ID: 1002390038

View in Genome Browser
Species Human (GRCh38)
Location 5:178903516-178903538
Sequence AAGAGGTCTTTCCTATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 149}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002390032_1002390038 25 Left 1002390032 5:178903468-178903490 CCTGTCTACACCCTTTGCCCATT 0: 1
1: 0
2: 3
3: 30
4: 268
Right 1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 149
1002390033_1002390038 15 Left 1002390033 5:178903478-178903500 CCCTTTGCCCATTTTTATATTGA 0: 1
1: 14
2: 80
3: 309
4: 1381
Right 1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 149
1002390034_1002390038 14 Left 1002390034 5:178903479-178903501 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 149
1002390035_1002390038 8 Left 1002390035 5:178903485-178903507 CCCATTTTTATATTGAGTTATTT 0: 1
1: 30
2: 292
3: 1172
4: 4745
Right 1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 149
1002390036_1002390038 7 Left 1002390036 5:178903486-178903508 CCATTTTTATATTGAGTTATTTA 0: 1
1: 3
2: 85
3: 602
4: 3680
Right 1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG 0: 1
1: 0
2: 1
3: 17
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002390038 Original CRISPR AAGAGGTCTTTCCTATAAAG TGG Intronic
900589600 1:3453823-3453845 AACAGGCCTTTCCTGAAAAGGGG + Intergenic
904966793 1:34380411-34380433 AAGAGGTGTTTGCAATAAATTGG - Intergenic
906770866 1:48481598-48481620 AAGAGCTCTTTCAAAAAAAGTGG + Intergenic
909867912 1:80697403-80697425 AAGAGATCTTACCTATAGAGTGG + Intergenic
910544602 1:88399592-88399614 AGGAGATCTTTGTTATAAAGTGG - Intergenic
910807227 1:91200900-91200922 AATAGGTTTTTCCTCTAAATGGG + Intergenic
911310455 1:96286466-96286488 AAGAGAAATTTCCTATTAAGAGG - Intergenic
911897093 1:103450198-103450220 AAGAGGTCTTTGCCCTCAAGTGG - Intergenic
912722534 1:112032265-112032287 AAGAGGTCTTTTGTACCAAGGGG - Intergenic
913280055 1:117177166-117177188 AAAAAGTATTTCCTATAAAGGGG + Intronic
914821060 1:151103367-151103389 AAAAAGTTTTTCCTTTAAAGTGG - Intronic
916604924 1:166331730-166331752 AACAGGTCTTTGATATAAACTGG + Intergenic
918152057 1:181806103-181806125 AAGAGGTTCTTGCTTTAAAGCGG + Intronic
920938085 1:210454758-210454780 AACACATCTTTCCTTTAAAGAGG + Intronic
921743260 1:218710053-218710075 AAGAGGTATCTCATATGAAGAGG - Intergenic
922084051 1:222328503-222328525 AAAATGTCTTTACTAGAAAGAGG - Intergenic
922321725 1:224494658-224494680 AAGAGGTCTTTAAGATAAAGTGG - Intronic
922869450 1:228890071-228890093 AAGTGGTTTTTCATATAACGTGG - Intergenic
923286691 1:232502956-232502978 AGGAGGTCTTTCCTGAAAGGGGG - Intronic
923730402 1:236544350-236544372 TAGAGCTATTTCCTAGAAAGTGG + Intronic
924532142 1:244902380-244902402 AGGTGGTCCTTCCTATATAGTGG - Intergenic
1071455450 10:85847140-85847162 AAGAGCCCTTTCCTAGAAATTGG - Intronic
1071830739 10:89369662-89369684 TAGAAGTGTTTCCTATATAGAGG + Intronic
1075940308 10:126385981-126386003 AAGAGATTTTTCCTATAATGTGG + Intronic
1076518575 10:131063975-131063997 AAGAGTTCTTTAAAATAAAGAGG - Intergenic
1076612328 10:131734107-131734129 CAGAGGTATTTCCTTCAAAGTGG - Intergenic
1078826581 11:14935787-14935809 AAGAGGTTTCTCCTCTAAGGAGG + Intronic
1079217941 11:18531186-18531208 AAGAAGTCTTGGCTATTAAGGGG - Exonic
1079585052 11:22115556-22115578 AAGAGAGCTTTGCTATAAAGAGG - Intergenic
