ID: 1002393273

View in Genome Browser
Species Human (GRCh38)
Location 5:178933255-178933277
Sequence GATGCTCTTGTTCCACAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002393273 Original CRISPR GATGCTCTTGTTCCACAATC TGG Intergenic
902745021 1:18468071-18468093 CAGGCTCTTTTTACACAATCAGG + Intergenic
910001488 1:82347750-82347772 GATGCTTTTGTTCATAAATCGGG - Intergenic
918913510 1:190604956-190604978 TTTGCTCTTGTTCCCCAACCTGG + Intergenic
922273459 1:224055495-224055517 TATGCTCTTGTTGCCCAGTCTGG - Intergenic
924859657 1:247908064-247908086 GATACTGTTGTTCTACATTCTGG - Intergenic
1065412928 10:25450182-25450204 GATCCTCTTGTTCCTCACCCTGG - Intronic
1069712479 10:70498896-70498918 TTTGCTCTTGTTGCCCAATCTGG - Intronic
1070379791 10:75870507-75870529 GAAGGGCTTGTTCCAGAATCCGG - Intronic
1072676714 10:97472267-97472289 TTTGCTCTTGTTACACAAGCTGG + Intronic
1073997236 10:109329602-109329624 TATGCTCTTGATCTACAATGTGG - Intergenic
1079008415 11:16809274-16809296 GATGCTCAGCTTCCAGAATCAGG - Intronic
1085658932 11:78344328-78344350 GATGCTGTTTTTCTTCAATCAGG + Intronic
1085851076 11:80121005-80121027 TATGCTCTTTTTCCTCAATAAGG + Intergenic
1089501849 11:118936896-118936918 TTTGCTCTTGTTCCCCAAGCTGG + Intronic
1093276393 12:17133577-17133599 GGTGTTCTCTTTCCACAATCAGG - Intergenic
1095647852 12:44570279-44570301 GATGCTGGTGCTCCACAATTAGG + Intronic
1095987301 12:48007693-48007715 GATGCTCTTCTTCTACCAACTGG - Intergenic
1096155565 12:49339615-49339637 GTTGCTCTTTTCCCACACTCTGG + Intergenic
1097652706 12:62321518-62321540 CATGTATTTGTTCCACAATCTGG - Exonic
1098043828 12:66379787-66379809 GATGCACTTCTTCCCCAAACTGG + Intronic
1098446823 12:70574655-70574677 GATGCTCTTGTTCTACATTTTGG - Intronic
1099743203 12:86668526-86668548 GCTGCTCTTGGTCCACGGTCTGG - Intronic
1100865641 12:98853935-98853957 GGGGCTGTTGTTCCATAATCAGG + Intronic
1101942824 12:109112648-109112670 TATGCTCTTGTTGCCCAGTCTGG - Intergenic
1102204081 12:111078345-111078367 GATGCTCTTGTTCCTTTCTCTGG - Intronic
1107557917 13:41534051-41534073 GATGCTCTTGTTGCAGCTTCAGG + Intergenic
1110121545 13:71887986-71888008 CCTGCTCTTGTTCCACAAAAAGG + Intergenic
1112485634 13:99817078-99817100 GATTCTCTTGTTCCATCACCAGG + Intronic
1112538798 13:100285931-100285953 GATGCACTAGTTCCACTAACTGG - Intronic
1127432771 15:58927297-58927319 GATGATCTTGTTGCCCAAGCTGG + Intronic
1128070765 15:64795430-64795452 TTTGCTCTTGTTGCCCAATCTGG + Intergenic
1129338715 15:74871103-74871125 GATGATCTTTTTCCACCATGAGG - Intronic
1130988823 15:88862663-88862685 GATTGTCTTGCACCACAATCAGG + Intronic
1133147625 16:3801638-3801660 GTTGCTCTTGTTGCACAAGCTGG - Intronic
1133486101 16:6219844-6219866 TTTGCTCTTGTTGCCCAATCTGG - Intronic
1133669114 16:8000177-8000199 TTTGCTCTTGTTCCCCAAGCTGG - Intergenic
