429-76861451 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1152999814 18:444066-444088 GGGTAATTTATAAATAAAAGAGG - Intronic
1153085783 18:1285128-1285150 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1153216410 18:2825000-2825022 GGGTTATTTATAAAGAAAAGAGG + Intergenic
1153276129 18:3369360-3369382 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1153525743 18:5992872-5992894 GAGTAATTTATAAAGAAAAGAGG - Intronic
1153952004 18:10065317-10065339 GGGTAATTTACAGAGAAAAGAGG - Intergenic
1153958156 18:10116049-10116071 GAATTATTCACATATTAAAAGGG + Intergenic
1154508553 18:15068709-15068731 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1155170565 18:23264176-23264198 GGGTAATTTACAAAGAAAAGAGG + Intronic
1155414821 18:25586422-25586444 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1155636239 18:27958979-27959001 GAGTGATTTACAAAGGAAAGAGG - Intronic
1155723839 18:29054126-29054148 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1155760628 18:29561084-29561106 GAATTATTTACACACATAAGTGG + Intergenic
1155917234 18:31568707-31568729 GGGTAATTTATATAGAAAAGAGG - Intergenic
1156194488 18:34758693-34758715 AAGATATTTACATCTCAAAGGGG + Intronic
1156223610 18:35079825-35079847 AAGTTATTCAAGTATAAAAGAGG + Intronic
1156637780 18:39051679-39051701 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1156670814 18:39466747-39466769 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1156764083 18:40630294-40630316 GGGTTCTTTATATATAGAAGAGG - Intergenic
1156866229 18:41891649-41891671 GGGTAATTTACAGAGAAAAGTGG - Intergenic
1156906836 18:42362779-42362801 CAGTAAATAACATATAAAAGAGG - Intergenic
1156914479 18:42448893-42448915 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1156995226 18:43457717-43457739 GAGTAATTTATAAAGAAAAGTGG - Intergenic
1157080463 18:44519187-44519209 CAGTTATTTATTTATAAAATGGG - Intergenic
1157094137 18:44671869-44671891 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1157379208 18:47196018-47196040 GAGTAATTTATAAACAAAAGAGG + Intergenic
1157657657 18:49407378-49407400 GAGTAATTTATAAAGAAAAGAGG + Intronic
1157893429 18:51441066-51441088 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1157893798 18:51444619-51444641 GATTTATTTACATTTAGAAAAGG + Intergenic
1158348045 18:56535606-56535628 AATTTATATATATATAAAAGAGG - Intergenic
1158455043 18:57598580-57598602 GGGTAATTTACAAAGAAAAGTGG - Intergenic
1158803100 18:60936658-60936680 GGGTAATTTATATAGAAAAGAGG + Intergenic
1159004880 18:63002842-63002864 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1159043008 18:63343113-63343135 GGGTAATTTACACGTAAAAGAGG - Intronic
1159126937 18:64235042-64235064 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1159157188 18:64600486-64600508 GGGCAATTTACAAATAAAAGAGG + Intergenic
1159186160 18:64977175-64977197 GAGGTATTTACATCTATAAGTGG + Intergenic
1159196605 18:65123462-65123484 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1159360643 18:67397206-67397228 GAGTGATTTATAAAGAAAAGAGG - Intergenic
1159377137 18:67606803-67606825 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1159436834 18:68429158-68429180 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1159444542 18:68525043-68525065 TACTTATTTAGCTATAAAAGAGG + Intergenic
1159540175 18:69764645-69764667 GAGTAATTTATAAAGAAAAGAGG - Intronic
1159564524 18:70033295-70033317 GAGTAATTTATAAAGAAAAGAGG - Intronic
1159584992 18:70275336-70275358 GATTTGTGCACATATAAAAGAGG + Intergenic
1159652475 18:70994796-70994818 GGGTAATTTATATAGAAAAGAGG - Intergenic
1159688118 18:71449077-71449099 GAATTATTTTAATGTAAAAGTGG + Intergenic
1159714226 18:71801538-71801560 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1159761415 18:72430920-72430942 GGGTTATTTACAAAAGAAAGAGG + Intergenic
1160121606 18:76135268-76135290 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1162255766 19:9488316-9488338 GAGTAATTTATAAAGAAAAGAGG - Intronic
1162306793 19:9879604-9879626 GGGTAATTTATAAATAAAAGAGG - Intronic
1163151950 19:15420813-15420835 CAGTTTTTGAAATATAAAAGTGG - Exonic
1164551494 19:29216338-29216360 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1164627711 19:29740499-29740521 GAGTGATTTAAAAAGAAAAGAGG - Intergenic
1164950231 19:32330859-32330881 GGGTCATTTACAAAGAAAAGAGG + Intergenic
1165127488 19:33610494-33610516 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1165278496 19:34775157-34775179 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1165876151 19:39008288-39008310 TATTTATTTAAATATAAATGGGG + Intronic
1166581668 19:43905834-43905856 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1166651676 19:44579869-44579891 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1167390397 19:49190894-49190916 GAGTAATTTATAAAGAAAAGAGG + Intronic
1167761230 19:51450994-51451016 GAGTAATTTATAAATGAAAGAGG + Exonic
925071585 2:972888-972910 GAGTAATTTATAAAGAAAAGAGG - Intronic
925530088 2:4849890-4849912 GGGTAATTTACAAAGAAAAGAGG + Intergenic
925620790 2:5790860-5790882 GAGGTACTTACATCTAAAAGGGG - Intergenic
925677033 2:6373632-6373654 GGGTAATTTATAAATAAAAGAGG - Intergenic
925815076 2:7739468-7739490 GGGTAATTTAAAAATAAAAGAGG - Intergenic
925821326 2:7802324-7802346 GTGTAATTTATAAATAAAAGAGG - Intergenic
925907829 2:8549903-8549925 GGGTAATTTACAAAGAAAAGAGG - Intergenic
925952458 2:8927871-8927893 GAGTAATTTACAAAGAAAAGAGG + Intronic
926485581 2:13452364-13452386 GAGTAATTTATAAAGAAAAGAGG + Intergenic
926638370 2:15207821-15207843 GAGTAATTTATAAAGAAAAGAGG - Intronic
926849138 2:17175481-17175503 GAGTAATTTATAAAGAAAAGAGG + Intergenic
926869320 2:17395203-17395225 GAGATATTTAAATGTAAAAATGG + Intergenic
926890197 2:17633030-17633052 GGGTAATTTACAAATGAAAGAGG + Intronic
927033617 2:19149631-19149653 GGGTCATTTACAAAGAAAAGGGG + Intergenic
927656622 2:24953158-24953180 GAGATATGTCCATTTAAAAGTGG - Intronic
928332145 2:30365784-30365806 GGGTTATTTATAAAGAAAAGAGG - Intergenic
928541152 2:32284645-32284667 GAGTAATTTATAAACAAAAGAGG - Intronic
928552273 2:32384161-32384183 GAGTTTATTAAATATAATAGTGG + Intronic
928750060 2:34460144-34460166 GGGTGATTTACAAAGAAAAGAGG - Intergenic
928975087 2:37078199-37078221 GAGCAATTTACAGATAAGAGAGG + Intronic
929217442 2:39430491-39430513 GATTTTTGTACATATAAAGGTGG + Intronic
929302459 2:40321517-40321539 GGGTAATTTACAAAGAAAAGAGG + Intronic
929384952 2:41395541-41395563 GGGTAATTTATAAATAAAAGAGG + Intergenic
929547919 2:42868021-42868043 GAGTAATTTATAAAGAAAAGAGG + Intergenic
929811118 2:45190137-45190159 GGGTAATTTACAGAGAAAAGAGG - Intergenic
930081884 2:47457321-47457343 GAGTAATTTATAAAGAAAAGAGG + Intronic
930104105 2:47626722-47626744 GGGTAATTTACAAAGAAAAGAGG - Intergenic
930219937 2:48736131-48736153 GGGTAATTTACAAAGAAAAGAGG - Intronic
930276978 2:49323032-49323054 GGGTAATTTATAAATAAAAGAGG - Intergenic
930377628 2:50587779-50587801 AAGTGATATACATATAAATGGGG + Intronic
930384469 2:50676306-50676328 GGGTTATTTATAAATAAAAGAGG - Intronic
930505788 2:52281537-52281559 GAGTAATTTATAAAGAAAAGAGG - Intergenic
930521212 2:52469979-52470001 GGGTAATTTATATAGAAAAGAGG - Intergenic
930941064 2:57014659-57014681 GGGTAATTTTCAAATAAAAGAGG - Intergenic
930975760 2:57458957-57458979 GAGTAATTTATAAAGAAAAGAGG + Intergenic
931118783 2:59193571-59193593 AAATTATTTACATATTAGAGAGG + Intergenic
931132998 2:59360043-59360065 GAGTGATTTACAAAGGAAAGAGG - Intergenic
931453303 2:62386689-62386711 GAGTAATTTACAAAGGAAAGGGG - Intergenic
931778762 2:65562331-65562353 GGGTAATTTATAAATAAAAGAGG + Intergenic
932375169 2:71228642-71228664 GAGTAATTTATAAAGAAAAGAGG - Intergenic
932547602 2:72730841-72730863 GATTTATTTATATATATTAGTGG - Intronic
932634823 2:73378994-73379016 GAGATAATTAGATATAAATGAGG - Intergenic
932930676 2:76034339-76034361 GGGTAATTTATAAATAAAAGAGG + Intergenic
933082434 2:78007515-78007537 GAGGTTTTTACAAATAAAAAAGG + Intergenic
933207513 2:79524493-79524515 GAACTCTTAACATATAAAAGAGG - Intronic
933356646 2:81218432-81218454 GAGTAATTTATAAAGAAAAGAGG - Intergenic
933362570 2:81306213-81306235 GGGTAATTTACAAAGAAAAGAGG - Intergenic
933410723 2:81921673-81921695 GGGTTATTTATTTAAAAAAGAGG + Intergenic
933458031 2:82541909-82541931 GAGTAATTTATAAAGAAAAGAGG + Intergenic
933517702 2:83326894-83326916 GAATTATTTACAAACGAAAGTGG - Intergenic
933989520 2:87624249-87624271 GGGTCATTTACAAAGAAAAGAGG + Intergenic
934576945 2:95408448-95408470 GAGCAATTTACAAAAAAAAGAGG + Intronic
934791403 2:97065152-97065174 GAGTAATTTATAAAGAAAAGAGG + Intergenic
934815031 2:97317391-97317413 GAGTAATTTATAAAGAAAAGAGG - Intergenic
934822664 2:97391092-97391114 GAGTAATTTATAAAGAAAAGAGG + Intergenic
934892045 2:98079188-98079210 GGGTAATTTATAAATAAAAGAGG + Intergenic
935151769 2:100443334-100443356 GGGTAATTTATAAATAAAAGAGG - Intergenic
935191510 2:100782160-100782182 GTTTTATTTACATAATAAAGTGG - Intergenic
935298349 2:101670490-101670512 GAGTAATTTATAAAGAAAAGAGG + Intergenic
935363886 2:102269760-102269782 GAGTTTTTTAAATATCCAAGTGG - Intergenic
936237260 2:110753314-110753336 GGGTAATTTATAAATAAAAGAGG - Intronic
936304323 2:111326577-111326599 GGGTCATTTACAAAGAAAAGAGG - Intergenic
936591840 2:113811711-113811733 GGGTAATTTACAAAGAAAAGAGG - Intergenic
936603742 2:113926463-113926485 GAGTAATTTATAAAGAAAAGAGG + Intronic
936629082 2:114180844-114180866 GAGTAATTTATAAAGAAAAGAGG - Intergenic
936633163 2:114226408-114226430 GAGTAATTTACAAAGAAAACAGG - Intergenic
936729058 2:115358712-115358734 GAGTAATTTATAAAGAAAAGAGG + Intronic
936761238 2:115786060-115786082 AAGATATTTACTTACAAAAGAGG + Intronic
936822829 2:116543518-116543540 GAGTAATTTATATAGAAAAGAGG + Intergenic
936844402 2:116813331-116813353 GCGTAATTTACAAATAAAACAGG - Intergenic
936906885 2:117546546-117546568 GGGTAATTTATAAATAAAAGAGG - Intergenic
936977622 2:118235318-118235340 AGGTAATTTACAAATAAAAGAGG - Intergenic
937146105 2:119646276-119646298 GAGTAATTTATAAAGAAAAGAGG + Intronic
937491233 2:122370679-122370701 GGGTTATTTATAAAGAAAAGAGG + Intergenic
937550740 2:123086903-123086925 GAGTAATTTATAGAGAAAAGAGG - Intergenic