1081248641 11:40801422-40801444 AAGAAGTAATTGCTATAAAGTGG - Intronic
1081419443 11:42856152-42856174 AATAGGTTATTCATATAAAGGGG + Intergenic
1082672297 11:56049333-56049355 AAGTTTTCTTTCTTATAAAGTGG - Intergenic
1088101198 11:106158061-106158083 AAGAAATCTTTCATATAAATGGG + Intergenic
1089705063 11:120271876-120271898 GACAGATCTTTCCTTTAAAGAGG + Intronic
1092476915 12:8827433-8827455 AAGAGGTATTGACTTTAAAGAGG - Intronic
1092846313 12:12588436-12588458 AAGGGGTCTTTCCTCTATAAGGG + Intergenic
1095851094 12:46807430-46807452 CCCAGGTCTTTCCTAAAAAGTGG + Intronic
1096043569 12:48542204-48542226 AAGGGGTGGTTCCGATAAAGAGG + Intergenic
1096151986 12:49320130-49320152 AAGAGGTCTTTACTAGATTGGGG + Intergenic
1097438072 12:59575261-59575283 GATAGGTTTTTCCTAAAAAGAGG - Intergenic
1097651699 12:62306490-62306512 AAGTGGTCTTTGTTATACAGTGG + Intronic
1098395478 12:70012378-70012400 AAGAGTTCTTGGCTTTAAAGAGG + Intergenic
1105579351 13:21679275-21679297 AAGAGCTATTTCTTCTAAAGGGG - Intronic
1106299331 13:28449745-28449767 AAGAGCTCTTTTTTAGAAAGAGG - Intronic
1106343888 13:28857488-28857510 AAGAGGGTTTTCATATCAAGAGG + Intronic
1108722213 13:53143865-53143887 AAGGGAAATTTCCTATAAAGTGG - Intergenic
1109468529 13:62772884-62772906 AGCAGGTCTCTCCTAGAAAGTGG - Intergenic
1110201487 13:72855341-72855363 AAGAAGTCATTCCTATAATGTGG + Intronic
1114148797 14:20010635-20010657 AAAATGTCTTTCCTATAAACGGG - Intergenic
1114411831 14:22508061-22508083 AAAAGGTGTTTTCTATAAACAGG + Intergenic
1115159518 14:30377786-30377808 AAGAGGTCTTTCCAATGCAAAGG - Intergenic
1115597492 14:34923267-34923289 ATGTGGTCTTTCCTTCAAAGAGG - Intergenic
1115760790 14:36578444-36578466 ATAAGGTCCTTCCTTTAAAGAGG - Intergenic
1116109588 14:40560449-40560471 AAGATGTTTTTCCTATTCAGTGG + Intergenic
1116598658 14:46888885-46888907 AATAGGAGTTTCCTATAAAATGG - Intronic
1117794054 14:59373570-59373592 ATCAGCTGTTTCCTATAAAGTGG + Intergenic
1120256830 14:82130944-82130966 AAGATGACTTTGCCATAAAGAGG - Intergenic
1122734187 14:103826417-103826439 AACAGGGCTTTCACATAAAGAGG + Intronic
1124708182 15:31982888-31982910 AAGGAGTGTTTCCTATAAAAAGG - Intergenic
1126044997 15:44631328-44631350 AAGATGTCTATAGTATAAAGTGG + Intronic
1126184001 15:45812857-45812879 AAGAGGTATTTACCTTAAAGAGG + Intergenic
1126543365 15:49845558-49845580 ACAAGGTGTTTCCAATAAAGGGG + Intergenic
1126835191 15:52655758-52655780 AAGGGGTCTTTCCAATCATGAGG - Intronic
1128650344 15:69407439-69407461 AATAGGTGTTTCATATAAAAAGG - Exonic
1130696952 15:86140467-86140489 AAGGGGTCTTTCATAAAAGGTGG - Intergenic
1134477027 16:14583095-14583117 AAGCGGTCTTTGCTGTAAAGTGG - Intronic
1135700749 16:24630572-24630594 AAAATATTTTTCCTATAAAGAGG - Intergenic
1138224126 16:55277967-55277989 AAGAGGTGGTTGCTATGAAGAGG - Intergenic
1144076098 17:11720923-11720945 CTGAGGTCATTTCTATAAAGGGG - Intronic
1149085526 17:52710641-52710663 AAGAGGACCTGCCTATAGAGAGG + Intergenic
1150781201 17:68123785-68123807 AAAAAGTCCTTCCTCTAAAGTGG + Intergenic
1153589864 18:6662016-6662038 AAGAGGAATTTCCTATAAAGTGG - Intergenic
1154423848 18:14257222-14257244 ATGAGGAATTTCCTATAAACAGG + Intergenic
1155272517 18:24154336-24154358 AAAAGGGCTTTCCTAAAAACTGG + Intronic
1161266058 19:3365396-3365418 AAGGGTTCTCCCCTATAAAGTGG - Intronic