1139450877 16:67027542-67027564 TATGCTCTTGTTCCCCAGGCTGG + Intergenic
1141373409 16:83508000-83508022 GTTGCTCTTGTTGCCCAAGCTGG - Intronic
1141438935 16:84016828-84016850 AGTGCTCCTGTTCCACACTCAGG + Intronic
1145234878 17:21201386-21201408 GAGGCTCTTGTCCCACCCTCAGG - Intronic
1146436979 17:32859381-32859403 GATGCTCTTTTTCCATACTCAGG + Intronic
1152006802 17:77687469-77687491 GTTTCTCTTTTTCCACACTCCGG - Intergenic
1152931449 17:83112133-83112155 GACCCTCTGGTTCCACAAGCTGG - Intergenic
1156837602 18:41574266-41574288 GTTGCTCTTGTTGCCCAGTCTGG + Intergenic
1158030320 18:52955678-52955700 GTTCCTCTTGCTCCACAACCTGG + Intronic
1160367823 18:78343840-78343862 GATGGTCCTGCTCCACACTCTGG + Intergenic
1164038991 19:21477950-21477972 TTTGCTCTTGTTGCCCAATCTGG + Intronic
1168101131 19:54141685-54141707 GAGGCTCTTGTTCCTCAGTATGG + Exonic
924987663 2:287177-287199 AATGCTTTTGTGACACAATCAGG - Intronic
926201582 2:10803589-10803611 AATGCTCTTGATCCACAATGTGG - Intronic
927846580 2:26475436-26475458 GATGCTGGTGTTCGACAACCTGG - Exonic
928796940 2:35034294-35034316 CATGTTCTTGTTCCACATCCAGG + Intergenic
932117460 2:69066324-69066346 TTTGCTCTTGTTCCCCAAGCTGG + Intronic
935084648 2:99833121-99833143 GCTTCTCTTGTCCCACCATCCGG + Intronic
935210244 2:100933548-100933570 GATGCTCATGTTCCTCCCTCTGG + Intronic
937908025 2:127061833-127061855 GATGCTCGTGCTCCACAATGAGG + Intronic
940147559 2:150562956-150562978 GATGCTCTTGTCTTAAAATCTGG + Intergenic
940335697 2:152525096-152525118 GATGTTCTCGTTTCACTATCTGG - Intronic
940452317 2:153854549-153854571 TTTGCTCTTGTTCCCCAAGCTGG - Intergenic
942126526 2:172831296-172831318 TTTGCTCTTGTTGCCCAATCTGG + Intronic
946902054 2:224382437-224382459 TTTGCTCTTGTTGCCCAATCTGG + Intronic
947584262 2:231342941-231342963 GATGCTCTTGTTGCCCAGGCTGG + Intronic
1170156339 20:13272846-13272868 GATGTTCTGGTTCCAGAATCAGG + Intronic
1175140430 20:56856780-56856802 TTTGCTCTTGTTCCCCAAGCTGG - Intergenic
1178159110 21:29890814-29890836 GATGCCCTTGTTACACAAAGTGG + Intronic
1181087003 22:20445093-20445115 GATGCTCTTTGACTACAATCAGG + Intronic
1182800012 22:33024370-33024392 GAGGCTCTGATTCCACAAGCTGG + Intronic
1182899761 22:33888076-33888098 AATGCTCCCGTTCCACAGTCAGG + Intronic
1183038984 22:35161960-35161982 GATGCTCTTGTTTCAGAAAAGGG - Intergenic
1183557016 22:38536878-38536900 TTTGCTCTTGTTGCACAAGCTGG + Intronic
1184674182 22:46031557-46031579 TTTGCTCTTGTTGCACAAGCTGG - Intergenic
949112528 3:279514-279536 GGTGCTGTTCTTCCACAATCTGG + Intronic
951067403 3:18283105-18283127 CATGCTCTTATTCCATAAACTGG + Intronic
951541500 3:23786555-23786577 GATGCTCTTGTTGCCCAGGCTGG + Intergenic
952722633 3:36549075-36549097 AATGCTCTTTCTACACAATCAGG + Intergenic
953257007 3:41300665-41300687 GATGCTTTTGTACAACCATCTGG - Intronic