937760958 2:125603163-125603185 GAGTAATTTATAGATGAAAGAGG - Intergenic
937786492 2:125905223-125905245 GAGTCATTTACAGAAAAAAAAGG - Intergenic
938123739 2:128655030-128655052 GGGTCATTTACAAAGAAAAGAGG - Intergenic
938286615 2:130123617-130123639 TATTTATTTACATAGAAAAAAGG + Intronic
938428983 2:131215245-131215267 TATTTATTTACATAGAAAAAAGG - Intronic
938523324 2:132096824-132096846 GGGTTATTTGAAGATAAAAGAGG - Intergenic
938772892 2:134515579-134515601 GTGTTATTTATATTTAAATGTGG + Intronic
939237754 2:139519368-139519390 GAGTAATTTATAAAGAAAAGAGG - Intergenic
939378847 2:141407770-141407792 GAGTGATTTATAAAGAAAAGAGG - Intronic
939440860 2:142247566-142247588 GAGTAATTTATAAAGAAAAGAGG - Intergenic
939459048 2:142475943-142475965 GAGTAATTTAAAAATAAAAGAGG + Intergenic
939503959 2:143021451-143021473 GGGTGATTTACAAAGAAAAGAGG + Intronic
939565597 2:143783284-143783306 GGGTTATTTATAAAGAAAAGAGG + Intergenic
939847199 2:147261599-147261621 GGATAATTTACAAATAAAAGAGG - Intergenic
940149135 2:150579640-150579662 GGGTAATTTACAAAGAAAAGAGG + Intergenic
940152612 2:150618871-150618893 GAGTTATATACATATATATGGGG - Intergenic
940450485 2:153829305-153829327 GGGTTATTTACAAAAGAAAGAGG + Intergenic
940732874 2:157414472-157414494 GAGTTATTTTGAGATAAAAGAGG - Intergenic
940826355 2:158416870-158416892 GAGTAATTTATAAAGAAAAGAGG + Intronic
940878815 2:158925223-158925245 GGGTAATTTACAAAGAAAAGAGG + Intergenic
941425775 2:165343164-165343186 GATTTATTTTCAAATAACAGAGG + Intronic
941431705 2:165421927-165421949 GAGTAATTTATAAAGAAAAGAGG + Intergenic
941701034 2:168604843-168604865 GAGTAATTTATAAAGAAAAGAGG - Intronic
942381956 2:175400979-175401001 GAGTAATTTATAAACAAAAGAGG + Intergenic
942501926 2:176600165-176600187 GGGTAATTTACAAAGAAAAGAGG - Intergenic
942524830 2:176841976-176841998 GGGTAATTTACAAAGAAAAGAGG - Intergenic
942825546 2:180170588-180170610 GAGTAATTTATAAACAAAAGGGG + Intergenic
942952728 2:181739133-181739155 GGGTAATTTATAAATAAAAGAGG - Intergenic
943032928 2:182707039-182707061 GGGTTATTTAAATATAATAGGGG - Intergenic
943138766 2:183950916-183950938 GTCTTCTTTACATATAAAATAGG + Intergenic
943210919 2:184964578-184964600 GAGTAATTTATAAACAAAAGAGG - Intergenic
943231786 2:185263818-185263840 GAGTAATTTATAAAGAAAAGAGG + Intergenic
943289273 2:186047819-186047841 GAGTCATTTATAAAGAAAAGAGG + Intergenic
943307927 2:186289883-186289905 GAGTAATTTATAAAGAAAAGAGG - Intergenic
943308576 2:186298357-186298379 GGGTAATTTATAAATAAAAGAGG - Intergenic
943435413 2:187859488-187859510 GGGTAATTTACAAAGAAAAGAGG - Intergenic
943452941 2:188068265-188068287 GAGTAATTTATAAACAAAAGAGG + Intergenic
943487253 2:188501418-188501440 GAGTAATTTATAAAGAAAAGAGG - Intronic
943512107 2:188839115-188839137 GATTTATTTATTTTTAAAAGTGG - Intergenic
943559630 2:189445150-189445172 GTGTTATTTACATTTTACAGTGG + Intronic
943769583 2:191702009-191702031 GGGTAATTTACAAAGAAAAGAGG - Intergenic
943808272 2:192151222-192151244 GGGTAATTTATAAATAAAAGAGG - Intronic
943882032 2:193158006-193158028 GGGTAATTTATAAATAAAAGAGG - Intergenic
943893061 2:193316648-193316670 GGGTAATTTACATAGAAAAGAGG + Intergenic
943933320 2:193882978-193883000 GGGTAATTTATAAATAAAAGAGG + Intergenic
943959326 2:194241389-194241411 GAGTAATTTACAAAAGAAAGAGG + Intergenic
944048780 2:195442718-195442740 GAGTAATTTATATAGGAAAGAGG + Intergenic
944187744 2:196968087-196968109 GGGTAATTTACAAAGAAAAGAGG - Intronic
944284609 2:197934552-197934574 GAGGTATTTGCAGATAAGAGAGG + Intronic
944329800 2:198452195-198452217 GAGCTATTTAAATATTAATGGGG + Intronic
944763189 2:202838744-202838766 GGGTAATTTATAAATAAAAGAGG + Intronic
944937885 2:204588481-204588503 GAAATATTTGCATATCAAAGTGG - Intronic
945009377 2:205445338-205445360 GGGTAATTTACAAAGAAAAGAGG + Intronic
945125742 2:206507568-206507590 GAGTAATTTATAAAGAAAAGTGG - Intronic
945192742 2:207206969-207206991 GAGTTCTTTAAATCTAAAAATGG + Intergenic
945900821 2:215535177-215535199 GAGTAATTTATAAAGAAAAGAGG - Intergenic
945930292 2:215848127-215848149 GGGTAATTTACAGAGAAAAGGGG - Intergenic
945961713 2:216142188-216142210 GTGTTATTTACATACAATACAGG - Intronic
946124008 2:217543778-217543800 GGGTAATTTACAAAGAAAAGAGG + Intronic
946503589 2:220275804-220275826 GAGTAATTTATATAGAAAAGAGG + Intergenic
946526299 2:220524469-220524491 GAGTCATTTATAAAGAAAAGAGG + Intergenic
946718960 2:222583956-222583978 GAGTAATTTATAAAGAAAAGAGG - Intronic
946763783 2:223021464-223021486 CTGTTATTTACATTTAAATGTGG + Intergenic
946805479 2:223466951-223466973 GGGTAATTTACAAAGAAAAGAGG + Intergenic
946875124 2:224121758-224121780 GAGTAATTTATAAAGAAAAGAGG + Intergenic
946989990 2:225317873-225317895 GAGTAATTTATAAAGAAAAGAGG - Intergenic
947030353 2:225785274-225785296 GATATATTTACATAGAACAGGGG - Intergenic
947034832 2:225840606-225840628 CAGTAATTTAAATAAAAAAGAGG + Intergenic
947125294 2:226862723-226862745 GAGTAATTTATAAAGAAAAGAGG + Intronic
947125998 2:226869011-226869033 GAGTGATTTTCATATGAATGTGG - Intronic
947131626 2:226932919-226932941 GAGTAATTTATAAAGAAAAGAGG + Intronic
947286093 2:228516665-228516687 GAGTAATTTATAAAGAAAAGAGG + Intergenic
947880652 2:233508051-233508073 GGGTTATTGACACATAAAACTGG - Intronic
947895172 2:233664450-233664472 GGGTAATTTATAAATAAAAGAGG + Intronic
948234102 2:236374472-236374494 GGGTAATTTATAAATAAAAGAGG + Intronic
948342263 2:237263226-237263248 GGGTAATTTACAAAGAAAAGAGG - Intergenic
948466526 2:238154516-238154538 GGGTAATTTACAAAGAAAAGAGG - Intergenic
948658708 2:239493192-239493214 GGGTAATTTACAAAGAAAAGAGG + Intergenic
948770058 2:240247214-240247236 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1168927240 20:1592130-1592152 GGGTAATTTATAAATAAAAGAGG - Intronic
1169390707 20:5188641-5188663 GGGTAATTTACAAAGAAAAGAGG + Intronic
1169467245 20:5852161-5852183 GAGTAATTTATAAAGAAAAGAGG - Intronic
1169804142 20:9542000-9542022 GAGTAATTTACAAATAAAGAAGG - Intronic
1169835263 20:9870947-9870969 GGGTAATTTATAAATAAAAGAGG - Intergenic
1170019713 20:11823535-11823557 GATTTATATACATTTCAAAGGGG - Intergenic
1170196316 20:13692990-13693012 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1170250998 20:14282600-14282622 GGGTAATTTAAAAATAAAAGAGG + Intronic
1170273030 20:14549432-14549454 TACTTATTTACATATAAAACAGG - Intronic
1170370882 20:15646855-15646877 GAGTAATTTACAAAGGAAAGAGG - Intronic
1170685387 20:18564966-18564988 GAGTTATTAACATATAACATAGG + Intergenic
1170717683 20:18846145-18846167 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1170883723 20:20319664-20319686 GGGTAATTTACAAAGAAAAGAGG - Intronic
1172017749 20:31888647-31888669 GAGTAATTTATAAAGAAAAGAGG + Intronic
1172051118 20:32119147-32119169 GAGTAATTTATAAAGAAAAGAGG + Intronic
1172224215 20:33294138-33294160 GAAATATCTACATATTAAAGAGG + Intronic
1172388048 20:34547756-34547778 GAGTAATTTACAAAGAAAAGAGG - Intronic
1172786315 20:37471088-37471110 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1173179459 20:40793304-40793326 GAATTATTGCCTTATAAAAGAGG + Intergenic
1173301531 20:41808070-41808092 GGGTAATTTACAAAGAAAAGGGG + Intergenic
1173407918 20:42783341-42783363 GAGTCCTTTACACATAAAAAAGG - Intronic
1173909720 20:46657659-46657681 GAGTAATTTATAAAGAAAAGAGG + Intronic
1173921685 20:46750912-46750934 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1174949622 20:55029740-55029762 GAGTAATTTATAAGTAAAAGAGG + Intergenic
1175007559 20:55701540-55701562 GGGTGATTTACAAAGAAAAGTGG + Intergenic
1175017854 20:55810948-55810970 GGGTGATTTACAAAGAAAAGAGG - Intergenic
1175169068 20:57067266-57067288 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1175307243 20:57984739-57984761 GAGGTATTCACTTTTAAAAGTGG - Intergenic
1175317341 20:58058257-58058279 GAGTAATTTACAAAGGAAAGAGG + Intergenic
1175427762 20:58880221-58880243 GAGCTATTTGCAAATAAAAATGG - Intronic
1175767403 20:61601060-61601082 GAGTGATTTATACAGAAAAGAGG + Intronic
1176086886 20:63300084-63300106 GATTTAATAACATATAAAAGGGG - Intronic
1176773362 21:13104171-13104193 GGGTTATTTGAAGATAAAAGAGG + Intergenic
1176845541 21:13873799-13873821 CAGATATTACCATATAAAAGTGG + Intergenic
1176885234 21:14247631-14247653 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1176925723 21:14746420-14746442 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1177169421 21:17639470-17639492 AGGTAATTTACAAATAAAAGAGG + Intergenic
1177292991 21:19139610-19139632 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1177302321 21:19263962-19263984 GGGTAATTTATAAATAAAAGAGG - Intergenic
1177328901 21:19630057-19630079 GGGTCATTTATATAGAAAAGAGG - Intergenic
1177529548 21:22341758-22341780 GGGTGATTTACAAAGAAAAGAGG + Intergenic
1177726078 21:24970169-24970191 GAGTAATTTATAGAGAAAAGTGG + Intergenic
1177774374 21:25551601-25551623 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1177812908 21:25943764-25943786 GACTTCCTTACAAATAAAAGTGG + Intronic
1177871336 21:26576295-26576317 GAGTATTTTTCATATAACAGAGG + Intergenic
1177950655 21:27532130-27532152 TAGTTATTTACAAATTAAAAAGG - Intergenic
1177993010 21:28060022-28060044 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1177999405 21:28142829-28142851 GAGTAATTTATAAACAAAAGAGG + Intergenic
1178096854 21:29224189-29224211 GAGTAATTTATAAACAAAAGAGG - Intronic
1178182953 21:30185416-30185438 GAATTATTTACACATAACAATGG + Intergenic
1178205073 21:30455633-30455655 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1178209835 21:30516844-30516866 GTGTTATTTACAAAGGAAAGAGG - Intergenic
1178310242 21:31524163-31524185 GGGTAATTTATATAGAAAAGAGG + Intronic
1178408612 21:32346290-32346312 GAGTGATTTATAAAGAAAAGAGG - Intronic
1178833954 21:36080124-36080146 GGGTAACTTACAAATAAAAGAGG - Intergenic
1178904487 21:36625172-36625194 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1179365638 21:40756368-40756390 GAGTAATTTATAAAGAAAAGAGG - Intronic
1179380699 21:40896505-40896527 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1179387023 21:40953310-40953332 GGGTAATTTATAAATAAAAGAGG + Intergenic
1179436561 21:41366371-41366393 GAGTAACTTACAAAGAAAAGAGG + Intronic
1179773569 21:43643649-43643671 GAGTAATTTATAAAGAAAAGAGG - Intronic