1168411443 19:56142675-56142697 AAGAGCTCCTTCCTCTCAAGAGG - Intronic
927114997 2:19890876-19890898 AAAAGAGCTTTCCAATAAAGTGG + Intergenic
927539370 2:23894166-23894188 TAGAAGTCTTTCATATAAAAAGG - Intronic
928964415 2:36963141-36963163 AATAGGTTTTTGCTATAACGTGG + Intronic
929038077 2:37714802-37714824 AAGAAGTAATTCGTATAAAGAGG - Intronic
930624767 2:53684642-53684664 ATGAGATGTTTCCTATAAACTGG - Intronic
931829213 2:66033621-66033643 CAGTGGACTTTCCTCTAAAGTGG + Intergenic
934168401 2:89318434-89318456 CAGAGGACTTTCATATTAAGAGG + Intergenic
934198886 2:89864148-89864170 CAGAGGACTTTCATATTAAGAGG - Intergenic
935455148 2:103258592-103258614 CAGAGGTCCATCCTTTAAAGTGG + Intergenic
938316731 2:130334593-130334615 AAGAGATCTTTGTTATAAAGTGG + Intergenic
939352591 2:141059043-141059065 AAGATGTCTAACCTATAAAGAGG + Exonic
940189842 2:151028958-151028980 AAGTGTTCTTTCCTATAAGAGGG + Intronic
940622844 2:156134485-156134507 ATTTGGTCTTTCCTTTAAAGCGG - Intergenic
941097993 2:161263223-161263245 CAGAGGTCTTTCCTGAAAAGAGG + Intergenic
942227084 2:173826490-173826512 CAGAGGTGTTTCCTGTACAGGGG + Intergenic
942557221 2:177184411-177184433 AAGATGTCCTTCCTTTAAATGGG - Intergenic
945791796 2:214314634-214314656 AAGAGGATATTCCAATAAAGTGG + Intronic
947706593 2:232281485-232281507 AAGAGATCTTTCTAAAAAAGAGG - Intronic
947792053 2:232873964-232873986 CAGAGGTCTTTTCTGGAAAGGGG + Intronic
1169473532 20:5909720-5909742 AAGATGTGTTTCCTAAAAACAGG + Intergenic
1169651386 20:7871465-7871487 AAGAGTTAGTTCCTAAAAAGTGG - Intergenic
1171094558 20:22318948-22318970 AAGAGGTCTTCCTTTGAAAGTGG + Intergenic
1172135167 20:32681703-32681725 AAGAGGTCTGCCCTGTACAGTGG - Intergenic
1177536581 21:22435978-22436000 AAGATTTGTTTCCTATAAAACGG + Intergenic
1179208684 21:39307725-39307747 AAGAGGTTTTTGTTTTAAAGGGG - Intronic
1182248728 22:28982603-28982625 CAGAGGCCTTTCCTATTAACTGG - Intronic
1184304079 22:43583276-43583298 AAGAGGGCTTTTCTTTAATGGGG - Intronic
949806771 3:7964057-7964079 AAAATGTATTTCCCATAAAGAGG - Intergenic
954640112 3:52092864-52092886 AAGAGGCCTTTCAGATGAAGAGG - Intronic
955156439 3:56421380-56421402 AAAAGGTCTTTCTGAGAAAGGGG - Intronic
955618915 3:60840062-60840084 AAGATATCTTTCCTCTAAAGAGG - Intronic
956006537 3:64784578-64784600 TATAGGTTTTTCCTATAAATGGG + Intergenic
958552550 3:95635874-95635896 AAGAGGTCTATTGTATATAGAGG - Intergenic
959927543 3:111940709-111940731 AAAAGGTGTTTACTTTAAAGGGG - Intronic
965450722 3:168834466-168834488 AAGAGGACGTTCCTAGAAAGGGG - Intergenic
965490532 3:169329994-169330016 AAGAAGACTTTCTTAAAAAGGGG + Intronic
965802910 3:172512769-172512791 AAAGGGTCTTTCCTACAATGTGG + Intronic
966168680 3:177052104-177052126 AAGATGTATTTACTATAATGGGG - Intronic
968236626 3:197035173-197035195 AAAAATTCTTTCCTATAAAGAGG - Intergenic
970153392 4:13115553-13115575 GAAAAGTCTTGCCTATAAAGGGG + Intergenic
970967116 4:21941474-21941496 AATAGGTCTTTACTACAAAAAGG - Intronic
971108349 4:23552669-23552691 AGGAGATATGTCCTATAAAGAGG - Intergenic
971383344 4:26119965-26119987 AAGAGAACCTACCTATAAAGTGG - Intergenic
974612587 4:64234937-64234959 AAGAGCTCTTTGTTATAAAAAGG + Intergenic
979448597 4:120841995-120842017 AAGAAGTATTTACTATGAAGTGG - Intronic
980926278 4:139141374-139141396 ATGAAGTCCTTCGTATAAAGTGG - Intronic