954327652 3:49872367-49872389 TCTGCTCTTGTTCCAAACTCTGG - Intergenic
955147261 3:56332078-56332100 GATCCTCTTGATACACACTCTGG + Intronic
958824855 3:99017803-99017825 GATGCCCTTTTTGCACACTCAGG + Intergenic
959595498 3:108124732-108124754 GCTGTTCTTGTCTCACAATCTGG + Intergenic
972524150 4:39891616-39891638 GTTGCTCTTGTTCCCCAGGCTGG - Intronic
978293075 4:107169564-107169586 GCTGCTCTTGTTCCACTTCCTGG - Intronic
978717092 4:111857766-111857788 GTTGCTCTTGTTCCCCAGTCTGG - Intergenic
979517435 4:121625688-121625710 TATGCTCTTGTTGCCCAAGCTGG - Intergenic
989265859 5:39472920-39472942 GATCCTCTTGGTCTACAATGGGG + Intergenic
991717451 5:69464907-69464929 TATGCTCTTGTTGCCCAAGCTGG - Intergenic
994683452 5:102919424-102919446 TATGCTCCTGTTCCACATCCTGG + Intronic
996222131 5:120947207-120947229 GTTGGTCTTGTTCCACAGTGAGG + Intergenic
996316979 5:122170889-122170911 GAAGCTCTTGTTTCAGAAACAGG + Intronic
996578087 5:124998904-124998926 GTTGCTCTTGTTGCCCAAGCTGG + Intergenic
996817088 5:127586441-127586463 GATGCTGGAGTCCCACAATCTGG - Intergenic
997050212 5:130371343-130371365 TTTGCTCTTGTTCCCCAAGCTGG - Intergenic
997396267 5:133562447-133562469 GAGGCTCTAGTTTCACACTCGGG + Intronic
997548102 5:134728327-134728349 TTTGCTCTTGTTCCCCAAGCTGG - Intergenic
998086347 5:139327889-139327911 TTTGCTCTTGTTCCCCAAGCTGG + Intronic
1002393273 5:178933255-178933277 GATGCTCTTGTTCCACAATCTGG + Intergenic
1003104538 6:3205329-3205351 GTTGCTCTTGTTCCCCAGGCTGG + Intergenic
1009642967 6:66361963-66361985 GCTGGTCTTGTTCCACACACTGG + Intergenic
1010197554 6:73254970-73254992 CTTGCTCTTGTTCCTCAAGCTGG - Intronic
1012936225 6:105370391-105370413 GTTCCTCTTGTTCCACAACGTGG - Intronic
1015156154 6:130098518-130098540 GATGTTCTTTTTACACAATAGGG + Intronic
1018792150 6:167157078-167157100 GATGCACATCTTCCAGAATCTGG - Exonic
1027953547 7:84850942-84850964 TATGCTCATTTTCCACAATAAGG + Intergenic
1031994387 7:128219778-128219800 ACTGCTCTTGTTCCTCCATCAGG - Intergenic
1044155889 8:88846496-88846518 GATGTTCTTCTTCCAAAATCTGG - Intergenic
1050282569 9:4066425-4066447 TATACTCTTGTTTCACAACCAGG - Intronic
1050606371 9:7305597-7305619 GGGGCTCTTGGTCCACAATGAGG - Intergenic
1055038956 9:71848097-71848119 AATGCTCTCATTGCACAATCTGG - Intergenic
1055734911 9:79316495-79316517 TCTGCTCTTGTTCCTCATTCAGG - Intergenic
1058415933 9:104788610-104788632 GATACTCTGGTTAGACAATCTGG + Intronic
1059776413 9:117479754-117479776 GATGCTTTTGTTGGACAATTAGG - Intergenic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1188478514 X:30612420-30612442 GTTGCTCTTGTTGCCCAAGCTGG - Intergenic
1198810408 X:140530493-140530515 GATGCTATTGTTGCACACACAGG - Intergenic
1198969185 X:142261979-142262001 GAAGTTCTTGTTCCAAATTCTGG + Intergenic
1201253629 Y:12086218-12086240 GATGCTCCTGTTCTAAAATACGG - Intergenic