1180438134 22:15333520-15333542 GGGTTATTTGAAGATAAAAGAGG + Intergenic
1180457265 22:15521038-15521060 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1180520989 22:16203878-16203900 GGGTTATTTGAAGATAAAAGAGG + Intergenic
1181445268 22:22967840-22967862 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1181448759 22:23001548-23001570 GGGTGATTTATAAATAAAAGAGG + Intergenic
1181878958 22:25962076-25962098 GAGTAATTTATAAAGAAAAGAGG - Intronic
1181905926 22:26196346-26196368 GGGTAATTTATATAGAAAAGAGG - Intronic
1182213103 22:28693022-28693044 GGGTAATTTACAAAGAAAAGAGG - Intronic
1182456704 22:30456355-30456377 GGGTAATTTACAAAGAAAAGAGG + Intronic
1182759509 22:32710837-32710859 GAGTAATTTATAAAGAAAAGAGG - Intronic
1182817432 22:33178068-33178090 GGGTAATTTACAAACAAAAGAGG - Intronic
1182967711 22:34537628-34537650 GAGTAATTTGTAAATAAAAGAGG + Intergenic
1183497054 22:38152640-38152662 GAGTATTATACATAGAAAAGAGG - Intronic
949230551 3:1745023-1745045 GGGTAATTTACAAAGAAAAGAGG + Intergenic
949670740 3:6397167-6397189 GACTTCTTTTCTTATAAAAGGGG - Intergenic
949692227 3:6653870-6653892 GGGTAACTTACAAATAAAAGAGG + Intergenic
949794752 3:7836149-7836171 GGGTAATTTATAAATAAAAGAGG - Intergenic
949830387 3:8208266-8208288 GAGTAATTTATAAAGAAAAGAGG + Intergenic
949913990 3:8942439-8942461 GGGTAATTTACAAAGAAAAGAGG - Intronic
950378963 3:12594952-12594974 GGGTTATTTATATGTAAATGAGG - Intronic
950741388 3:15054928-15054950 GAGTAATTTATAGAGAAAAGAGG + Intronic
950822038 3:15771058-15771080 GGGTTATTTATAAAGAAAAGAGG + Intronic
950827972 3:15845703-15845725 GGGTAATTTACAAAGAAAAGAGG + Intronic
950927221 3:16753678-16753700 GGGTTATTTATAAAGAAAAGAGG + Intergenic
950961016 3:17107684-17107706 GAGTGATTTACATGTAATATAGG + Intergenic
951132654 3:19066968-19066990 GAGTAATTTATAAAGAAAAGAGG - Intergenic
951183270 3:19683215-19683237 GGGTAATTTACAAATGAAAGAGG + Intergenic
951237080 3:20249321-20249343 GAGTAATTTATAAAGAAAAGAGG + Intergenic
951530156 3:23691414-23691436 GGGTAATTTACAAAGAAAAGAGG - Intergenic
951659627 3:25048120-25048142 GGGTAATTTACATAAAAAAGAGG - Intergenic
951744841 3:25966334-25966356 GAGTAATTTATAAAGAAAAGAGG - Intergenic
951961374 3:28325869-28325891 GAGTTGGTTACATATAAATCAGG - Intronic
952122937 3:30266136-30266158 GAGTAATTTACAAAGAAAAGAGG - Intergenic
952185408 3:30962609-30962631 GAGTAATTTACAAAGAAAAGAGG + Intergenic
952255357 3:31690390-31690412 GAGTAATTTATAAAGAAAAGAGG - Intronic
952296160 3:32063882-32063904 GGGTAATTTACAAAGAAAAGAGG - Intronic
952411950 3:33057323-33057345 GGGTAATTTACAAAGAAAAGAGG - Intronic
952420215 3:33123595-33123617 GGGTAATTTATAAATAAAAGAGG - Intronic
952667033 3:35919472-35919494 GAGTAATTTATAAAGAAAAGAGG - Intergenic
953202330 3:40788476-40788498 GAGTAATTTATAAAGAAAAGAGG - Intergenic
953444943 3:42955292-42955314 GAGTAATTTATAAAGAAAAGAGG + Intronic
953658173 3:44870732-44870754 AAGTTGTTTACATATATAATAGG + Intronic
953856497 3:46503296-46503318 GGGTAATTTACAAAGAAAAGAGG + Intergenic
953898620 3:46824276-46824298 GGGTAATTTACAAACAAAAGAGG + Intergenic
955008595 3:54992817-54992839 GGGTAATTTACAAAGAAAAGAGG + Intronic
955166209 3:56516382-56516404 GAGTAATTTACAAAGGAAAGAGG - Intergenic
955652617 3:61210991-61211013 TAGATATTTAAAAATAAAAGTGG + Intronic
955857519 3:63289328-63289350 GAGTAATTTACAAAGAAAATGGG + Intronic
956283532 3:67584672-67584694 GAGTAATTTACAAAGGAAAGAGG + Intronic
956357441 3:68409597-68409619 GCGTAATTTATAAATAAAAGAGG - Intronic
956364105 3:68481068-68481090 GAGTAATTTATAAAGAAAAGAGG - Intronic
956379149 3:68647552-68647574 GGGTAATTTACAAAGAAAAGAGG - Intergenic
956379677 3:68652590-68652612 GGGTAATTTACAAAGAAAAGAGG - Intergenic
956524932 3:70148487-70148509 GAGTAATTTATAAAGAAAAGAGG + Intergenic
956901811 3:73724604-73724626 GAGTAATTTATAAATAAAAGAGG + Intergenic
957088902 3:75708795-75708817 GAGTTATTTATAAATGAAAGAGG + Intergenic
957237195 3:77608934-77608956 GAGTTATGTACAAAGAAAAGAGG - Intronic
957266180 3:77969288-77969310 GAGTAATTTATAAAGAAAAGGGG - Intergenic
957293560 3:78307670-78307692 GGGTAATTTACAAAGAAAAGAGG - Intergenic
957396599 3:79647345-79647367 AAGTTATTTACATATTTAATAGG - Intronic
957422431 3:79988627-79988649 GAGATATTTGCATTTAGAAGAGG - Intergenic
957442725 3:80271217-80271239 GAGTAATTTATAAACAAAAGAGG - Intergenic
957510849 3:81185905-81185927 GGGTAATTTACAAATAAAAGAGG - Intergenic
957667717 3:83255438-83255460 TAGTTATTTAGATAAAAAATAGG - Intergenic
957765919 3:84623246-84623268 GAGTTTTTTTTATATAAAAAGGG + Intergenic
957831763 3:85530628-85530650 GGGTAATTTATATAGAAAAGTGG - Intronic
957901466 3:86499449-86499471 GGGTAATTTATAAATAAAAGAGG + Intergenic
957955764 3:87185208-87185230 GGGTAATTTATAAATAAAAGAGG + Intergenic
958510410 3:95039738-95039760 GAGTAATTTATAAAGAAAAGTGG + Intergenic
958698438 3:97556361-97556383 GGGTAATTTACATAGGAAAGAGG + Intronic
958838881 3:99179099-99179121 GAGTAATTTATAAACAAAAGAGG + Intergenic
958917360 3:100064547-100064569 AAGTTCTCTACATATAATAGTGG - Intronic
959122493 3:102249081-102249103 GGGTAATTTACAAAGAAAAGAGG + Intronic
959268056 3:104168649-104168671 GAGTAATTTATAAAGAAAAGAGG + Intergenic
959270906 3:104208386-104208408 GGGTAATTTATAAATAAAAGAGG - Intergenic
959336897 3:105078660-105078682 GAGTAATTTATAAAGAAAAGAGG + Intergenic
959341882 3:105142243-105142265 GAGTAATTTATATAGGAAAGAGG + Intergenic
959369504 3:105505212-105505234 GAGTAATTTATAAAGAAAAGAGG + Intronic
959463681 3:106658427-106658449 GGGTAATTTACAAACAAAAGAGG + Intergenic
959730805 3:109599502-109599524 GAATTATGTACATTTAAAAATGG + Intergenic
959739819 3:109705185-109705207 GAGTAATTTATAAAGAAAAGAGG + Intergenic
959809289 3:110595889-110595911 GGGTAATTTAAAAATAAAAGAGG + Intergenic
960424732 3:117492523-117492545 GGGTAATTTACAAAGAAAAGAGG - Intergenic
960538610 3:118840385-118840407 GGGTTATTTATAAACAAAAGAGG + Intergenic
960540550 3:118857118-118857140 GAGTAATTTATAAAGAAAAGAGG + Intergenic
960591863 3:119374447-119374469 GGGTAATTTATATAGAAAAGAGG - Intronic
960655695 3:120001564-120001586 GAGTAATTTATAAAGAAAAGAGG - Intronic
960724848 3:120659777-120659799 GAGTAATTTATAAAGAAAAGAGG + Intronic
960913542 3:122674404-122674426 GGGTAATTTACAAAGAAAAGTGG + Intergenic
961342460 3:126237527-126237549 GAGTAATTTATAAAGAAAAGAGG + Intergenic
962018332 3:131467734-131467756 GGGTAATTTATAAATAAAAGAGG - Intronic
962030509 3:131595465-131595487 GGGTAATTTACAAAGAAAAGAGG + Intronic
962388236 3:134950458-134950480 GAGTAATTTATAAAGAAAAGAGG + Intronic
963012256 3:140781465-140781487 GGGTTATTTATAAAGAAAAGAGG - Intergenic
963470796 3:145739237-145739259 GAGTAATTTATAAAGAAAAGAGG - Intergenic
963511635 3:146255012-146255034 GAGTAATTTATAAAGAAAAGAGG - Intergenic
963527110 3:146429093-146429115 GAGTAATTTATAAAGAAAAGAGG + Intronic
963849051 3:150190748-150190770 GAGTAATTTATAAAGAAAAGAGG + Intergenic
964002378 3:151790852-151790874 GAGTAATTTATAAAGAAAAGAGG + Intergenic
964284332 3:155101234-155101256 GAGTAATTTATAAAGAAAAGAGG - Intronic
964298732 3:155263183-155263205 GGGTAATTTACAAAGAAAAGAGG - Intergenic
964431313 3:156609246-156609268 TTCTTATTTACATCTAAAAGAGG + Intergenic
964458358 3:156893748-156893770 GAGTAATTTATAAAGAAAAGAGG - Intronic
964608555 3:158585457-158585479 GGGTAATTTACAAAGAAAAGAGG - Intronic
964729542 3:159850583-159850605 GGGTAATTTATAAATAAAAGAGG + Intronic
964971370 3:162567270-162567292 TAGTTATTTAGAAATAAAATTGG - Intergenic
965235873 3:166121691-166121713 GATTAATTTAAAGATAAAAGTGG + Intergenic
965236175 3:166126706-166126728 GAGTAATTTAAAAATAGAAGAGG + Intergenic
965278081 3:166713858-166713880 GTGTAATTTACAAAGAAAAGAGG + Intergenic
965294096 3:166920819-166920841 GAGTAATTTATACAGAAAAGAGG - Intergenic
965331305 3:167378124-167378146 GGGTTATTTACAAAGGAAAGAGG - Intronic
965394111 3:168141631-168141653 GGGTTATTTATAAAGAAAAGAGG + Intergenic
965605490 3:170494195-170494217 GAGCTATTTGCATGTAAAAGTGG + Intronic
966025396 3:175274074-175274096 GGGTAATTTATTTATAAAAGGGG + Intronic
966055805 3:175687978-175688000 GGGTAATTTACAAAGAAAAGAGG - Intronic
966076266 3:175938832-175938854 GAGTAATTTATAAATACAAGAGG - Intergenic
966211552 3:177458464-177458486 GAGTAGTTTATAAATAAAAGAGG - Intergenic
966262809 3:178000600-178000622 GGGTAATTTACAAAGAAAAGAGG - Intergenic
966346998 3:178991046-178991068 GAGTAATTTATAAAGAAAAGAGG + Intergenic
966393703 3:179479052-179479074 GGGTAATTTATAAATAAAAGAGG - Intergenic
966485603 3:180466087-180466109 AAGATATTAACATTTAAAAGGGG - Intergenic
966589896 3:181670733-181670755 GAATTCTTTACATATTAAGGAGG + Intergenic
966675075 3:182576525-182576547 GGGCAATTTACAAATAAAAGTGG - Intergenic
966713347 3:182991358-182991380 GGGTAATTTACAAAGAAAAGAGG + Intergenic
966763788 3:183440601-183440623 GAGTAATTTATAAAGAAAAGAGG + Intergenic
966977801 3:185101495-185101517 GGGTAATTTACAGAGAAAAGAGG + Intronic
967170079 3:186816327-186816349 GAGTAATTTATAAAGAAAAGAGG + Intergenic
967186930 3:186952029-186952051 GAGTAATTTATAAAGAAAAGAGG + Intronic
967261651 3:187648709-187648731 GTGTAATTTAAAAATAAAAGAGG + Intergenic
967397895 3:189026937-189026959 AAGTTATTGATATATATAAGTGG - Intronic
968032431 3:195511896-195511918 GGGTTATTTATTTAAAAAAGAGG + Intergenic
968248039 3:197174715-197174737 GATTTATATACAGATAAATGAGG + Intronic
968838630 4:2983773-2983795 GGGTAATTTATAAATAAAAGAGG + Intronic
969140574 4:5067717-5067739 GAGTAATTTATAAATAAAAGAGG + Intronic
969655891 4:8498372-8498394 GGGTAATTTACAAAGAAAAGAGG + Intergenic
969963851 4:10974471-10974493 GAGTCATTTATAAAGAAAAGAGG + Intergenic
970030902 4:11673556-11673578 GAGTAATTTATAAAGAAAAGAGG + Intergenic
970070028 4:12147881-12147903 GAGTAATTTATAAAGAAAAGAGG + Intergenic
970088212 4:12371621-12371643 GGGTAATTTATATAGAAAAGAGG - Intergenic
970099677 4:12505741-12505763 GAGTAATTTATAAAGAAAAGAGG - Intergenic
970399752 4:15705858-15705880 GGGTAATTTACAAAGAAAAGAGG + Intronic
970567773 4:17349370-17349392 GAGTAATTTATAAAGAAAAGAGG + Intergenic
970589604 4:17547709-17547731 GGGTAATTTATAAATAAAAGAGG - Intergenic
970661063 4:18286456-18286478 GAGTTATTTACATGTCAAAGTGG + Intergenic
