ID: 1002394284

View in Genome Browser
Species Human (GRCh38)
Location 5:178941172-178941194
Sequence CTGCGCTTGCGCGTTGCCCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1002394284_1002394291 28 Left 1002394284 5:178941172-178941194 CCCAGGGCAACGCGCAAGCGCAG 0: 1
1: 0
2: 0
3: 3
4: 55
Right 1002394291 5:178941223-178941245 ATTGTGTTCTGACTGCGATGTGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1002394284 Original CRISPR CTGCGCTTGCGCGTTGCCCT GGG (reversed) Exonic
904754439 1:32760375-32760397 GTGCGCATGCGCGTGGCCTTGGG + Intronic
911601181 1:99849950-99849972 CGGCGCTTTCTCCTTGCCCTGGG - Intergenic
915600542 1:156920591-156920613 CTGCGGTTGCCCCTTTCCCTCGG + Intergenic
1063028506 10:2207760-2207782 CTGCGCATGCGCATTTCCCAGGG + Intergenic
1073259257 10:102176211-102176233 CTGGGCTTGCGTGTGGCCCGAGG + Intergenic
1075046739 10:119152243-119152265 CTGCATTTGCGCTTTCCCCTGGG - Intronic
1094844358 12:34354945-34354967 CTGCGCATGCGCGGGGCCCAGGG - Intergenic
1094849837 12:34377427-34377449 CTGCGCATGCGTGTTGCCCAGGG - Intergenic
1095852290 12:46824020-46824042 CTGCCCTTGATAGTTGCCCTTGG + Intronic
1096916661 12:55040248-55040270 CAGCGCTTCCGAGTTGCTCTCGG - Intergenic
1116862103 14:50003231-50003253 CCGCACTTGCCCGTTGCCATGGG - Intronic
1121853051 14:97240309-97240331 CTGCGCTTGCGCTTCAGCCTGGG + Intergenic
1128950898 15:71880447-71880469 CTTCGCTTGCGCTTAGCCTTTGG + Exonic
1141767074 16:86065736-86065758 CTGTGTTTGCGCCTGGCCCTTGG + Intergenic
1141948589 16:87326262-87326284 CTGGGCTCTCGCGTTGCCCGAGG + Intronic
1143161294 17:4873154-4873176 CTGCTCTCACGTGTTGCCCTTGG + Intronic
1161672678 19:5622917-5622939 CAGCGCTTGCGCGTTGTGCCGGG - Exonic
1166350723 19:42196804-42196826 CTGCGCTGGCGCAGTGCACTTGG - Intergenic
1166737150 19:45092890-45092912 TCGCGCTTGCGCGCTGCTCTTGG + Intronic
929974314 2:46617037-46617059 CTGCGCCTGCGCGTGGGCCTGGG - Exonic
933925789 2:87090552-87090574 CTGGGGTTGCGGGTTGCCATAGG + Intergenic
945148709 2:206765331-206765353 GTGCGCCTGCGCCTTGCCCTTGG - Exonic
1172539359 20:35699182-35699204 CTGCGCCTGCGCGGTACGCTCGG - Exonic
1175908070 20:62391617-62391639 CTGCCCATGCGCCCTGCCCTGGG - Intronic
1176707252 21:10125692-10125714 CAGCCCTTGCGCTGTGCCCTGGG + Intergenic
1178892896 21:36534760-36534782 CTGCTCTTGCTCATTCCCCTGGG + Intronic
1181312532 22:21952893-21952915 CTGCGCCTGCGCGGCGCCCGCGG - Intergenic
1181841580 22:25667327-25667349 CTGCGTTTTCACGTTGCACTGGG - Intronic
1184933595 22:47701330-47701352 CTGAGCTTGTGAGTTTCCCTGGG + Intergenic
968372873 4:11579-11601 CCGCGCCTGCGCCTTGTCCTCGG - Intergenic
969621329 4:8280321-8280343 CTGGGCCTGGGGGTTGCCCTGGG + Intronic
980007872 4:127561825-127561847 CTGCCCTTGCTAGGTGCCCTCGG + Intergenic
985462523 4:190120988-190121010 CCGCGCCTGCGCCTTGTCCTCGG + Intergenic
990233914 5:53745928-53745950 CTGGGCTTGTGCGTGGCCCGAGG - Intergenic
990521792 5:56588255-56588277 CTGGGCTTGCGGGATGGCCTTGG + Intronic
991562228 5:67965791-67965813 CTGCTCCTGCACATTGCCCTGGG - Intergenic
1001086865 5:168706958-168706980 CTGCGCTTGCCCAGTGCCTTTGG + Intronic
1002394284 5:178941172-178941194 CTGCGCTTGCGCGTTGCCCTGGG - Exonic
1004330989 6:14720864-14720886 CTGCCCTTGCCCTTTGACCTTGG - Intergenic
1012873274 6:104696456-104696478 CTGGGCTTTGGAGTTGCCCTAGG - Intergenic
1013272421 6:108557430-108557452 CTGCTATTTCGGGTTGCCCTTGG - Intergenic
1018849939 6:167579686-167579708 CTGCGCTGACCCGTTGCCATTGG + Intergenic
1018997774 6:168723411-168723433 CTGCACTTCCGTCTTGCCCTGGG + Intergenic
1022818344 7:33934790-33934812 ATGCGCTTGGGAGTGGCCCTTGG + Intronic
1029421741 7:100475649-100475671 CTGCTCCTGCGCTCTGCCCTAGG + Intronic
1032189385 7:129755069-129755091 CTGCACTGGTCCGTTGCCCTGGG - Exonic
1049520317 8:143085065-143085087 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520327 8:143085114-143085136 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520337 8:143085163-143085185 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520347 8:143085212-143085234 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520357 8:143085261-143085283 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1049520367 8:143085310-143085332 CTGGGCTGGTGCGTTACCCTGGG - Intergenic
1053761541 9:41352443-41352465 CAGCCCTTGCGCTGTGCCCTGGG - Intergenic
1054325464 9:63710289-63710311 CAGCCCTTGCGCTGTGCCCTGGG + Intergenic
1054540135 9:66263560-66263582 CAGCCCTTGCGCTGTGCCCTGGG - Intergenic
1055334481 9:75219402-75219424 CTGTGCCTGCGGGTTGTCCTGGG + Intergenic
1059452072 9:114376821-114376843 CTGCCCTGCCGCGTTGGCCTGGG + Exonic
1202792000 9_KI270719v1_random:94572-94594 CAGCCCTTGCGCTGTGCCCTGGG + Intergenic
1187669542 X:21655955-21655977 CATCGGCTGCGCGTTGCCCTGGG - Exonic