981973465 4:150694154-150694176 AAGATGTCATTCCTATATAATGG + Intronic
983733418 4:171026906-171026928 AATAGGTCATTCCTAGAAATAGG + Intergenic
985265064 4:188149488-188149510 AAGAGGTCTGTGAAATAAAGAGG + Intergenic
985339186 4:188930534-188930556 CAGAGGTTTTTCCCAGAAAGGGG - Intergenic
992123789 5:73621266-73621288 AATTGGTGTTTCCTATAAAATGG + Intergenic
1002390038 5:178903516-178903538 AAGAGGTCTTTCCTATAAAGTGG + Intronic
1003391981 6:5722365-5722387 AAGACGTTTTTCTTGTAAAGGGG + Intronic
1003941062 6:11027454-11027476 AAGAAGTCTTTCCAGTAAGGTGG - Intronic
1007208631 6:40173013-40173035 AAGATGTGTTTCCTTTAGAGAGG + Intergenic
1008038236 6:46770192-46770214 AAAAGGCTTTTCCTAGAAAGGGG + Intergenic
1009441191 6:63680783-63680805 AAGAGGTGTTTTCAATAAAATGG - Intronic
1009716787 6:67408098-67408120 AAGAGGTTTTTCCTAAAATGAGG - Intergenic
1010790346 6:80056941-80056963 AAGAGTACCTTCTTATAAAGAGG + Intergenic
1011884246 6:92074091-92074113 AAGAGGTCTAAACTCTAAAGGGG + Intergenic
1012843741 6:104363344-104363366 AAGAGGTCTCTGCTATAAAATGG + Intergenic
1014676062 6:124367857-124367879 AAGAATTATTTCCTATTAAGTGG - Intronic
1014676179 6:124369399-124369421 AAGAATTATTTCCTATTAAGTGG + Intronic
1021723228 7:23525171-23525193 AAGAAGTCCTTTATATAAAGAGG + Intronic
1021863490 7:24931116-24931138 AATAGGTCTTTTCTAAAAGGAGG + Intronic
1022112828 7:27241798-27241820 AAGAGGTTTTTCGAATGAAGAGG - Intergenic
1025291525 7:57729762-57729784 AAGAGCTCTTTCTTCTAAATGGG - Intergenic
1033403923 7:141053891-141053913 TGGAGGTCATTCCTATCAAGGGG - Intergenic
1038085900 8:24195884-24195906 CAGAGGACTTACCTATAGAGGGG - Intergenic
1042760826 8:72269853-72269875 AAGAGGTGTTTCCTAGAAGGAGG - Intergenic
1046335602 8:112782471-112782493 AAGAGTTATTGCCTTTAAAGAGG + Intronic
1048053108 8:130837884-130837906 AAGATCTCTTGGCTATAAAGTGG + Intronic
1050012429 9:1198813-1198835 CAGAGGCCTTTCCAATAAAAGGG - Intergenic
1050608871 9:7330608-7330630 AAAAGGTCTTTCCTATCCAAGGG + Intergenic
1052068559 9:24053655-24053677 AAGAGGTCCTTCATATAAGAGGG - Intergenic
1055998595 9:82190243-82190265 GAAAGGTCTTTCCAGTAAAGTGG + Intergenic
1057746703 9:97758190-97758212 CAGAGTTCTTGCCCATAAAGGGG - Intergenic
1057781238 9:98052194-98052216 CAGAGGTTTTTCCTAGAATGGGG + Intergenic
1058330947 9:103758573-103758595 AAGAGGTGTATTCTTTAAAGAGG - Intergenic
1062152367 9:135028147-135028169 AAGAGATCTTTCCCATGCAGAGG + Intergenic
1185759772 X:2681459-2681481 AGGAGGTCTCTGCTATAAATTGG + Intergenic
1186259360 X:7760077-7760099 AAGAGGGCTTTCTTATCTAGGGG + Intergenic
1186690060 X:11965889-11965911 AGAAGTTCTTTCCTACAAAGGGG + Intergenic
1188519263 X:31019743-31019765 AGGACGTTTTTGCTATAAAGTGG + Intergenic
1191647788 X:63502023-63502045 AAGAGATCTATTATATAAAGTGG + Intergenic
1193027531 X:76860726-76860748 AGGTGTTCTTTACTATAAAGTGG + Intergenic
1193260959 X:79405545-79405567 AAGAGGTATTGGCTTTAAAGAGG + Intergenic
1193983892 X:88217331-88217353 AAGAGGTCTTTCATCTCCAGTGG + Intergenic
1194616490 X:96110251-96110273 AATAGCTCTTTGCTATAGAGAGG + Intergenic
1195503765 X:105633203-105633225 AAGAGATCTTTTAGATAAAGGGG + Intronic
1198198500 X:134389562-134389584 AAGAGGCCTTCCCTAGAAAAAGG - Intronic
1199050741 X:143233797-143233819 AAGAGGTCTTGGCCTTAAAGAGG + Intergenic