970707414 4:18821867-18821889 GGGTAATTTATAAATAAAAGAGG - Intergenic
970813037 4:20118218-20118240 GAGTAATTTATAAAGAAAAGAGG + Intergenic
970821193 4:20216982-20217004 GAGTGTTTTGCAAATAAAAGTGG - Intergenic
970971894 4:21994580-21994602 GGGTAATTTACAAAGAAAAGAGG + Intergenic
971126379 4:23759914-23759936 GGGTAATTTATATAGAAAAGAGG + Intronic
971263893 4:25081402-25081424 GAGTAATTTATAAAGAAAAGAGG - Intergenic
971454801 4:26834227-26834249 GAGTAATTTATAAAGAAAAGAGG - Intergenic
971642488 4:29153756-29153778 GAGTAATTTATAAAGAAAAGAGG + Intergenic
971709714 4:30094934-30094956 TAGGTATTTACATAGAAATGGGG - Intergenic
971711009 4:30112750-30112772 GGGTTATTTATAAAGAAAAGAGG + Intergenic
971813065 4:31452737-31452759 GAATAATTTATATACAAAAGAGG - Intergenic
971837192 4:31782843-31782865 GAGTAATTTATAAAGAAAAGAGG - Intergenic
971845690 4:31915518-31915540 GAGTAATTTATAAAGAAAAGAGG - Intergenic
971884539 4:32426205-32426227 GAGTAATTTAAAAAGAAAAGAGG - Intergenic
971914544 4:32851038-32851060 GAGTAATTTATAAACAAAAGAGG + Intergenic
971969481 4:33603603-33603625 GGGTAATTTATAAATAAAAGAGG + Intergenic
972007684 4:34131613-34131635 GGGTAATTTACAAAGAAAAGAGG - Intergenic
972084149 4:35192613-35192635 GGGTCATTTACAAAGAAAAGAGG + Intergenic
972091727 4:35294895-35294917 GGGTAATTTACAAAGAAAAGAGG - Intergenic
972828750 4:42789828-42789850 GGGTAATTTATAAATAAAAGAGG + Intergenic
972902834 4:43705891-43705913 GGGTAATTTACAAAGAAAAGAGG - Intergenic
972910461 4:43810260-43810282 GGGTAATTTACAAAGAAAAGAGG + Intergenic
972911354 4:43821545-43821567 GGGTAATTTATAAATAAAAGAGG + Intergenic
973010999 4:45073047-45073069 GGGTAATTTACAAAGAAAAGAGG + Intergenic
973089359 4:46113205-46113227 GAGTAATTTATAAAGAAAAGAGG + Intronic
973266969 4:48220637-48220659 GGGTAATTTATAAATAAAAGAGG - Intronic
973267088 4:48221511-48221533 GGGTAATTTACAAAGAAAAGAGG - Intronic
973641848 4:52910968-52910990 GAGTAATTTATAAAGAAAAGAGG - Intronic
973780532 4:54284404-54284426 GAGTAATTTATAAAGAAAAGAGG + Intronic
973854419 4:54996590-54996612 GGGTAATTTACAAAGAAAAGAGG + Intergenic
973860773 4:55062557-55062579 GAGTAATTTATAAAGAAAAGAGG - Intergenic
973925925 4:55737289-55737311 GCATTATTTACAAATAAAATAGG - Intergenic
973933300 4:55815724-55815746 GGGTAATTTACAAAGAAAAGAGG - Intergenic
974183537 4:58415076-58415098 GGGTTATTTATAAACAAAAGTGG - Intergenic
974323986 4:60390310-60390332 GAGTAATTTATAAAGAAAAGAGG + Intergenic
974469071 4:62295847-62295869 GAGTAATTTATACAGAAAAGAGG + Intergenic
974532922 4:63134201-63134223 GAGTAATTTATAAAGAAAAGAGG - Intergenic
974550579 4:63367496-63367518 GAGTAATTTACAAAATAAAGAGG - Intergenic
974601580 4:64089743-64089765 GGGTGATTTATATATAAAAGAGG + Intergenic
974799674 4:66801214-66801236 GAGTAATTTATAAACAAAAGAGG + Intergenic
974887646 4:67840200-67840222 GGGTAATTTACAAAGAAAAGAGG + Intronic
974899707 4:67982135-67982157 GAGTTCTGTACATATAAACCTGG + Intergenic
974923307 4:68269234-68269256 GAGTAATTTATAAAGAAAAGGGG + Intergenic
975051121 4:69866107-69866129 GGGTTATTTATAAAGAAAAGAGG - Intergenic
975100076 4:70502928-70502950 GATTTATCTACATTTCAAAGGGG - Intergenic
975609669 4:76191660-76191682 GGGTAATTTACTTAAAAAAGAGG - Intronic
976015421 4:80546848-80546870 GAGCAATTTACAAAGAAAAGAGG - Intronic
976096848 4:81517465-81517487 GAGTAATTTATAAAGAAAAGAGG - Intronic
976122024 4:81793960-81793982 GAGTAATTTACAATGAAAAGAGG + Intronic
976124936 4:81823681-81823703 GAGTTACTTACCTTTAAAGGTGG - Intronic
976195879 4:82530734-82530756 GAGTAATTTATAAAGAAAAGAGG + Intronic
976396858 4:84565355-84565377 GATTTGTGCACATATAAAAGAGG - Intergenic
977072328 4:92406950-92406972 GGGTAATTTATATATAAAAAAGG + Intronic
977079825 4:92511075-92511097 GGGTTATTTACAAAGAAAAATGG + Intronic
977130052 4:93224926-93224948 GAGTCATCAACATATAAAAAGGG + Intronic
977206723 4:94171248-94171270 GTGTAATTTACAAAGAAAAGAGG - Intergenic
977270837 4:94916105-94916127 GGGTAATTTACAAAGAAAAGAGG - Intronic
977459756 4:97310411-97310433 GGGTAATTTACAAAGAAAAGAGG + Intronic
977749230 4:100588805-100588827 GACTTACTTAGATATAAAATAGG - Intronic
978085553 4:104648325-104648347 AATTTAATAACATATAAAAGTGG + Intergenic
978100801 4:104839099-104839121 GGGTAATTTACAAAGAAAAGAGG - Intergenic
978235051 4:106447676-106447698 GAGTGATTTATAAAGAAAAGAGG + Intergenic
978727552 4:111987182-111987204 GAGATATTTACATAAAGAACAGG + Intergenic
978809627 4:112836327-112836349 GGGTAATTTATAAATAAAAGAGG - Intronic
978903946 4:113984616-113984638 GTGTAATTTATAAATAAAAGAGG - Intergenic
978991134 4:115083865-115083887 GGGTTATTTATAAAGAAAAGAGG - Intronic
979003768 4:115261464-115261486 GAGTAATTTTTAAATAAAAGAGG - Intergenic
979049224 4:115909375-115909397 GAGTAATTTATAAACAAAAGAGG + Intergenic
979090036 4:116471336-116471358 GGGTAATTTATATAGAAAAGAGG - Intergenic
979102924 4:116645173-116645195 GGGTAATTTATATAGAAAAGAGG - Intergenic
979166548 4:117539738-117539760 GGGTAATTTACAAAGAAAAGAGG - Intergenic
979304270 4:119124476-119124498 GATTGATTTACATTAAAAAGGGG - Intergenic
979555366 4:122040590-122040612 GGGTAATTTACAAAGAAAAGAGG + Intergenic
979710965 4:123778858-123778880 GAGTAATTTATAAAGAAAAGAGG - Intergenic
979740002 4:124137692-124137714 GGGTTATTTATAAATAAAAGAGG - Intergenic
979779743 4:124635649-124635671 GAGTAATTTATAAAGAAAAGGGG - Intergenic
979860473 4:125687053-125687075 GAGTTATTTATAAAGAAGAGAGG + Intergenic
979881503 4:125964694-125964716 GGGTAATTTACAAAGAAAAGAGG - Intergenic
979913492 4:126401419-126401441 GAGTTGATTATAGATAAAAGAGG - Intergenic
979983567 4:127287521-127287543 GGGTTATTTATAAAGAAAAGAGG - Intergenic
980209191 4:129764135-129764157 GAGTAATTTATAAAGAAAAGAGG + Intergenic
980263914 4:130491464-130491486 GAGTAATTTATAAAGAAAAGAGG - Intergenic
980285724 4:130776552-130776574 GAGTAATTTACAAAGAAAAGAGG - Intergenic
980318738 4:131240033-131240055 GGGTAATTTATATAGAAAAGAGG - Intergenic
980386224 4:132090229-132090251 GAGTAATTTATATAGGAAAGAGG - Intergenic
980525556 4:133987855-133987877 GAGTAATTTACAGAAGAAAGAGG + Intergenic
980748485 4:137055419-137055441 GAGTTGTCTTCATATAAAAGTGG - Intergenic
980755162 4:137149032-137149054 GAGCAATTTACAAATGAAAGAGG + Intergenic
980758102 4:137191619-137191641 GAGTAATTTATAAAGAAAAGAGG + Intergenic
980888918 4:138793357-138793379 GGGTAATTTATAAATAAAAGAGG - Intergenic
981072586 4:140559750-140559772 GACTTTTTTATATAAAAAAGAGG - Exonic
981191970 4:141874282-141874304 GCGTTTTTTAAATATAAAAATGG + Intergenic
981268907 4:142820523-142820545 GGGTAATTTATAAATAAAAGAGG - Intronic
981391689 4:144197952-144197974 GAGTAATTTATAAATAAAAGAGG - Intergenic
981453104 4:144921495-144921517 GGGTAATTTATATAGAAAAGAGG + Intergenic
981488065 4:145308694-145308716 GAGTAATTTACAAAGAAAAGAGG + Intergenic
981491962 4:145348990-145349012 GGGTTATTTATAAAGAAAAGAGG - Intergenic
981612891 4:146614401-146614423 GAGTAATTTATAAAGAAAAGAGG - Intergenic
981649963 4:147046286-147046308 GAAATATTTACATAGGAAAGTGG - Intergenic
981912816 4:150001482-150001504 GGGTTATTTATAAAGAAAAGAGG + Intergenic
982051443 4:151506421-151506443 GAGTTATTTATAAAGAAATGAGG + Intronic
982331295 4:154184731-154184753 GAGTGATTTATAAAGAAAAGAGG + Intergenic
982509776 4:156267017-156267039 GGGTTATTTATAAAGAAAAGAGG + Intergenic
982613029 4:157601472-157601494 AAGTTATTAAAATATAAAATGGG + Intergenic
983067539 4:163228526-163228548 GAGTAATTTACAAAGAAAAGAGG - Intergenic
983147056 4:164229608-164229630 GAGTAATTTATAAAGAAAAGAGG + Intronic
983363274 4:166755632-166755654 CAGTTATTTGCATGGAAAAGAGG + Intronic
983379511 4:166973299-166973321 GAGTAATTTATAAACAAAAGAGG - Intronic
983434369 4:167693770-167693792 GGGTAATTTACAAAGAAAAGAGG + Intergenic
983449270 4:167890329-167890351 GAGTAATTTATAAAGAAAAGAGG - Intergenic
983672723 4:170256855-170256877 GAGTAATTTACAAAGAAAAGAGG - Intergenic
983767481 4:171503333-171503355 GGGTAATTTACAAAAAAAAGAGG + Intergenic
983798490 4:171897064-171897086 GATTTATTTAGATAAAAATGAGG - Intronic
983802823 4:171956406-171956428 GAATTATTTAAATAAATAAGAGG + Intronic
983872557 4:172838728-172838750 GAGTTATTTATATACATCAGAGG - Intronic
983952672 4:173661105-173661127 GTGTAATTTACAAACAAAAGAGG - Intergenic
983967493 4:173830603-173830625 GAGTGATTTATAAAGAAAAGAGG - Intergenic
984109574 4:175595721-175595743 GGGTAATTTACAAAGAAAAGAGG - Intergenic
984297503 4:177871913-177871935 AAGGTATTTACAGATAAAATGGG - Intronic
984372321 4:178883407-178883429 GGGTAATTTATAAATAAAAGAGG - Intergenic
984480820 4:180299016-180299038 GGGTAATTTACAAAGAAAAGAGG - Intergenic
984498560 4:180530236-180530258 GAGTAATTTAGAAAGAAAAGAGG - Intergenic
984512118 4:180692350-180692372 GAGTAATTTATAAAGAAAAGAGG + Intergenic
984865692 4:184278344-184278366 GGGTAATTTATAAATAAAAGAGG - Intergenic
985007609 4:185549788-185549810 GTGTAATTTACAAAGAAAAGAGG + Intergenic
985373726 4:189313111-189313133 GGGTAATTTACAAATAAGAGTGG + Intergenic
985985911 5:3516168-3516190 GGGTAATTTACAAAGAAAAGAGG + Intergenic
986138711 5:5008704-5008726 GAGTAATTTATAGAGAAAAGAGG - Intergenic
986191776 5:5503102-5503124 GATATATGTACATATAAAAGGGG - Intergenic
986248323 5:6031418-6031440 GAGTAATTTATAAAGAAAAGAGG - Intergenic
986474008 5:8106757-8106779 GGGTAATTTATAAATAAAAGAGG + Intergenic
986536415 5:8792733-8792755 GAGTAATTTACAAAGAAAAGAGG - Intergenic
986784487 5:11100700-11100722 CAATTATTTTCATATAAAAATGG + Intronic
986800720 5:11257409-11257431 GGGTAATTTACAAAGAAAAGAGG + Intronic
986816041 5:11412786-11412808 CGATTATTTACATATAAAAAAGG - Intronic
986933758 5:12857964-12857986 GAGTAATTTATAAAGAAAAGAGG + Intergenic
987197608 5:15543160-15543182 GAGTAATTTATAAAGAAAAGAGG + Intronic
987492435 5:18597779-18597801 GGGTAATTTATAAATAAAAGAGG - Intergenic
987492532 5:18598851-18598873 GGGTAATTTATAAATAAAAGAGG - Intergenic
987661787 5:20887857-20887879 GGGTTACTTATAAATAAAAGAGG + Intergenic
988194422 5:27984616-27984638 GGGTGATTTATAAATAAAAGAGG + Intergenic
988226405 5:28417333-28417355 GAGTAATTTATAAAGAAAAGAGG - Intergenic
988272186 5:29031844-29031866 GAGTAATTTATAGAGAAAAGAGG + Intergenic
988386730 5:30574765-30574787 GAGTAATTTATATACAAAGGAGG - Intergenic
988389474 5:30609269-30609291 GGGTTATTTATAAAGAAAAGAGG + Intergenic
988390066 5:30616334-30616356 GAGTAATTTATAAAGAAAAGAGG + Intergenic
988778621 5:34499290-34499312 GAGTCATTTATAAACAAAAGAGG - Intergenic
988794265 5:34637875-34637897 GGGTAATTTACAAAGAAAAGAGG + Intergenic
989042118 5:37240045-37240067 GAGTAATTTATAAAGAAAAGGGG + Intronic
989055745 5:37364961-37364983 GTGTTATTTTAAAATAAAAGTGG + Intronic
989256117 5:39367259-39367281 GGGTAATTTACAAACAAAAGTGG + Intronic
989347475 5:40446262-40446284 GGGTAATTTACAAAGAAAAGAGG + Intergenic
989382326 5:40821743-40821765 GGGTAATTTACAAAGAAAAGAGG + Intergenic
989393085 5:40923287-40923309 GGGTAATTTATAAATAAAAGAGG + Intronic
989526140 5:42455544-42455566 GAATTATTTCCATATAAATTGGG - Intronic
989619654 5:43371853-43371875 GAGTAATTTATAAAGAAAAGAGG + Intergenic
989668196 5:43881740-43881762 GGGTAATTTACAAAGAAAAGAGG - Intergenic
989752611 5:44913884-44913906 GGGTAATTTACAAACAAAAGAGG + Intergenic
989981735 5:50653987-50654009 GAGTAACTTATAAATAAAAGAGG + Intergenic
990038031 5:51346384-51346406 GGGTAATTTACAAAGAAAAGAGG - Intergenic
990592066 5:57276396-57276418 GGGTAATTTAAAAATAAAAGAGG + Intergenic
990679366 5:58223572-58223594 GGGTAATTTACAAAGAAAAGAGG - Intergenic
990739263 5:58895464-58895486 GAGTAATTTATAAAGAAAAGAGG - Intergenic
990754579 5:59054892-59054914 GAGTTTTTTAATTATAAAAAGGG - Intronic
990866132 5:60382209-60382231 GAGTTATTTCCAAATAAACTGGG + Intronic
991118027 5:62976623-62976645 GAGTAATTTATAAAGAAAAGAGG - Intergenic
991119030 5:62989719-62989741 GAGTAATTTATAAACAAAAGAGG + Intergenic
991188122 5:63834865-63834887 GAGTAATTTATAAAGAAAAGGGG - Intergenic
991467835 5:66933219-66933241 GAGATGTTTCCATATAAAAGGGG - Intronic
991934171 5:71785292-71785314 TAGATATTTACATAGAAATGAGG - Intergenic
992350377 5:75922160-75922182 CAGTTATTTAAATGTGAAAGAGG - Intergenic
992352907 5:75949256-75949278 GAGTAATTTATAAAGAAAAGAGG - Intergenic
992679586 5:79140799-79140821 GGGTAATTTATAAATAAAAGAGG - Intronic
992895472 5:81241356-81241378 GATTTATATACATTTCAAAGGGG - Intronic
993017052 5:82545776-82545798 GGGTAATTTACAAAGAAAAGAGG - Intergenic
993081415 5:83305613-83305635 GATTAATTTAGATATAAAATTGG + Intronic
993249564 5:85501273-85501295 GGGTAATTTACACAGAAAAGAGG - Intergenic
993453262 5:88098157-88098179 GGGTAATTTATAAATAAAAGAGG - Intergenic
993468500 5:88277344-88277366 GAGTAATTTATAAAGAAAAGGGG - Intergenic
993725536 5:91362490-91362512 GGGTAATTTACAAAGAAAAGAGG + Intergenic
993810779 5:92473275-92473297 GGGTAATTTACAAATAAAAGAGG - Intergenic
993951108 5:94176394-94176416 GGGTAATTTACAAAGAAAAGAGG - Intronic
994019175 5:95003764-95003786 GGGTAATTTATAAATAAAAGAGG - Intronic
994062806 5:95499480-95499502 GGGTAATTTACAGAGAAAAGAGG - Intronic
994338553 5:98598774-98598796 GGGTAATTTACAAATAAAAGAGG - Intergenic
994431837 5:99675920-99675942 GGGTAATTTACTTAAAAAAGAGG + Intergenic
994549045 5:101207698-101207720 GAGTAATTTATAAATAAAAAAGG - Intergenic
994580376 5:101633697-101633719 GAGTAATTTATAAAGAAAAGAGG + Intergenic
994589469 5:101755269-101755291 GAGTAATTTATAGAGAAAAGAGG - Intergenic
994617846 5:102128409-102128431 CAGCTACTTACATATAAAACTGG + Intergenic
995056570 5:107765916-107765938 GAGCTATTTAAAAATAAATGTGG - Intergenic
995181738 5:109236186-109236208 GGGTAATTTATAAATAAAAGAGG - Intergenic
995283352 5:110359011-110359033 GAGTGATTTATAAAGAAAAGAGG - Intronic
995301569 5:110590730-110590752 GAGTAATTTATAAATAAAAGAGG + Intronic
995369980 5:111408272-111408294 GAGTAATTTATAAAGAAAAGAGG + Intronic
995469131 5:112481759-112481781 TATTTATTTACATTTAAAACTGG - Intergenic
995608257 5:113881111-113881133 GGGTAATTTATAAATAAAAGAGG - Intergenic
995761257 5:115564649-115564671 GAGTAATTTATAAAGAAAAGAGG - Intergenic
996090262 5:119344120-119344142 GAGTAATTTATAAAGAAAAGAGG + Intronic
996103136 5:119465566-119465588 GGGTAATTTACAAAGAAAAGAGG - Intronic
996113092 5:119588521-119588543 GAGTTTTTTCAATATAGAAGTGG + Intronic
996198944 5:120646111-120646133 GTGTTATTGAAATGTAAAAGTGG + Intronic
996234931 5:121115473-121115495 TAGATATTTACTTATAAAAAAGG - Intergenic
996656451 5:125942563-125942585 GGGTAATTTATAAATAAAAGAGG - Intergenic
996673164 5:126143358-126143380 GAGTAATTTATAAAGAAAAGAGG + Intergenic
996682677 5:126245756-126245778 GAGTAATTTATAAAGAAAAGAGG + Intergenic
996829284 5:127721695-127721717 GAGTAATTTATAGATAAAAGAGG + Intergenic
997032817 5:130151554-130151576 GAGTAATTTATAAAGAAAAGAGG + Intronic
997188222 5:131902589-131902611 GGGTTATTTATAAAGAAAAGAGG - Intronic
997389563 5:133502794-133502816 GAGTAATTTATAAAGAAAAGAGG - Intronic
997575760 5:134976132-134976154 GGGTAATTTATAAATAAAAGAGG + Intronic
997575995 5:134977753-134977775 GAGTAATTTATAAAGAAAAGAGG + Intronic
997931336 5:138074397-138074419 AAGTTAGTTACATATATAAAAGG + Intergenic
998371206 5:141662493-141662515 GTGCTATTTAAAAATAAAAGTGG - Intronic
998427454 5:142040886-142040908 CAGTTTTTTACACAGAAAAGTGG - Intergenic
998442414 5:142173674-142173696 GAGTAATTTATAAAGAAAAGAGG + Intergenic
998568685 5:143238168-143238190 GAGTAATTTATAAAGAAAAGAGG - Intergenic
998711711 5:144833374-144833396 GAGTAATTTATAAAGAAAAGAGG + Intergenic
998767294 5:145502078-145502100 GAGTAATTTATAAAGAAAAGAGG + Intronic
998966992 5:147551707-147551729 GGGTAATTTACAAAGAAAAGAGG - Intergenic
999219822 5:149965623-149965645 GAGATTTTTCCATATAAGAGAGG + Intronic
999675606 5:153998678-153998700 GGGTAATTTACAAAGAAAAGAGG - Intronic
999675613 5:153998763-153998785 GGGTAATTTACAAAGAAAAGAGG - Intronic
999683418 5:154081160-154081182 AAGTTCCTTACATATAAAATAGG - Intronic
999863307 5:155672290-155672312 GAGTGATTTACAAAAGAAAGAGG - Intergenic
999953147 5:156671740-156671762 GAGTAATTTATAAAGAAAAGAGG + Intronic
999971597 5:156869240-156869262 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1000106679 5:158066594-158066616 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1000111731 5:158114461-158114483 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1000672377 5:164078404-164078426 GGGTAATTTATAAATAAAAGAGG - Intergenic
1000755026 5:165147591-165147613 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1001655116 5:173343391-173343413 GGGTAATTTACAGAGAAAAGAGG + Intergenic
1001872420 5:175168471-175168493 GGGTAATTTTCAAATAAAAGAGG + Intergenic
1001888070 5:175313860-175313882 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1002006115 5:176236557-176236579 GAGTAATTTATAAAGAAAAGGGG + Intergenic
1002009160 5:176263370-176263392 GAGTCATTTATAAAGAAAAGAGG + Intronic
1002217560 5:177648913-177648935 GAGTCATTTATAAAGAAAAGAGG - Intergenic
1002220264 5:177674080-177674102 GAGTAATTTATAAAGAAAAGGGG - Intergenic
1002317814 5:178355510-178355532 GAGTAATTTATAAAGAAAAGAGG + Intronic
1002390037 5:178903499-178903521 GAGTTATTTACATATAAAAGAGG + Intronic
1003259635 6:4505706-4505728 GGGTAATTTATAAATAAAAGAGG + Intergenic
1003259908 6:4507664-4507686 GGGTAATTTATAAATAAAAGAGG + Intergenic
1003280025 6:4683113-4683135 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1003373560 6:5552189-5552211 GTCATATTTACATATATAAGAGG + Intronic
1003652274 6:7972280-7972302 GAGTGATTCACATACAGAAGCGG + Intronic
1003788892 6:9520352-9520374 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1004165713 6:13255021-13255043 GGGTAATTTACAAAGAAAAGAGG + Intronic
1004167618 6:13270801-13270823 GTGTAATTTATAAATAAAAGAGG + Intronic
1004235985 6:13874706-13874728 GGGTAATTTATATAGAAAAGAGG + Intergenic
1004301316 6:14460546-14460568 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1004570063 6:16836109-16836131 GATTTATTGTCTTATAAAAGAGG - Intergenic
1005671481 6:28110286-28110308 GGGTAATTTACAAACAAAAGAGG - Intergenic
1005767015 6:29021979-29022001 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1006243773 6:32711088-32711110 GAGGTATTTAAATTTAAGAGAGG + Intergenic
1006248210 6:32758571-32758593 GAGTAATTTATAAAGAAAAGAGG - Intronic
1006409773 6:33866233-33866255 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1006675561 6:35760242-35760264 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1007209074 6:40177153-40177175 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1007438345 6:41834789-41834811 GGGTAATTTACAAAGAAAAGAGG - Intronic
1007881674 6:45175274-45175296 GAGTAATTTACAAAGGAAAGAGG + Intronic
1008296805 6:49787683-49787705 GAGGTTTTTACATATCAAAATGG - Intergenic
1008353836 6:50527105-50527127 GAGATATATACACATAAAAAAGG + Intergenic
1008499052 6:52161955-52161977 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1008718357 6:54317587-54317609 GAGTAATTTACAAAAGAAAGAGG - Intronic
1008881037 6:56380320-56380342 GAGTAATTTATAAAGAAAAGCGG - Intronic
1009037988 6:58141200-58141222 GGGTTATTTATAAATAAAAGAGG + Intergenic
1009213780 6:60894836-60894858 GGGTTATTTATAGATAAAAGAGG + Intergenic
1009394742 6:63186507-63186529 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1009525405 6:64738469-64738491 GAGTTACTTATAAAGAAAAGAGG - Intronic
1009559400 6:65220568-65220590 GAGTAATTTATAAAGAAAAGAGG - Intronic
1009720259 6:67459204-67459226 GAGTGATTTATAAAGAAAAGAGG - Intergenic
1009883305 6:69596269-69596291 GAGTAATTTATAAATAAAAGAGG + Intergenic
1009955410 6:70447424-70447446 GTCTTGTTTACATTTAAAAGGGG - Intronic
1009971365 6:70628347-70628369 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1010055017 6:71555305-71555327 GAGTTATTTATAAGGAAAAGAGG - Intergenic
1010094327 6:72022263-72022285 AAGTTGTTTACACATAAAGGTGG + Intronic
1010136212 6:72556234-72556256 CAATTATTTACATTTACAAGCGG + Intergenic
1010389835 6:75324023-75324045 GAGTGATTTATAAATAAAAGAGG - Intronic
1010430088 6:75768842-75768864 GAGTAATTTATAAAGAAAAGAGG + Intronic
1010744336 6:79543802-79543824 CAGTTATTTATAAATATAAGAGG + Intergenic
1010832027 6:80542704-80542726 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1011158022 6:84355456-84355478 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1011214170 6:84987422-84987444 GAGTTCTTTCCATATAACACTGG - Intergenic
1011694894 6:89903510-89903532 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1011708081 6:90023543-90023565 GAGTAATTTATAAAGAAAAGAGG - Intronic
1012011658 6:93795488-93795510 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1012173708 6:96052004-96052026 GGGTCATTTATATAGAAAAGAGG + Intronic
1012732256 6:102898480-102898502 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1012747733 6:103115996-103116018 GAGTAATTTATAAATAAGAGAGG - Intergenic
1012755900 6:103229172-103229194 GAGTAATTTATAAATGAAAGAGG - Intergenic
1012815781 6:104019789-104019811 AAATTAATTACAAATAAAAGTGG - Intergenic
1013440490 6:110160530-110160552 AAGTTATATACTAATAAAAGTGG - Intronic
1013606144 6:111750485-111750507 GAGTAATTTATAAAGAAAAGAGG - Intronic
1013611756 6:111802400-111802422 GGGTTATTTATAAAGAAAAGAGG - Intronic
1013713281 6:112927014-112927036 GAGTAATTTATAGAGAAAAGAGG + Intergenic
1013716526 6:112968923-112968945 GAGTAATTTATAAACAAAAGAGG + Intergenic
1013928754 6:115503848-115503870 GGGTGATTTACAAAGAAAAGAGG - Intergenic
1013962501 6:115917407-115917429 GAGCTATTTACAAAAGAAAGAGG + Intergenic
1014234162 6:118936459-118936481 GAATAATTTACAAATAAAAGAGG + Intergenic
1014524890 6:122490742-122490764 GAGGAATTTATAAATAAAAGAGG - Intronic
1014707298 6:124763284-124763306 GGGTTATTTACAAAGAAAAGAGG + Intronic
1014759149 6:125336222-125336244 GGATTACTTACATATAACAGAGG - Intergenic
1014814059 6:125916316-125916338 GAGTAATTTACAAACAAAAGAGG - Intronic
1014815573 6:125932015-125932037 GGGTTATTTATAAAGAAAAGAGG - Exonic
1014878685 6:126694489-126694511 GGGTAATTTACAGAAAAAAGAGG + Intergenic
1014939802 6:127424673-127424695 GAGTATTTTAAACATAAAAGGGG - Intergenic
1015957699 6:138615430-138615452 GGGTTATTTCCATATAAAAAAGG - Intronic
1016153351 6:140771963-140771985 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1016222317 6:141689893-141689915 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1016303863 6:142662485-142662507 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1016309372 6:142716529-142716551 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1016311705 6:142740195-142740217 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1016504522 6:144763928-144763950 GAGTTCTTTACTTAAAAAACTGG - Intronic
1016545671 6:145220772-145220794 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1016702613 6:147070540-147070562 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1016721440 6:147303454-147303476 GAGTAATTCACAAAGAAAAGAGG - Intronic
1017296077 6:152796450-152796472 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1017657785 6:156646362-156646384 AACTTCTTTACCTATAAAAGAGG - Intergenic
1017989002 6:159470138-159470160 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1018209750 6:161469387-161469409 GAGTAATTTATAAAGAAAAGAGG - Intronic
1018234897 6:161714371-161714393 GATTTAGATACTTATAAAAGAGG + Intronic
1018585347 6:165350931-165350953 GAGTAATTTATAAAGAAAAGAGG - Intronic
1018608403 6:165623111-165623133 GGGTGATTTATAAATAAAAGAGG - Intronic
1018660799 6:166085787-166085809 GAGGTATTTACTTTTCAAAGTGG - Intergenic
1018834440 6:167472484-167472506 GGGTAATTTATATAGAAAAGAGG + Intergenic
1019011306 6:168845696-168845718 GGGTAATTTATAAATAAAAGAGG + Intergenic
1020584213 7:10045625-10045647 TTGATATTTACATATATAAGTGG - Intergenic
1020611821 7:10407317-10407339 GAGTTATTCACATTTAAAGATGG - Intergenic
1020658248 7:10952794-10952816 GAGTTATTTACTTAAGATAGTGG + Intergenic
1020795413 7:12672805-12672827 TATTTATTTGCATATACAAGTGG - Intergenic
1020826583 7:13036399-13036421 GAGTCATTTATAAAGAAAAGAGG - Intergenic
1020910517 7:14124767-14124789 TAGTTATTTGCATATCACAGAGG - Intergenic
1021042065 7:15874363-15874385 GATTTATTTAGAGATAGAAGTGG - Intergenic
1021169376 7:17379939-17379961 TAGTTATTTTTATATAAAAATGG - Intergenic
1021332369 7:19354693-19354715 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1021471492 7:21007677-21007699 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1021482229 7:21130389-21130411 GAGTTAATTAGAAAGAAAAGGGG - Intergenic
1021643931 7:22768922-22768944 GGGTAATTTATAAATAAAAGAGG - Intergenic
1021648617 7:22810899-22810921 GTCTTATTTACAAATAAAACAGG - Intergenic
1022256774 7:28666262-28666284 GAGTCATATACATTTATAAGGGG - Intronic
1022377045 7:29823951-29823973 GAGAAATTTATAAATAAAAGAGG - Intronic
1022436886 7:30395699-30395721 GGGTAATTTACAAATGAAAGAGG - Intronic
1022601764 7:31767569-31767591 GAGTAATTTATAAAGAAAAGAGG - Intronic
1022861845 7:34375816-34375838 GAGTAACTTATAAATAAAAGAGG - Intergenic
1022873471 7:34503847-34503869 GAGTCATTTATAAAGAAAAGAGG + Intergenic
1023394636 7:39741653-39741675 TAATTATTTACAAATAAAAGAGG - Intergenic
1024059793 7:45689333-45689355 GGGTTATTTATAAAGAAAAGAGG + Intronic
1024157606 7:46640540-46640562 GGGTAATTTATAAATAAAAGAGG + Intergenic
1024396298 7:48871986-48872008 GAATTTTTTAAATATAAAGGAGG - Intergenic
1024761418 7:52601158-52601180 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1024767546 7:52678351-52678373 GGGTAATTTATAAATAAAAGAGG + Intergenic
1024867777 7:53923370-53923392 GAAGTATATACATATAAAATGGG - Intergenic
1024936958 7:54720200-54720222 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1024947887 7:54829588-54829610 GAGTAATTTATAGAGAAAAGAGG - Intergenic
1025267283 7:57474019-57474041 GGGTAATTTACATAAAAAGGAGG - Intergenic
1025625337 7:63216315-63216337 GGGTAATTTATAAATAAAAGAGG + Intergenic
1025838936 7:65125319-65125341 GATTTCTTTACATTTAAATGTGG + Intergenic
1025884130 7:65570646-65570668 GATTTCTTTACATTTAAATGTGG - Intergenic
1025889314 7:65631960-65631982 GATTTCTTTACATTTAAATGTGG + Intergenic
1026104233 7:67408463-67408485 CAGTAATTTACAAAGAAAAGAGG + Intergenic
1026414653 7:70166146-70166168 GGGTAATTTACAAAGAAAAGAGG - Intronic
1026432299 7:70359405-70359427 GGGTAATTTATAAATAAAAGAGG + Intronic
1026549294 7:71353845-71353867 GGGTAATTTACAAATAAAAGAGG + Intronic
1026617367 7:71917531-71917553 GGGTAATTTATAAATAAAAGAGG + Intronic
1026673259 7:72407663-72407685 GGGTAATTTACAAAGAAAAGGGG - Intronic
1027448795 7:78305319-78305341 GAGTTATCTCCATACAAAGGGGG - Intronic
1027783043 7:82543561-82543583 TAATTATTTTAATATAAAAGTGG - Intergenic
1027958896 7:84918839-84918861 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1028216162 7:88136037-88136059 GAGTTATTTTCAAATACAAGTGG - Intronic
1028323657 7:89495042-89495064 GGGTAATTTACAGAGAAAAGAGG + Intergenic
1028409308 7:90510798-90510820 CAGTTATTTACATAGAACAGTGG - Intronic
1028424394 7:90670483-90670505 GAGTCATTTATAAAGAAAAGAGG + Intronic
1028498038 7:91484252-91484274 GAATAATTTACATACAAAAATGG - Intergenic
1028804731 7:95012144-95012166 GAGTAATTTATAAAGAAAAGAGG + Intronic
1028925094 7:96348927-96348949 GAGTAATTTATAAAGAAAAGCGG - Intergenic
1029162864 7:98564972-98564994 GAGTCATTTACAAAGAAAAGAGG - Intergenic
1029236097 7:99120259-99120281 GAGTAATTTACAAAGAAAAGAGG - Intronic
1029914121 7:104189193-104189215 GGGTAATTTACAAAGAAAAGAGG + Intronic
1030138158 7:106278754-106278776 GAGTTATTTACATTGTAAACTGG - Intronic
1030752321 7:113242848-113242870 GGGTAATTTATAAATAAAAGAGG - Intergenic
1030878808 7:114850274-114850296 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1030960918 7:115921165-115921187 GATTTATTTAAATATTAAAATGG + Intergenic
1031183946 7:118452191-118452213 GATTGAGTTACATATAAAACAGG + Intergenic
1031242523 7:119265315-119265337 AAGTAATTTATAAATAAAAGAGG + Intergenic
1031246669 7:119322003-119322025 AAGTTGTTTACAAAAAAAAGTGG - Intergenic
1031287876 7:119895197-119895219 GTGTAATTTATAAATAAAAGAGG + Intergenic
1031323255 7:120359992-120360014 GAGTAATTTATAAAGAAAAGAGG - Intronic
1031789974 7:126090407-126090429 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1031853138 7:126890014-126890036 GATTTCTTTACATTTAAATGTGG - Intronic
1031877946 7:127163133-127163155 GGGTAATTTACAAAGAAAAGAGG + Intronic
1032182044 7:129688565-129688587 GGGTAATTTATAAATAAAAGAGG + Intronic
1032524935 7:132572940-132572962 GTGTTATTTATATTTAAAAGCGG - Intronic
1032546091 7:132744290-132744312 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1032553580 7:132808326-132808348 GAATTACTTATAAATAAAAGTGG - Intronic
1032555478 7:132828853-132828875 AAGTTATCTACACATAAAAATGG - Intronic
1032618410 7:133499901-133499923 GGGTAATTTACAAAGAAAAGAGG - Intronic
1033357390 7:140611229-140611251 AAGTGATTTAAATATAAAATGGG + Intronic
1033611645 7:142968906-142968928 CAGTTATAGACTTATAAAAGTGG - Intergenic
1033763441 7:144461770-144461792 GGGTAATTTACAAAGAAAAGAGG - Intronic
1033856748 7:145571442-145571464 GAGTAATTTATACAGAAAAGAGG + Intergenic
1033910855 7:146261193-146261215 GGGTAATTTACAAACAAAAGAGG - Intronic
1034258663 7:149739871-149739893 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1034502143 7:151457691-151457713 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1035062110 7:156077072-156077094 GACTAATTTATAAATAAAAGAGG + Intergenic
1035178680 7:157073459-157073481 GGGTAATTTACAACTAAAAGAGG + Intergenic
1035405582 7:158595034-158595056 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1035578334 8:723278-723300 GGGTTATTTATAAAGAAAAGAGG - Intronic
1035714057 8:1740270-1740292 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1035715119 8:1748083-1748105 GGGTCATTTACAAAGAAAAGAGG - Intergenic
1035819465 8:2576734-2576756 GGGTAATTTACAAAGAAAAGGGG + Intergenic
1035821964 8:2602827-2602849 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1035822657 8:2610864-2610886 GAGTAACTTATATAGAAAAGAGG - Intergenic
1035826177 8:2646329-2646351 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1036124416 8:6049819-6049841 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1036420472 8:8590781-8590803 GGGTAATTTATAAATAAAAGAGG - Intergenic
1036456485 8:8913381-8913403 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1036527179 8:9546242-9546264 GGGTAATTTACATAGGAAAGAGG + Intergenic
1036726354 8:11224321-11224343 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1036742770 8:11379927-11379949 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1037081826 8:14797006-14797028 GGGTAATTTATAAATAAAAGAGG - Intronic
1037348053 8:17920923-17920945 GAAATATTTACATTGAAAAGGGG - Intergenic
1037389385 8:18377590-18377612 GAGTGATTTATAAATAAAAGAGG + Intergenic
1037392446 8:18407988-18408010 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1037393763 8:18420783-18420805 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1037439832 8:18904019-18904041 GAGTAATTTATAAAGAAAAGAGG + Intronic
1037541162 8:19872807-19872829 GGGTAATTTATAAATAAAAGAGG + Intergenic
1037566018 8:20119104-20119126 GGGTAATTTATAAATAAAAGAGG - Intergenic
1038376064 8:27041620-27041642 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1038513814 8:28166332-28166354 TATTTTTTTACATATAAAAATGG + Intronic
1038560081 8:28568303-28568325 CAATTATTTTCATATAAAATAGG - Exonic
1038713109 8:29967036-29967058 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1038948257 8:32385440-32385462 GGGTAATTTATAAATAAAAGAGG + Intronic
1038959376 8:32502081-32502103 GGGTAATTTACAAAGAAAAGAGG + Intronic
1039014222 8:33128148-33128170 CAGTTATTTTCATAGAAAATAGG - Intergenic
1039407981 8:37329061-37329083 GAGTCATTTCGATTTAAAAGTGG - Intergenic
1039418236 8:37413959-37413981 GGGTAATTTACACAGAAAAGAGG - Intergenic
1039808635 8:41025219-41025241 GGGTGATTTACAAAGAAAAGAGG - Intergenic
1040630496 8:49204348-49204370 GAGTAATTTATACAGAAAAGAGG - Intergenic
1040802069 8:51352685-51352707 GGATAATTTACAAATAAAAGAGG - Intronic
1040807931 8:51415296-51415318 GTGTAATTTACAAAGAAAAGAGG + Intronic
1040843254 8:51807143-51807165 GGGTAATTTACAAAGAAAAGAGG + Intronic
1041077750 8:54184643-54184665 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1041125505 8:54634273-54634295 GAATTATTAACATATACAATGGG + Intergenic
1041331842 8:56735327-56735349 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1041548920 8:59078611-59078633 GAGTAATTTATAAAGAAAAGAGG - Intronic
1041801296 8:61803381-61803403 GGGTAATTTATAAATAAAAGAGG - Intergenic
1041811586 8:61916683-61916705 AACTTATTTACATTTAAAACTGG - Intergenic
1041940359 8:63380954-63380976 GAGTTATTTATAATGAAAAGTGG - Intergenic
1042008378 8:64209286-64209308 GAGTAATTTAGAAAGAAAAGAGG + Intergenic
1042010497 8:64240069-64240091 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1042018973 8:64349474-64349496 GAGTGCTTTACAAATGAAAGAGG + Intergenic
1042152488 8:65803107-65803129 GAGTAATTTATAAAGAAAAGAGG - Intronic
1042170144 8:65983426-65983448 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1042206772 8:66337523-66337545 GACTGATGTACTTATAAAAGGGG - Intergenic
1042330270 8:67572583-67572605 GGGTAATTTATATACAAAAGAGG - Intronic
1042440237 8:68817710-68817732 GGGTAATTTACAAAGAAAAGAGG + Intronic
1042443681 8:68858551-68858573 GAAAAATATACATATAAAAGTGG + Intergenic
1042715270 8:71765567-71765589 GTGTAATTTATAAATAAAAGAGG + Intergenic
1042867286 8:73367009-73367031 GAATTAGTCACAGATAAAAGTGG + Intergenic
1042868129 8:73373339-73373361 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1042887239 8:73565433-73565455 GAGTAATTTATAAAGAAAAGAGG - Intronic
1042905033 8:73763831-73763853 GAGCTTTTTACTTATAAAACTGG + Intronic
1043358277 8:79439462-79439484 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1043396818 8:79845544-79845566 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1043397745 8:79855220-79855242 GAGTTTCTTACTTTTAAAAGAGG - Intergenic
1043597903 8:81905218-81905240 GGGTAATTTATAAATAAAAGAGG - Intergenic
1043997403 8:86835439-86835461 AAGTTATTTATATATTAAATGGG + Intergenic
1044043320 8:87398017-87398039 GAGCAATTTACAAATGAAAGAGG - Intronic
1044275903 8:90299032-90299054 GAATTATTTACATATACATCTGG + Intergenic
1044345255 8:91097465-91097487 GGGTAATTTATAAATAAAAGAGG + Intergenic
1044552935 8:93532364-93532386 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1044700894 8:94964466-94964488 GGGTAATTTATAAATAAAAGAGG + Intronic
1044754590 8:95447905-95447927 GAGTAATTTATAAACAAAAGAGG - Intergenic
1044787395 8:95809134-95809156 GAGTAATTTATAAATAAAAGAGG + Intergenic
1044806754 8:96016442-96016464 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1045038979 8:98202705-98202727 GAGTAATTTATTTTTAAAAGAGG - Intronic
1045081210 8:98627692-98627714 GGGTAATTTATAAATAAAAGAGG - Intronic
1045551111 8:103173297-103173319 GAGTCATTTAAATACAGAAGAGG - Intronic
1045722666 8:105131908-105131930 GATTTATTTACAGTTGAAAGTGG - Intronic
1045872062 8:106938500-106938522 GAGTGATTTTCTTATAAAACTGG - Intergenic
1045908641 8:107378848-107378870 GAGTAATTTATAAACAAAAGAGG - Intronic
1046065968 8:109197117-109197139 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1046278442 8:111992736-111992758 GAATTAGTTAGATAAAAAAGAGG - Intergenic
1046369771 8:113286978-113287000 GATTTATTTAAAAATAAAAGTGG + Intronic
1046377985 8:113412013-113412035 TAGTTTTTTACTTATAAAATGGG + Intronic
1046396657 8:113649145-113649167 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1046427314 8:114071818-114071840 GTACTATTTACATATAAAATAGG + Intergenic
1046591962 8:116217576-116217598 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1046666614 8:117010662-117010684 GGGTAATTTACAAAGAAAAGAGG + Intronic
1046689425 8:117266647-117266669 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1046822065 8:118644564-118644586 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1046879423 8:119292004-119292026 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1046911729 8:119635388-119635410 AAATTACTTACATATCAAAGAGG + Intronic
1047283903 8:123470000-123470022 GAGGTAATTAGATATAAATGAGG + Intergenic
1047546364 8:125821569-125821591 GAGTAATTTATAAACAAAAGAGG + Intergenic
1047793766 8:128233167-128233189 GGGTAATTTACAAAGAAAAGTGG + Intergenic
1047888733 8:129282966-129282988 GAGTAATTTATAAAGAAAAGGGG + Intergenic
1047980015 8:130171324-130171346 GAGTAATTTATAAAGAAAAGAGG + Intronic
1048094676 8:131278843-131278865 GGGTAATTTATAAATAAAAGAGG + Intergenic
1048226205 8:132588722-132588744 GGGTAATTTATAAATAAAAGAGG + Intronic
1048499866 8:134965627-134965649 GAGTAATTTATAAATGAAAGAGG - Intergenic
1048648889 8:136452769-136452791 GTGTTACTTACATGTTAAAGTGG + Intergenic
1048733452 8:137470596-137470618 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1048838697 8:138546121-138546143 GTGTAATTTACAAAGAAAAGAGG + Intergenic
1049250313 8:141584877-141584899 GGGTAATTTACACAGAAAAGAGG - Intergenic
1049450260 8:142657457-142657479 GAGTAATTTATAAAGAAAAGAGG + Exonic
1049877782 8:145037136-145037158 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1050109696 9:2201644-2201666 GGGTTATTTATAAAGAAAAGGGG + Intergenic
1050156838 9:2676291-2676313 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1050210101 9:3244365-3244387 GAGTTATTAACATATATATATGG + Intronic
1050236545 9:3587179-3587201 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1050288806 9:4131703-4131725 GGGTAATTTACAAAGAAAAGAGG - Intronic
1050402616 9:5271863-5271885 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1050402704 9:5272685-5272707 CACTTATTTACATTTTAAAGAGG + Intergenic
1050469582 9:5972760-5972782 GAGTAATTTATAAAGAAAAGAGG - Intronic
1050715079 9:8515060-8515082 GAGTAATTTACAAAGGAAAGAGG - Intronic
1050786661 9:9412209-9412231 TAATTATTAAAATATAAAAGTGG - Intronic
1050833023 9:10037530-10037552 GGGTAATTTATAAATAAAAGAGG - Intronic
1050869828 9:10552991-10553013 GATTTATTTACAGTTCAAAGTGG + Intronic
1051020143 9:12533739-12533761 GAGTAATTTATAAATAAAAGAGG + Intergenic
1051043671 9:12847896-12847918 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1051127437 9:13820603-13820625 GGGTAATTTATAAATAAAAGAGG - Intergenic
1051212581 9:14760177-14760199 CAGATATTTACAACTAAAAGGGG + Intronic
1051326813 9:15980885-15980907 GAGTAATTTACAAAAGAAAGAGG + Intronic
1051693735 9:19745288-19745310 GGGTAATTTACAAAGAAAAGAGG - Intronic
1051767286 9:20539393-20539415 GGGTAATTTATAAATAAAAGAGG + Intronic
1051969516 9:22871049-22871071 GAGATATCTGCATGTAAAAGAGG + Intergenic
1052036473 9:23686956-23686978 GAGTTTTTTAGGTATAATAGTGG + Intergenic
1052207518 9:25860971-25860993 GGGTAATTTATAAATAAAAGAGG - Intergenic
1052362886 9:27578764-27578786 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1052622037 9:30925131-30925153 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1053185761 9:36014753-36014775 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1053264381 9:36699963-36699985 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1053702016 9:40704051-40704073 GGGTTATTTGAAGATAAAAGAGG - Intergenic
1054412075 9:64827511-64827533 GGGTTATTTGAAGATAAAAGAGG - Intergenic
1054709399 9:68496324-68496346 CAGCTATTCACACATAAAAGGGG + Intronic
1054854020 9:69878779-69878801 GGGTAATTTACAAAGAAAAGAGG + Intronic
1054966344 9:71031691-71031713 GAGATTTTTACATATAAAAAGGG - Intronic
1055089491 9:72348212-72348234 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1055191839 9:73534008-73534030 GGGTAATTTATATAGAAAAGAGG - Intergenic
1055502752 9:76918091-76918113 GACTGATTTACATGTAAAAGGGG + Intergenic
1055531456 9:77188259-77188281 GGGTAATTTACAAAGAAAAGAGG - Intronic
1055619312 9:78107274-78107296 GGGTAATTTACAGAGAAAAGAGG - Intergenic
1055637818 9:78295701-78295723 GAGTTATTTACGTAAAATAATGG + Intergenic
1055713435 9:79089951-79089973 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1055874352 9:80924252-80924274 GAGAAAGTTTCATATAAAAGAGG + Intergenic
1056397940 9:86198451-86198473 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1056734520 9:89196640-89196662 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1056742824 9:89275020-89275042 GAGTAATTTATAAATGAAAGAGG + Intergenic
1056860501 9:90176548-90176570 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1056874608 9:90316194-90316216 CAGTCATTTAAATATAAAATGGG - Intergenic
1056878507 9:90363717-90363739 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1056880712 9:90390794-90390816 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1056978072 9:91279424-91279446 GAGTAATTTATAAAGAAAAGAGG + Intronic
1057241319 9:93413359-93413381 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1057325547 9:94060535-94060557 GAGTAATTTATAAAGAAAAGAGG + Intronic
1057424174 9:94935337-94935359 GGGTAATTTATAAATAAAAGAGG - Intronic
1057551972 9:96057726-96057748 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1058045713 9:100354508-100354530 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1058272674 9:102992798-102992820 GAGTAATTTATAGAGAAAAGAGG - Intergenic
1058281344 9:103119362-103119384 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1058292071 9:103255960-103255982 GGGTAATTTATAAATAAAAGAGG + Intergenic
1058341648 9:103904700-103904722 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1058525297 9:105851108-105851130 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1059706586 9:116829466-116829488 GGGTAATTTATAAATAAAAGAGG + Intronic
1059765391 9:117379123-117379145 GGGTAATTTATAAATAAAAGAGG - Intronic
1060019724 9:120118578-120118600 GAGTAATTTATAAATAAAAGAGG - Intergenic
1060122512 9:121007645-121007667 GAGGTATTTACATTTTAATGTGG + Intronic
1060307827 9:122432498-122432520 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1060366008 9:123014631-123014653 GAGTAATTTATAAAGAAAAGAGG + Intronic
1060833758 9:126739382-126739404 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1061223047 9:129263528-129263550 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1061956429 9:133963950-133963972 GAGCTATTTACATTTAATTGTGG - Intronic
1185745371 X:2568525-2568547 GAGTGATTTATAAAGAAAAGAGG - Intergenic
1185950212 X:4423958-4423980 GGGTAATTTATAAATAAAAGAGG + Intergenic
1186053578 X:5626015-5626037 CAATTATTTAGATATGAAAGTGG + Intergenic
1186102525 X:6172107-6172129 GGGTAATTTACAAAGAAAAGAGG - Intronic
1186227051 X:7410542-7410564 GAGTAATTTATAAATAAAAGAGG - Intergenic
1186539270 X:10383511-10383533 GGGTTATTTATAAAGAAAAGAGG + Intergenic
1186552411 X:10520933-10520955 GGGTAATTTACAAAGAAAAGGGG + Intronic
1186568420 X:10689197-10689219 GGGTAATTTACAAAGAAAAGAGG + Intronic
1186656180 X:11614302-11614324 GGGTAATTTACAGAGAAAAGAGG + Intronic
1186974952 X:14892181-14892203 GAGTGATTTATAAAGAAAAGAGG + Intronic
1187107035 X:16253990-16254012 GAGTTGTTTTCATACAAAGGTGG + Intergenic
1187462823 X:19502839-19502861 GGGTAATTTATATACAAAAGTGG - Intronic
1187574650 X:20541544-20541566 GAGTAATTTATAAACAAAAGAGG - Intergenic
1187628554 X:21143341-21143363 GCGTAATTTACAAACAAAAGAGG + Intergenic
1187757078 X:22539712-22539734 GGGTAATTTATATAGAAAAGAGG - Intergenic
1188082916 X:25866478-25866500 GTATTATTTAAAAATAAAAGAGG + Intergenic
1188162546 X:26821111-26821133 TAGTTATTTCCATCAAAAAGTGG + Intergenic
1188186760 X:27125865-27125887 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1188191041 X:27172254-27172276 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1188221671 X:27548029-27548051 GGGTTATTTATAAAGAAAAGTGG - Intergenic
1188251802 X:27905194-27905216 GAGTAGTTTATATAAAAAAGAGG + Intergenic
1188251831 X:27905517-27905539 GAGTAGTTTATATAAAAAAGAGG + Intergenic
1188257102 X:27976538-27976560 GAGTGATTCACATATAAGAAGGG + Intergenic
1188422751 X:30009471-30009493 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1188441325 X:30217192-30217214 GGGTAATTTACAAAGAAAAGAGG + Intronic
1188813266 X:34679805-34679827 GGGTAATTTATAAATAAAAGAGG + Intergenic
1189001289 X:36949835-36949857 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1189011274 X:37048093-37048115 GAGTAATTTATAAACAAAAGAGG - Intergenic
1189127192 X:38461152-38461174 GAGTAATTTATAAAGAAAAGAGG + Intronic
1189462904 X:41256702-41256724 AAGTTTCTTTCATATAAAAGCGG - Intergenic
1189735654 X:44067103-44067125 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1189903496 X:45733724-45733746 GGGTAATTTACAAACAAAAGAGG - Intergenic
1190524232 X:51311700-51311722 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1190526004 X:51330696-51330718 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1190576696 X:51846572-51846594 GGGTAATTTACAAAGAAAAGAGG + Intronic
1190600891 X:52090403-52090425 GGGTAATTTATAAATAAAAGAGG - Intergenic
1190703749 X:53007889-53007911 GAGTGATTTACACAGAAAAGAGG + Intergenic
1190959295 X:55229249-55229271 GAGTTATTTATAATGAAAAGAGG - Intronic
1191600220 X:62995417-62995439 GGGTGATTTATAAATAAAAGAGG - Intergenic
1191680654 X:63836704-63836726 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1191710826 X:64148777-64148799 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1191891234 X:65944184-65944206 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1191932784 X:66392776-66392798 GAGCAATTTACAAAAAAAAGTGG - Intergenic
1191975659 X:66868503-66868525 GATTTACTCACATATAAAATGGG - Intergenic
1192042202 X:67634445-67634467 AATTTATTTACATGTAAAATGGG - Intronic
1192070941 X:67940802-67940824 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1192526102 X:71845988-71846010 GGGTAATTTAAAAATAAAAGAGG + Intergenic
1192862420 X:75090144-75090166 GTGTCATTTAGATATAATAGAGG - Intronic
1192868589 X:75163214-75163236 ATGTTAATTACCTATAAAAGGGG - Intergenic
1192955185 X:76062836-76062858 GGGTAATTTATAAATAAAAGAGG + Intergenic
1193482902 X:82048978-82049000 GGGTAATTTATAAATAAAAGAGG - Intergenic
1193549817 X:82878090-82878112 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1193634491 X:83931356-83931378 GGGTAATTTATAAATAAAAGAGG - Intergenic
1193824138 X:86201929-86201951 GCCCTATTTATATATAAAAGGGG + Intronic
1193850382 X:86530614-86530636 GAGTAATTTATAAAGAAAAGAGG - Intronic
1193861603 X:86673999-86674021 AGGTAATTTACATAGAAAAGAGG - Intronic
1193865174 X:86721739-86721761 GAGTAATTTATAAAGAAAAGAGG + Intronic
1193887338 X:86998639-86998661 GTGTAATTTATATAAAAAAGAGG + Intergenic
1193930702 X:87547435-87547457 GAGTAATTTATGAATAAAAGAGG - Intronic
1193965039 X:87974900-87974922 GGGTAATTTATAAATAAAAGAGG - Intergenic
1194017100 X:88636361-88636383 GGGTAATTTATAAATAAAAGAGG - Intergenic
1194070994 X:89326027-89326049 GAGTAATTTACAAAGAAAAAAGG - Intergenic
1194150928 X:90324433-90324455 GAGTCATTTATAAAGAAAAGAGG + Intergenic
1194192170 X:90850842-90850864 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1194212440 X:91084456-91084478 GAGTAATTTATAAATAAAAGAGG + Intergenic
1194241823 X:91458414-91458436 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1194373095 X:93098693-93098715 GGGTAATTTATAAATAAAAGAGG - Intergenic
1194397713 X:93405731-93405753 TCATTATTTACATATAAATGAGG - Intergenic
1194460600 X:94162459-94162481 GGGTAATTTACAGAGAAAAGAGG - Intergenic
1194489185 X:94526354-94526376 GAGTAATTTATAAAGAAAAGGGG + Intergenic
1194501895 X:94691410-94691432 GAGTAATTTACAAAATAAAGAGG - Intergenic
1194506944 X:94744998-94745020 GAGTAATTTATATAGAAAGGAGG - Intergenic
1194549000 X:95273335-95273357 GGGTAATTTATATACAAAAGAGG + Intergenic
1194590957 X:95798816-95798838 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1194603922 X:95958014-95958036 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1194752282 X:97698305-97698327 GATTAATGTCCATATAAAAGTGG - Intergenic
1194856390 X:98933953-98933975 GAGTAATTTACAAAGAAAAGAGG - Intergenic
1194875971 X:99187925-99187947 GGGTAATTTATAAATAAAAGAGG - Intergenic
1195141295 X:101963216-101963238 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1195214346 X:102683651-102683673 GAGTTATTTATAAAGGAAAGAGG + Intergenic
1195249712 X:103031399-103031421 GGGTAATTTATAAATAAAAGAGG - Intergenic
1195580607 X:106496865-106496887 GGGTAATTTATATAGAAAAGAGG - Intergenic
1195717254 X:107828608-107828630 GGGTAATTTATAAATAAAAGAGG - Intronic
1195754174 X:108184658-108184680 GGGTAATTTACAAAGAAAAGAGG - Intronic
1196166315 X:112539022-112539044 GGGTAATTTATAAATAAAAGAGG + Intergenic
1196223215 X:113136320-113136342 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1196296733 X:114006293-114006315 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1196383238 X:115117918-115117940 GAGTTATTAACATACAATATAGG - Intronic
1196390494 X:115203029-115203051 GAGTAATTTATAAAGAAAAGAGG + Intronic
1196550277 X:117016273-117016295 GGGTAATTTACATAGAAAATAGG - Intergenic
1196712744 X:118780471-118780493 GGGTAATTTATAAATAAAAGAGG + Intronic
1196724474 X:118883963-118883985 GGGTAATTTATAAATAAAAGAGG - Intergenic
1196865841 X:120070038-120070060 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1196877255 X:120166242-120166264 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1196885219 X:120237904-120237926 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1197308819 X:124878692-124878714 GGGTAATTTACAAAGAAAAGAGG - Intronic
1197397520 X:125945375-125945397 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1197440096 X:126476992-126477014 GGGTAATTTATAAATAAAAGAGG + Intergenic
1197457659 X:126698114-126698136 AAGTCATTTATAGATAAAAGTGG + Intergenic
1197813790 X:130476050-130476072 GGGTAATTTACAAAGAAAAGTGG + Intergenic
1198083057 X:133257212-133257234 GGGTAATTTACAAAGAAAAGAGG - Intergenic
1198133519 X:133723820-133723842 GAGTAATTTATAAAGAAAAGAGG - Intronic
1198260977 X:134964717-134964739 GGGTAATTTACAAATAAAAGAGG + Intergenic
1198688337 X:139251597-139251619 GGATAATTTACATAGAAAAGAGG + Intergenic
1198870293 X:141171755-141171777 GGGTAATTTACAGAGAAAAGAGG - Intergenic
1198919187 X:141707133-141707155 GAGTTATTTATAAAGGAAAGAGG + Intergenic
1198946908 X:142025979-142026001 GAGTAATTTACAAAGAAAAGAGG + Intergenic
1199038083 X:143077694-143077716 GAGTCATTTATAAAGAAAAGAGG + Intergenic
1199476619 X:148253699-148253721 GGGTAATTTATAAATAAAAGAGG - Intergenic
1199657528 X:150011601-150011623 GGGTAATTTACAAAGAAAAGAGG + Intergenic
1200255895 X:154582729-154582751 GAGTAATTTATAAAGAAAAGAGG - Intergenic
1200261874 X:154621674-154621696 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1200343877 X:155428317-155428339 GAGGTATTTACAATTAAGAGGGG - Intergenic
1200497294 Y:3901192-3901214 GAGTCATTTATAAAGAAAAGAGG + Intergenic
1200538807 Y:4433289-4433311 GAGTAATTTATAAAGAAAAGAGG + Intergenic
1200681134 Y:6212734-6212756 GGGTAATTTATAAATAAAAGAGG - Intergenic
1200725224 Y:6661768-6661790 GAGTAATTTACAAAGAAAAAAGG - Intergenic
1201538981 Y:15085494-15085516 GGGTTATTTATAAAGAAAAGAGG - Intergenic
1201683072 Y:16670476-16670498 GGGTAATTTATAAATAAAAGAGG + Intergenic